ID: 1143124230

View in Genome Browser
Species Human (GRCh38)
Location 17:4631481-4631503
Sequence CTCTAGGGAGGGTGGGACAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143124219_1143124230 -7 Left 1143124219 17:4631465-4631487 CCATGAAAAGGTGCCCCTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG 0: 1
1: 0
2: 0
3: 33
4: 341
1143124215_1143124230 28 Left 1143124215 17:4631430-4631452 CCTCTAGAGTAAAATGTGTTCAC 0: 2
1: 0
2: 1
3: 9
4: 142
Right 1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG 0: 1
1: 0
2: 0
3: 33
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143124230 Original CRISPR CTCTAGGGAGGGTGGGACAT GGG Exonic
900165582 1:1243165-1243187 CCCTGGGGAGGGTGGTGCATGGG + Intronic
900355223 1:2258354-2258376 CCCTAGGGAGGATGGGACAGTGG + Intronic
900513949 1:3072643-3072665 CCCCAGGGAGGGTGGGAGAAGGG - Intronic
900685557 1:3945729-3945751 CTCCTGGGAGGGTGAGACCTGGG - Intergenic
900866998 1:5275841-5275863 CTCCAGGGAGGGTGGGGGTTGGG + Intergenic
901146861 1:7070689-7070711 CTCTGGGCAGGGTGGGTTATAGG + Intronic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
902237757 1:15068562-15068584 CTCCAGGGAGGGTGGGATCGTGG - Intronic
902335327 1:15751268-15751290 CCCTCGGGTGGGTGGGACCTGGG - Intergenic
903363632 1:22792774-22792796 CTCTAGGCTGGGTGGGCCTTGGG - Intronic
903516354 1:23913514-23913536 CTCTGGCCAGGGTGGGGCATGGG + Intergenic
903579377 1:24359375-24359397 CTCCAGAGAGGGTAGGGCATAGG - Intronic
903825920 1:26145755-26145777 CCCTAGGAAGGGTGGGAGCTTGG + Intergenic
904612995 1:31735517-31735539 GTGCAGGGAGGGAGGGACATGGG - Intronic
905975528 1:42171172-42171194 CTACAGGGAGGGTAGGGCATGGG + Intergenic
906311892 1:44760189-44760211 CTCTAGGAAGGGAGGGACACAGG - Intronic
906374538 1:45284676-45284698 CTCTGGGGAGTGTTGGACAGTGG + Intronic
906396195 1:45467452-45467474 CTCTAGGGAGGCTGAGGCAGGGG - Intronic
907842275 1:58169704-58169726 CTATAGGGAGGCTAGGATATGGG - Intronic
910227511 1:84951074-84951096 CTCTGGGGTGGGTGGGCCAGAGG - Intronic
911298902 1:96149977-96149999 CTATAGGGAGGCTAGGATATGGG - Intergenic
912021228 1:105111088-105111110 CTATAGGGAGGCTAGGATATGGG - Intergenic
913469446 1:119174363-119174385 CTATAGGGAGGCTAGGATATGGG - Intergenic
915564683 1:156706866-156706888 GTCTGGGGAGGGTGGGGGATGGG - Intergenic
916083556 1:161252197-161252219 CTATAGGGAGGCTAGGATATGGG - Intergenic
916114364 1:161474633-161474655 CTATAGGGAGGCTAGGATATGGG - Intergenic
916350464 1:163843852-163843874 CTCTAAGGATGGTGGGACAAAGG - Intergenic
916720637 1:167482639-167482661 TTCTAGGGAGGCTGGGACCTCGG + Intronic
916939454 1:169664077-169664099 CTATAGGGAGGCTGGGATATGGG - Intronic
917279815 1:173369916-173369938 CTATAGGGAGGCTAGGAAATGGG - Intergenic
917281079 1:173378762-173378784 CTATAGGGAGGCTGGGATATGGG - Intergenic
917445871 1:175105450-175105472 CTATAGGGAGGCTAGGATATGGG + Intronic
917676207 1:177321682-177321704 CTATAGGGAGGCTAGGATATGGG - Intergenic
919420605 1:197365492-197365514 CTCTGGGGAGGGGGGGAGAAGGG + Intronic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
921019630 1:211224253-211224275 CTATAGGGAGGCTAGGATATGGG - Intergenic
921070579 1:211654796-211654818 CTCTAGGGGGTGGGGGACACTGG + Intergenic
1062985151 10:1761531-1761553 CTCTCGGGAGGGTGGGAGGAGGG + Intergenic
1063592754 10:7408977-7408999 CTCTAGGGAAGGTGGGGGATGGG - Intronic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064603633 10:17016779-17016801 CTATAGGGAGGCTAGGATATGGG + Intronic
1065385345 10:25128241-25128263 ATCTAGTGAGGGTGGGCCTTAGG - Intergenic
1065523496 10:26594249-26594271 CTCTTGTGGGGGTGGGGCATAGG - Intergenic
1065529429 10:26653370-26653392 CTGTTGGGGGGGTGGGGCATAGG - Intergenic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1066614639 10:37282566-37282588 CTATAGGGAGGCTAGGATATGGG + Intronic
1067149297 10:43716814-43716836 CTCTAGGGAGTGTTGGAAAGTGG + Intergenic
1067479974 10:46588278-46588300 CTGTGGGGAGGGTGGGCCATGGG - Intronic
1067614763 10:47753519-47753541 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1068500244 10:57834746-57834768 CTATAGGGAGGCTAGGATATGGG - Intergenic
1069137400 10:64782753-64782775 CTATAGGGAGGCTAGGATATTGG + Intergenic
1069622144 10:69844248-69844270 GTCCAGGGAGGATGGGCCATAGG + Intronic
1071630169 10:87213482-87213504 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1072738984 10:97898299-97898321 GCCTAGGGAGAGTGGGTCATGGG + Intronic
1073604841 10:104883785-104883807 CTCTAAGGAGGCTGGGAGGTAGG + Intronic
1073970692 10:109043337-109043359 CTATAGGGAGGCTAGGATATGGG - Intergenic
1074612973 10:115039110-115039132 CTATAGGGAGGCTAGGATATGGG - Intergenic
1075146271 10:119885580-119885602 CTATAGGGAGGCTAGGATATAGG - Intronic
1076551566 10:131281618-131281640 CTCTAGGGAGGGTTTGCCTTTGG - Intronic
1077094882 11:795085-795107 CTTGAGGGAGGGTGGGACCCAGG + Exonic
1077774074 11:5252473-5252495 TTCTAGGGAGGTGGGGACTTAGG - Intronic
1078405780 11:11068702-11068724 GTGTAGGGAGCATGGGACATGGG + Intergenic
1078451289 11:11442832-11442854 CCCCTGGGAGGGAGGGACATGGG + Intronic
1079121969 11:17692384-17692406 CACTTGGGAGGATGTGACATGGG + Intergenic
1079356742 11:19736136-19736158 CTATAGAGAGGGTGAGATATAGG - Intronic
1079731286 11:23939524-23939546 CTATAGGGAGGCTAGGATATGGG + Intergenic
1079811721 11:25005245-25005267 CTATAGGGAGGCTAGGATATGGG + Intronic
1080437489 11:32259165-32259187 CTGAAGGGAGGGAGGGACAGAGG - Intergenic
1081145943 11:39562752-39562774 CTATAGGGAGGCTAGGATATGGG - Intergenic
1081421361 11:42877029-42877051 CTATAGGGAGGCTAGGATATGGG - Intergenic
1081674693 11:44961940-44961962 CTCTAAGGAGGGTTGGAAAGGGG + Intergenic
1083656285 11:64231215-64231237 CTCTGTGGGGGGTGGGAGATGGG + Intronic
1084149933 11:67283311-67283333 CTCCAAGGAGGCTGGGACCTTGG - Intronic
1084210940 11:67622087-67622109 CTATAGGGAGGCTGGGATATGGG - Intergenic
1085077001 11:73600112-73600134 TTCTAGGGAAGGTAGGACTTTGG - Intergenic
1085330357 11:75644220-75644242 ATCTAGGGAGGGGAAGACATAGG + Intronic
1086061282 11:82702313-82702335 CTCTGGGGAGGGCGTGACCTTGG - Intergenic
1086268955 11:85036344-85036366 TTCTAGTGGGGGTGGGAGATGGG - Intronic
1087066176 11:94030073-94030095 CTATAGGGAAGGATGGACATTGG - Intronic
1087074945 11:94120237-94120259 CTATAGGGAGGATAGGATATGGG - Intergenic
1087459056 11:98422940-98422962 CTATAGGGAGGCTAGGATATGGG + Intergenic
1087683389 11:101238612-101238634 CTATAGGGAGGCTAGGATATGGG + Intergenic
1088492487 11:110401439-110401461 CTATAGGGAGGCTAGGATATGGG - Intergenic
1088837216 11:113587930-113587952 CTCTTTGGAGGGTGGGAACTGGG - Intergenic
1089278083 11:117353110-117353132 CTGAAGAGAGGGAGGGACATAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091396596 12:157231-157253 CTATCAGGAGGGTTGGACATTGG + Intronic
1091590282 12:1838739-1838761 GTCTAGGAAGGATGGGACAGGGG - Intronic
1091781178 12:3215542-3215564 CTCTAGGAAGGCTGAGAGATGGG - Intronic
1092340259 12:7669981-7670003 CTCCAGGGTGGGTGGGAGGTGGG - Intergenic
1092472242 12:8790326-8790348 CTATAGGGAGGCTAGGATATGGG - Intergenic
1093229048 12:16520592-16520614 CAATAGGGAGGTTGGGCCATAGG + Intronic
1093571184 12:20667948-20667970 CTCTAGGGAGTGCGAGACAGTGG + Intronic
1093580626 12:20781234-20781256 CTATAGGGAGGCTAGGATATGGG + Intergenic
1094338163 12:29383701-29383723 CTATAGGGAGGCTAGGATATGGG + Intergenic
1094479597 12:30871127-30871149 CTCTAGAGAAAGTGAGACATGGG - Intergenic
1095356986 12:41286419-41286441 CTCTAAGGAGGTTGGGAGAGTGG - Intronic
1095982980 12:47983245-47983267 ATCTGTGGAGGCTGGGACATGGG + Intronic
1096021285 12:48327590-48327612 TTCTTGGGAGGGTGAGACACAGG + Intergenic
1096110692 12:49027389-49027411 CTTTTGGGAGGGTGGCATATGGG - Intronic
1096631395 12:52928940-52928962 CTGTAGTGGGTGTGGGACATGGG - Intronic
1097428245 12:59472920-59472942 CTATAGGGAGGCTAGGATATGGG - Intergenic
1099414794 12:82372404-82372426 CTATAGGGAGGCTAGGATATGGG + Intronic
1100049022 12:90421780-90421802 CTCTTGGGAAGCTGGAACATTGG + Intergenic
1100209733 12:92388643-92388665 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1101704827 12:107211904-107211926 CTATAGGGAGGCTAGGATATGGG - Intergenic
1102720291 12:115010128-115010150 CTAAAGGGAGTGGGGGACATGGG + Intergenic
1102990208 12:117310027-117310049 CTCCAGGGTGGCTGGGACAACGG + Intronic
1103607246 12:122096534-122096556 GTCCTGGGAGGGTGGGACAGTGG - Intronic
1104038404 12:125114273-125114295 CTCTTGGGGGAGAGGGACATGGG + Intronic
1104306124 12:127612309-127612331 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1105762427 13:23526887-23526909 CTATAGGGAGGCTAGGATATGGG - Intergenic
1106162638 13:27214771-27214793 CTATAGGGAGGCTAGGATATGGG - Intergenic
1107549028 13:41457932-41457954 GTGGAGGGAAGGTGGGACATGGG - Intronic
1109500981 13:63235934-63235956 CTATAGGGAGGCTAGGACATGGG - Intergenic
1112519064 13:100080330-100080352 CTATAGGGAGGCTAGGATATGGG - Intergenic
1112538313 13:100282846-100282868 CTATAGGGAGGCTAGGATATGGG - Intronic
1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG + Intronic
1113551559 13:111196717-111196739 CTATAGGGAGGCTAGGATATGGG + Intronic
1113605252 13:111600238-111600260 CTCCAGTGATGGTGGCACATGGG + Intronic
1113988735 13:114341254-114341276 CTCTTTGGAGGGTGGGACCCCGG + Intergenic
1114570644 14:23665038-23665060 CCCTAGGGAGGGAGGTACCTGGG + Intergenic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115285513 14:31709884-31709906 CTATAGGGAGGCTAGGATATGGG + Intronic
1116366377 14:44070555-44070577 CTCAAGGGAGGATAGCACATAGG - Intergenic
1116835214 14:49763688-49763710 TACTAGGGAGGGTGAGACACAGG - Intergenic
1119645072 14:76342034-76342056 TGCTAGGCAGGTTGGGACATGGG + Intronic
1119743988 14:77031620-77031642 CTCTGGGGAGGGTTGGATAGGGG - Intergenic
1121224976 14:92315091-92315113 CTCCAGGAAGGCTGGGACATGGG - Intergenic
1122794418 14:104198831-104198853 CTGTTGAGAGGGTGGGATATTGG + Intergenic
1124493492 15:30172617-30172639 CTCTAGGGTGTGGGGGACAGTGG + Intergenic
1124750042 15:32365708-32365730 CTCTAGGGTGTGGGGGACAGTGG - Intergenic
1125595819 15:40885436-40885458 CTTTAGGGAGCATGGGAAATGGG - Intergenic
1126072125 15:44874363-44874385 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1127439142 15:58988322-58988344 CTCTAGGGAGAGTCGGAAGTGGG - Intronic
1127814631 15:62597049-62597071 CTTTAGGGAGGCAGGGAGATGGG - Intronic
1128252734 15:66174328-66174350 CTCTTGGGAGGGATGGAGATAGG - Intronic
1128806239 15:70533126-70533148 CTTCAGGAAGGGTGGGACCTGGG - Intergenic
1129468324 15:75736753-75736775 CTGTGGGGAGGGTGAGGCATAGG - Intergenic
1129727252 15:77907747-77907769 CTGTGGGGAGGGTGGGGCATAGG + Intergenic
1129840628 15:78741271-78741293 CTGTGGGGAGGGTGGGGCATAGG - Intergenic
1129995697 15:80003287-80003309 CGCAAGGGAGGGTGGGGGATAGG + Intergenic
1130270403 15:82443303-82443325 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130275565 15:82474528-82474550 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130462748 15:84170622-84170644 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130467924 15:84201920-84201942 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130485762 15:84397587-84397609 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130489929 15:84424165-84424187 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130496342 15:84471622-84471644 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130501517 15:84502915-84502937 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130590216 15:85206518-85206540 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130905572 15:88238515-88238537 CTCTAGGGAGAGAGGGAGAGAGG - Intronic
1131084794 15:89567090-89567112 TGCAAGGGAGGCTGGGACATTGG - Intergenic
1132626388 16:893638-893660 CACTGGGGAAGGTGGGACTTGGG + Intronic
1135153289 16:20029683-20029705 CCCTGGGGAGCGTGGGAGATGGG + Intergenic
1135339732 16:21635399-21635421 CTATAGGGAGGCTAGGATATGGG + Intronic
1135643784 16:24143543-24143565 AGCTAGGGAGGGAGGGGCATGGG + Intronic
1135790451 16:25389476-25389498 CTCTGAGGAGTGTGGGACCTGGG + Intergenic
1137481682 16:48856993-48857015 CTCTGGGGTGGGAGTGACATTGG + Intergenic
1137511178 16:49102059-49102081 CTCAAGGGATGGTGCCACATTGG + Intergenic
1138342492 16:56299338-56299360 CTCTAGGGAGGTAGGGCCCTGGG + Intronic
1138449808 16:57086953-57086975 CTCTGGGGAGGGAGGGTCATGGG - Intergenic
1140793117 16:78411147-78411169 CTCAAGGGTGGGTGAGACCTAGG - Intronic
1142161518 16:88560154-88560176 CTCCAGGAAGGGAGGGACAGTGG - Intergenic
1142642736 17:1294152-1294174 TTCTAGGGAGGGAGGGACACAGG + Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1144029387 17:11305830-11305852 AGCTAGGGAGGCTGGGAGATGGG + Intronic
1147150913 17:38513174-38513196 GACTTGGGAGGGTGGGGCATAGG - Intergenic
1147155401 17:38542207-38542229 CTCTGGGGAGGGAGGGACTAGGG + Intronic
1148075479 17:44933086-44933108 CACTTGCGAGGGTGGGTCATGGG - Intronic
1149073838 17:52575222-52575244 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1151567953 17:74910400-74910422 CTATAGGGAGGCTAGGATATGGG - Intergenic
1152353108 17:79794263-79794285 CTCTAGGGAAGTTGGGCCCTGGG - Exonic
1152898493 17:82926918-82926940 CTCTAGTCAGGGTGGGAAGTGGG + Intronic
1153712494 18:7814158-7814180 CTATAGGGATTGTGGGAGATGGG + Intronic
1154017190 18:10629128-10629150 CTCCAGGGAGGGTGGCACAAAGG - Intergenic
1154187669 18:12200469-12200491 CTCCAGAGAGGGTGGCACAAAGG + Intergenic
1160148871 18:76384597-76384619 CTGTAGGGGGGGTGGGGGATGGG - Intronic
1160350782 18:78176543-78176565 TGCTAGGCAAGGTGGGACATGGG + Intergenic
1161118344 19:2511844-2511866 CCCTGGGGAGGGTGGGAGAGGGG + Exonic
1161182247 19:2891907-2891929 TTCTATGGATGGTGGGGCATTGG - Intergenic
1161901865 19:7125256-7125278 GTCCAGTGGGGGTGGGACATGGG - Intronic
1162018989 19:7860243-7860265 CACTGGTGAGGGTGGGAGATGGG - Intronic
1162107859 19:8381513-8381535 CTGTAGGGAGGCTAGGATATGGG - Intronic
1162932914 19:13966147-13966169 CTGTATGGAGGGTAGGGCATAGG - Intronic
1165826540 19:38708978-38709000 CTTTAGGGTGGTTGGGACCTGGG + Intronic
1167042259 19:47028939-47028961 CTGTAGGGAGGATGGGGCAGGGG + Intronic
1167461163 19:49625419-49625441 CACTGGGGAGGGTGGCACACCGG - Intronic
1167680013 19:50913249-50913271 CTCTGGGCAGGACGGGACATAGG + Intergenic
1168694842 19:58398242-58398264 CTCCAGGGAAGGTGGCATATGGG + Intergenic
924959057 2:17592-17614 CTCTGTGGAGGGTGGGACCCCGG - Intergenic
925579984 2:5400648-5400670 ATCTAGAGAGGCTGGGACATGGG + Intergenic
927877808 2:26670490-26670512 CTCTAGAGAAGGTGGGAGAAGGG + Intergenic
928053659 2:28028366-28028388 GTGTTGGGAGGGTGGGATATTGG - Intronic
928617691 2:33055937-33055959 CTATAGGGAGGCTAGGATATGGG + Intronic
930038456 2:47102624-47102646 CTATAGGGAGGCTAGGATATGGG - Intronic
930427875 2:51234336-51234358 GGCTGGGGTGGGTGGGACATAGG + Intergenic
931450240 2:62362395-62362417 CTCTTGGGAAGGTGGGCCAGGGG + Intergenic
933996042 2:87670744-87670766 CTCTAGAGAGAGTAGGACAGAGG + Intergenic
934867055 2:97823143-97823165 CTATAGGGAGGCTAGGATATGGG - Intronic
936849618 2:116879905-116879927 CTCCAGGGAGGGAGGCAGATGGG - Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
938806254 2:134809360-134809382 CTATAGGGAGGCTAGGATATGGG + Intergenic
939409711 2:141808745-141808767 GGCTAGGTAGGGTGGGACACAGG - Intronic
940418405 2:153449487-153449509 CTCTAGGGCAGGAGGGACAATGG - Intergenic
940973603 2:159920319-159920341 ATCTAGGGAAAGTGGGACACAGG + Intergenic
941243346 2:163068802-163068824 CTATAGGGAGGCTAGGATATAGG - Intergenic
941607425 2:167617114-167617136 ACATATGGAGGGTGGGACATAGG - Intergenic
943085735 2:183308863-183308885 CTATAGAGAGGGTGGGAAAGGGG - Intergenic
943133682 2:183887483-183887505 CTATAGGGAGGCTAGGATATGGG - Intergenic
943405811 2:187482806-187482828 GTCTGGGGAGGGTGTGAAATAGG + Intronic
944663213 2:201938327-201938349 CTCTAAGGAGGCTGGGACTTGGG - Intergenic
946586815 2:221198507-221198529 CTCAAGGGGGAGTGAGACATAGG + Intergenic
1169090270 20:2856575-2856597 CTTTGGGGAGGGTGGTAGATGGG - Intronic
1170819292 20:19742738-19742760 CTCTAGCTAGGGTGTGACCTCGG + Intergenic
1171270578 20:23813862-23813884 CTATAGGGAGGCTAGGATATGGG - Intergenic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1173999665 20:47365205-47365227 CTTTAAGGAGGCTGTGACATTGG + Intergenic
1174269994 20:49361133-49361155 CTCTAGGGACAGGGGGACAGGGG + Intergenic
1175380383 20:58558706-58558728 CACTAGGGAGGGCTGGCCATGGG - Intergenic
1175686159 20:61030191-61030213 ATCTGGGGAGGGTGGGCCAGAGG + Intergenic
1175941158 20:62538106-62538128 GACTAGGGAGCGTGGCACATGGG - Intergenic
1175945532 20:62556789-62556811 CTCTAGGGAGTGAGAGACACCGG - Intronic
1176370061 21:6057065-6057087 ACCGAGGGAGGGAGGGACATGGG - Intergenic
1176870249 21:14078322-14078344 CCCTAGGGAGGGAGGGAGAGAGG + Intergenic
1177704034 21:24677274-24677296 ATCTAGGGAAGCTGGCACATTGG + Intergenic
1178723826 21:35034031-35034053 TTCTAGAGAGGGTGTGACTTTGG - Intronic
1179753458 21:43481476-43481498 ACCGAGGGAGGGAGGGACATGGG + Intergenic
1182167535 22:28191417-28191439 CACTAGGGAGTGTCGGACAGTGG + Intronic
1182453209 22:30433275-30433297 CTCTGGGGAGGCTGGGACAGGGG + Intergenic
1183585890 22:38752722-38752744 CTCTAGAGGAGGTGGGACAGAGG + Intronic
1185004721 22:48269001-48269023 CTGAAGGGTGGGTGGGACCTTGG - Intergenic
951900929 3:27656834-27656856 GTCTAGGGAGGAGGGGACACAGG + Intergenic
952452954 3:33448689-33448711 CTATAGGGAGGCTAGGATATGGG - Intergenic
952555119 3:34522260-34522282 CTATAGGGAGGCTAGGATATGGG + Intergenic
953623014 3:44548861-44548883 CTATAGGGAGGCTAGGATATGGG + Intergenic
954586912 3:51744366-51744388 CTATAGGGAGGCTAGGATATGGG - Intergenic
954598853 3:51852211-51852233 CTATAGGGAGGCTAGGATATGGG - Intergenic
956843034 3:73157456-73157478 CTATAGGGAGGCTAGGATATGGG + Intergenic
956873281 3:73439016-73439038 CACTGAGGAGGGTGGGACAGAGG - Intronic
958575882 3:95949533-95949555 CTATAGGGAGGCTAGGATATGGG + Intergenic
958601318 3:96299831-96299853 CTATAGGGAGGCTAGGATATGGG - Intergenic
958809819 3:98848119-98848141 CTTTTGGGAGGGTGGGAGGTGGG - Intronic
959425647 3:106184650-106184672 ATCTAGGGGAGGTGGGAGATGGG - Intergenic
962866421 3:139451407-139451429 CTCTAGGAAGGTGGGGACAAAGG + Intergenic
963992363 3:151668924-151668946 CTATAGGGAGGCTAGGATATGGG + Intergenic
964098790 3:152964028-152964050 CTCTAGGAAAGGTGGGGCAAGGG - Intergenic
965122300 3:164576604-164576626 CTCTAGGCAAGGAGGGCCATTGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967583542 3:191187488-191187510 CTATAGGGAGGCTAGGATATGGG - Intergenic
968374544 4:28040-28062 CTCTGTGGAGGGTGGGACCCCGG - Intergenic
968500668 4:948360-948382 CTCCTGGGAGGGTGGGAGACTGG + Intronic
968652462 4:1765689-1765711 CTCTAGGGAGGCCTGGACAGAGG - Intergenic
969586587 4:8097560-8097582 CTCTAGCGAGGGTGGGAGGCTGG - Intronic
971281285 4:25244323-25244345 CTATAGGGAGGCTAGGATATGGG + Intronic
971418787 4:26456872-26456894 CTCGAGGGAGGCAGGGATATGGG + Intergenic
971578398 4:28305066-28305088 CTCTAGGAAGGCTAGGATATGGG - Intergenic
972642006 4:40933648-40933670 CTCTACGTAGGGAGGGAGATAGG + Intronic
974187238 4:58460145-58460167 CTATAGGGAGGCTAGGATATGGG - Intergenic
974838925 4:67280246-67280268 CTATAGGGAGGCTAGGATATGGG + Intergenic
975595924 4:76048128-76048150 CTATAGGGAGGCTAGGATATGGG + Intronic
975640930 4:76499668-76499690 CACTGGGGAGGAGGGGACATGGG + Intronic
976174394 4:82336984-82337006 CTATAGGGAGGCTAGGATATGGG + Intergenic
977834998 4:101636216-101636238 CTATAGGGAGGCTAGGATATGGG + Intronic
977884017 4:102237364-102237386 CTATAGGGAGGCTAGGATATGGG - Intergenic
978747100 4:112207507-112207529 CTATAGGGAGGCTAGGATATGGG - Intergenic
981706245 4:147662321-147662343 CTCTAGGGAGAGTGGGGCACTGG + Intronic
982559538 4:156913569-156913591 CTCAAGAGAGGGAGGGAAATAGG - Intronic
984917367 4:184736491-184736513 CTATAGGGAGGCTAGGATATGGG - Intergenic
985789365 5:1916886-1916908 CCCTGGAGAGGGAGGGACATGGG + Intergenic
986990460 5:13546589-13546611 CTCTAGAGAGGGAGGGCCTTTGG - Intergenic
987929816 5:24389236-24389258 CTATAGGGAGGCTAGGATATGGG - Intergenic
989496162 5:42113370-42113392 CTATAGGGAGGCTAGGATATGGG - Intergenic
989589043 5:43096342-43096364 CTCAAGGGAGGCTGTGACTTGGG + Intronic
989957266 5:50372395-50372417 CTATAGGGAGGCTAGGATATGGG - Intergenic
995583504 5:113623745-113623767 CTATAGGGAGGCTAGGATATGGG + Intergenic
995706354 5:114992442-114992464 CTATAGGGAGGCTAGGATATGGG - Intergenic
997072315 5:130635655-130635677 CTATAGGGAGGCTAGGATATGGG - Intergenic
998146975 5:139734544-139734566 TTCTGGGGAGGGTGGGAGCTCGG + Intergenic
1001423114 5:171601756-171601778 CTCCAGGGTGGGTGGGAGATGGG + Intergenic
1001517160 5:172364035-172364057 CTCCAGGGAGGCTGTGCCATGGG + Intronic
1001715159 5:173809538-173809560 ATCTAGGGAGGGTAACACATTGG - Intergenic
1002327466 5:178419190-178419212 CTCTAGGGACTGAGGGACAGAGG - Intronic
1003805705 6:9724356-9724378 CTATAGGGAGGCTAGGATATGGG - Intronic
1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG + Intergenic
1004471559 6:15934002-15934024 CTCTAGGGAGAGTGGGAAACAGG - Intergenic
1004495174 6:16156178-16156200 CTGGAGGCAGGGTGGGCCATGGG + Intergenic
1004812153 6:19273274-19273296 CTATAGGGAGGCTAGGATATGGG - Intergenic
1006221697 6:32497085-32497107 CTATAGGGAGGCTAGGATATTGG - Intergenic
1006617351 6:35339586-35339608 CTCCAGAGAGGGTGGGACAGAGG + Intergenic
1007883293 6:45191609-45191631 CTGTAGGGAGGGTGGCAGGTAGG + Intronic
1008566854 6:52777238-52777260 CACTAGGGAGTGTGGGACAGTGG - Intergenic
1009662329 6:66630941-66630963 CACTAGGGAGTGTGAGACAGTGG + Intergenic
1010455141 6:76045580-76045602 CTCTAGTGAGGATGGGGCAGAGG - Intronic
1010645451 6:78382362-78382384 GTCTAGGGGGTGAGGGACATGGG + Intergenic
1010856538 6:80847853-80847875 CACTAGGGAGTGTGAGACAGTGG + Intergenic
1011375133 6:86679328-86679350 CTATAGGGAGGCTAGGATATGGG + Intergenic
1012441645 6:99266752-99266774 CTATAGGGAGGCTAGGATATGGG + Intergenic
1012643781 6:101654695-101654717 ATCTTGGGTGGGTGGGACACGGG - Intronic
1013256805 6:108395759-108395781 CTTGAGGGAGGGAGGGAGATAGG + Intronic
1013463473 6:110398096-110398118 CTCATGGGAGGTTGGGACAATGG - Intronic
1013907938 6:115239089-115239111 CTCTAGGGAGGCTAGGATATGGG + Intergenic
1016183938 6:141178221-141178243 CTATAGGGAGGCTAGGATATGGG - Intergenic
1018975751 6:168563987-168564009 CTCTGGGGTGGGTGGGGCCTTGG + Intronic
1019873761 7:3790856-3790878 GGCTAGGGAGGTTGGGACAGGGG + Intronic
1021634124 7:22674452-22674474 ATCTTGGGAGGGTGGGGCATGGG + Intergenic
1021756814 7:23860021-23860043 CTATAGGGAGGCTAGGATATGGG + Intergenic
1021941612 7:25684755-25684777 CTCTAGGGAGGGTGAGAGGGTGG + Intergenic
1022324005 7:29313501-29313523 CTGTAGGGAGTGTGGGGCCTCGG - Intronic
1022580497 7:31548603-31548625 CTCCAGGAAGGGTGGAAGATTGG + Intronic
1023849197 7:44140826-44140848 CTCTAGGGAAGGTGGGAGGTGGG + Intronic
1028495314 7:91454266-91454288 CTATAGGGAGGCTAGGATATGGG + Intergenic
1029158672 7:98535417-98535439 CTGTAGGGAAGTGGGGACATTGG + Intergenic
1029180692 7:98699488-98699510 CACTAGGGAGGGTTAGACAGAGG - Intergenic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1030420427 7:109301260-109301282 CTATAGGGAGGCTAGGATATGGG - Intergenic
1030940900 7:115648538-115648560 CTCTAGGGTGGGTTGGATTTTGG - Intergenic
1031731687 7:125309883-125309905 CTATAGGGAGGCTAGGATATGGG - Intergenic
1032670586 7:134078991-134079013 CTCGATGGAGGGTGGGATGTGGG - Intergenic
1033759344 7:144422863-144422885 CTATTGGGAGGCTGGGATATGGG + Intergenic
1034580067 7:152034222-152034244 CTATAGGGAGGATAGGATATGGG + Intronic
1039497895 8:37994911-37994933 CTCTAGAGTGGCTGGGACACAGG + Intergenic
1039800932 8:40953798-40953820 CACTAGGGAGGGTGACACTTGGG - Intergenic
1040279444 8:46031417-46031439 CCCTAGGGAGGGAGGGAGAGAGG + Intergenic
1040667968 8:49654945-49654967 CTATAGGGAGGCTAGGATATGGG + Intergenic
1041795422 8:61742609-61742631 CTTCAGGGAGGGTGTGACCTTGG + Intergenic
1044456722 8:92398832-92398854 CTATAGGGAGGCTAGGATATGGG + Intergenic
1045421718 8:102022974-102022996 CTGAAGGGAGGGTGTGAGATGGG - Intronic
1047368455 8:124234573-124234595 CTGTAGGGAGGCTGAGATATGGG - Intergenic
1048292339 8:133190745-133190767 CTGTAGGGAGGGGGGAGCATGGG - Intergenic
1049121153 8:140739317-140739339 CTCTATAGAGGGAAGGACATTGG - Intronic
1049172383 8:141169604-141169626 CTCTGGGGAGGGAGGGAGAGAGG - Intronic
1049264574 8:141660552-141660574 CTCGAGGGAGGGTGGGAGCTTGG + Intergenic
1050268791 9:3919477-3919499 CTGTTGGGAGGGTGGAAGATGGG + Intronic
1050361846 9:4837824-4837846 CTCCAGGGAGGGAGGAACTTGGG - Intronic
1051935173 9:22436600-22436622 CTATAGGGAGGCTAGGATATGGG - Intergenic
1057189210 9:93077046-93077068 CACTAGGGAGCATGGGAAATGGG + Intronic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1058698829 9:107584388-107584410 GACTAGGGAGGGTGGGAAAGTGG - Intergenic
1058698990 9:107585534-107585556 GACTAGGGAGGGTGGGAAAGTGG + Intergenic
1060011339 9:120045210-120045232 CTGAAGGGAGGCTGGGACACTGG + Intergenic
1061236775 9:129347787-129347809 CTCTTGGGAGGGTGAGTCATTGG + Intergenic
1061371168 9:130198326-130198348 GTCAAGGGAGAGTGGGACTTCGG + Intronic
1061807931 9:133146942-133146964 CTCAAGGGAGGCTGGGACTGGGG - Intronic
1062264227 9:135679564-135679586 CTCTAGGGAGGGGTGGGGATAGG - Intergenic
1062332903 9:136052405-136052427 CTCCAGCGAGGGTGGGGAATGGG + Intronic
1062562075 9:137146189-137146211 CTCCAGGGAGCGAGGGGCATGGG - Intronic
1203574675 Un_KI270744v1:166110-166132 CTCTGTGGAGGGTGGGACCCCGG + Intergenic
1188665747 X:32818790-32818812 CCCTAGAGAGGGTGTGACATTGG - Intronic
1189263420 X:39694482-39694504 CTCCAGGGAGGGAGGCACAGGGG - Intergenic
1189551896 X:42101970-42101992 TTCTAGGGTTGGTGGGGCATGGG + Intergenic
1190745419 X:53319633-53319655 CTCTTGGGTTGGTGGGACATGGG - Intronic
1191838013 X:65486089-65486111 CTCTCAGTAGGGTGGGAGATAGG - Intronic
1193189877 X:78557986-78558008 GTCAGGGGAGGGTGGGGCATAGG - Intergenic
1195439468 X:104884811-104884833 CTATAGGGAGGCTAGGATATGGG - Intronic
1199832512 X:151560157-151560179 CTATAGGGAGGCTAGGATATGGG + Intergenic
1201403674 Y:13629867-13629889 CTATAGGGAGGCTAGGATATGGG - Intergenic
1201403948 Y:13631829-13631851 CTATAGGGAGGCTAGGATATGGG - Intergenic
1201496501 Y:14595341-14595363 CTATAGGGAGGCTAGGATATAGG + Intronic
1201568671 Y:15391768-15391790 CTATAGGGAGGCTAGGATATAGG + Intergenic
1201729682 Y:17190588-17190610 CTATAGGGAGGCTAGGATATGGG + Intergenic
1201744081 Y:17351886-17351908 CTATAGGGAGGCTAGGATATGGG + Intergenic
1201975089 Y:19840108-19840130 CACTGGGGAGGGTTGGACAGTGG - Intergenic
1202242786 Y:22788211-22788233 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202272160 Y:23082871-23082893 CTATAGGGAGGCTAGGATATGGG + Intergenic
1202293866 Y:23337811-23337833 CTATAGGGAGGCTAGGATATGGG - Intergenic
1202368261 Y:24181207-24181229 CTGTGGGGAGGGTGGGGCACCGG - Intergenic
1202372436 Y:24207975-24207997 CTGTGGGGAGGGTGGGGCACCGG + Intergenic
1202395773 Y:24421961-24421983 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202425157 Y:24716615-24716637 CTATAGGGAGGCTAGGATATGGG + Intergenic
1202445632 Y:24953470-24953492 CTATAGGGAGGCTAGGATATGGG - Intergenic
1202475012 Y:25248131-25248153 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1202498349 Y:25462145-25462167 CTGTGGGGAGGGTGGGGCACCGG - Intergenic
1202502524 Y:25488910-25488932 CTGTGGGGAGGGTGGGGCACCGG + Intergenic