ID: 1143127048

View in Genome Browser
Species Human (GRCh38)
Location 17:4648982-4649004
Sequence CTGACTATACAAAAGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 1, 2: 18, 3: 73, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143127048 Original CRISPR CTGACTATACAAAAGGACAA TGG (reversed) Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905981910 1:42236364-42236386 CTGTCTCTACAAAAAGATAAAGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909552181 1:76910834-76910856 CTGACTATACATTAGGTAAATGG + Intronic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914387079 1:147180191-147180213 CTGACTATACAACATGACACTGG - Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918062379 1:181073107-181073129 ATGACTATGTACAAGGACAAGGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920919866 1:210289757-210289779 CTGACCATAGAAAAGGAAATGGG - Intergenic
921178324 1:212612273-212612295 CTGACTTTACATAAGAAGAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923922564 1:238584121-238584143 GAGACTAAAGAAAAGGACAAGGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1064157795 10:12917785-12917807 CAGACTCAACAAAAGGACTACGG - Intronic
1065231928 10:23607199-23607221 CTTTCTATACAAAAGCATAAGGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067858653 10:49820971-49820993 GTGCCTATACAAAAGGCCAGTGG - Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074931152 10:118127623-118127645 CTGACTATTTGAAAGGAGAATGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075598520 10:123749743-123749765 CTGACTTTACAAAGGGTGAAAGG - Intronic
1076049717 10:127322717-127322739 CTGACAATACAAAAAGTGAATGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076084144 10:127610433-127610455 CTAACTAAACAAAAGCAGAAAGG - Intergenic
1077322913 11:1950401-1950423 CAGACTTTAGAAAAGGCCAATGG - Intronic
1078456721 11:11481518-11481540 CTGACTTTCCCAAGGGACAAGGG + Intronic
1080377740 11:31733531-31733553 CTGACTCTACAGAAGTAAAAAGG + Intronic
1080770903 11:35340401-35340423 CTGACTATACTAAAGCAGATAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082912680 11:58394673-58394695 CTGCCGGTACAAAAGCACAAAGG - Intergenic
1082916318 11:58441946-58441968 CTGATTAAACCAAAGGAGAAAGG + Intergenic
1084409992 11:69001366-69001388 CTGTCTTCACAAAAGGAAAACGG - Intergenic
1085631829 11:78124864-78124886 CTGAGGATACAAAATGATAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1088610624 11:111572875-111572897 CTAACAATACAAAAGGAAATAGG + Intergenic
1089659588 11:119977398-119977420 CTCACTAAACAAAAAGATAACGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1202805931 11_KI270721v1_random:5714-5736 CAGACTTTAGAAAAGGCCAATGG - Intergenic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1093428252 12:19053853-19053875 CTAATTATAAAAAAGAACAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097168000 12:57095922-57095944 GAGACTATGCAAAAGTACAAGGG - Exonic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098669688 12:73210495-73210517 CATACTATTCAAAAAGACAATGG + Intergenic
1099343127 12:81464088-81464110 CTGTCTTTAAAAAAGGACAGGGG + Intronic
1099433306 12:82614855-82614877 CAGCCTATACAAAGGGACAGGGG - Intergenic
1101206706 12:102495668-102495690 CTGACTCTTCACAAGGAAAATGG + Intergenic
1101335961 12:103797166-103797188 CTAATAATAAAAAAGGACAATGG + Intronic
1101347513 12:103900342-103900364 CTGTCTCTACTAAATGACAATGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105247729 13:18667623-18667645 CTGGCCATGTAAAAGGACAAGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108936037 13:55880677-55880699 CTGACTATAAAAAATGCCAAAGG - Intergenic
1109549372 13:63873181-63873203 TTGATAATACAAAAGGAAAATGG - Intergenic
1109590440 13:64473611-64473633 CTAAGTATACAAAATGACATTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112159486 13:96853047-96853069 CTGACTATAGGAACAGACAAGGG + Intergenic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1117878895 14:60287657-60287679 CACACCATAGAAAAGGACAAAGG + Intronic
1119250350 14:73147354-73147376 CTTATTTTACAAAAGGAGAAGGG - Intronic
1120932990 14:89867227-89867249 CTGACTAAAAAACAAGACAAAGG - Intronic
1122335668 14:100978587-100978609 ATGACTATATAAAAGGATAGAGG + Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1127972987 15:63976845-63976867 CTGACTAAACAAAAAGAAATAGG - Intronic
1128096882 15:64963567-64963589 CTGACTATACAAGAACACACCGG + Exonic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132681181 16:1142511-1142533 CTGACTTTAAAAAAAGAAAAAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137256989 16:46783888-46783910 CTGACCATACAGAAACACAAAGG + Intronic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144277338 17:13686085-13686107 ATTACCATACAAAAGGAAAAAGG - Intergenic
1144491406 17:15714040-15714062 CTGTTTATACCAAAGAACAATGG - Intronic
1144909079 17:18665163-18665185 CTGTTTATACCAAAGAACAATGG + Intronic
1145851942 17:28108249-28108271 CTGACAATCCAAAAGTATAAAGG + Intronic
1146136724 17:30328474-30328496 CTTACAATTCAAAATGACAAAGG + Intronic
1148947951 17:51282063-51282085 CTGTCTATCCCAAAGGACCATGG + Intronic
1149268347 17:54951879-54951901 CTGACTCTCCACAAGGACACAGG + Intronic
1150201966 17:63366762-63366784 TTGACTATAAAACAGCACAAGGG + Intronic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1152920408 17:83063831-83063853 TTGACCATAGAACAGGACAATGG - Intergenic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1154345708 18:13542069-13542091 CTGATTCTAAAAAAGGAAAAAGG + Intronic
1154441113 18:14391496-14391518 CTGGCCATGTAAAAGGACAAGGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156137183 18:34056692-34056714 CTGACTCAAGAAAAGGACATGGG + Intronic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157458632 18:47862872-47862894 CTGATTATACAATACTACAAAGG + Intronic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159658442 18:71061527-71061549 CTTTCTATACTCAAGGACAAAGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160888118 19:1361792-1361814 CTGACTATGGAACAGGACAGAGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164508141 19:28876017-28876039 CTTACTGTACAGTAGGACAATGG + Intergenic
1165464748 19:35967186-35967208 TTGACTGTAGCAAAGGACAAGGG + Intergenic
1167823052 19:51947546-51947568 CTGAGTATAGGAGAGGACAAGGG - Intronic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
1168167397 19:54560085-54560107 CTTATTATACAAGAGAACAAAGG + Intergenic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927385482 2:22528388-22528410 CTGACAATATAAAATGACAATGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929371975 2:41236476-41236498 CTGACTAAAAAATAGGTCAAAGG + Intergenic
931495339 2:62800136-62800158 ATCACTACAAAAAAGGACAAGGG - Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932326500 2:70865583-70865605 CTGTCTCTACAAAAATACAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933677892 2:85074026-85074048 CTGACTTTACAAAACTAAAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935862750 2:107350644-107350666 CTGACTATACTATAGGACTAAGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939171662 2:138703105-138703127 CTGACGATATAAAAGAAAAATGG - Intronic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940071290 2:149690964-149690986 CTGACAGCACACAAGGACAAAGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
945264729 2:207879732-207879754 CTCTCTAAACAAGAGGACAACGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1168893590 20:1309255-1309277 CTGTCTGAACAAAAGGACAAAGG - Exonic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171564320 20:26164972-26164994 ATTACTTTACAAAAGGAAAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175356894 20:58375615-58375637 CTGACTAGTCAGAAGGACAGTGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176454943 21:6899680-6899702 CTGGCCATGTAAAAGGACAAGGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176833116 21:13764728-13764750 CTGGCCATGTAAAAGGACAAGGG - Intergenic
1177523267 21:22258897-22258919 CAGACTATACAAAAGTATAGAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1184991789 22:48175238-48175260 CTAACTATAGAAAAAAACAATGG + Intergenic
951364778 3:21768179-21768201 TTGATTATGAAAAAGGACAAAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952546551 3:34426158-34426180 CTGAAAATACAAGAGGACCAAGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953957894 3:47245643-47245665 CAGACCAGACAAAAGGACAAAGG + Intronic
954521164 3:51227972-51227994 CTGATTACAGCAAAGGACAAAGG + Exonic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956342754 3:68245031-68245053 CTGACTATACAACAAAATAAAGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
958906455 3:99947247-99947269 GAAACTATACAAAAGGTCAAGGG - Intronic
961943887 3:130665521-130665543 ATGTCTTTTCAAAAGGACAAAGG + Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
965924709 3:173963585-173963607 CTGAGAAGAAAAAAGGACAAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966317523 3:178664896-178664918 CGATCTATACAAAAGAACAAAGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971986782 4:33836294-33836316 ATTACTTTACAAAAGGAAAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974900061 4:67985516-67985538 GTGACTATACAAAAGGCAAAGGG + Intergenic
976780597 4:88754427-88754449 CTTACTATACAAAAGAAAACCGG + Intronic
979327124 4:119393345-119393367 CTCACTATAAAAAAGCCCAAGGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981621417 4:146703936-146703958 CTTGGTATGCAAAAGGACAAAGG - Intergenic
981674344 4:147324035-147324057 CTGACTCTATAAAAGTACCATGG - Intergenic
982409969 4:155063896-155063918 ATGACTATACGAAATAACAAAGG - Intergenic
983201643 4:164866847-164866869 ATGATTATAGCAAAGGACAACGG - Intergenic
983245006 4:165278033-165278055 CTCACTATAAAAAAGCCCAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987398510 5:17449663-17449685 CTTACTACACAAAAGCATAATGG + Intergenic
987445503 5:18013470-18013492 CTGGCTATTCAAAAGGAAAGGGG + Intergenic
987446620 5:18027598-18027620 GTGACTATTCAATAGGACAATGG - Intergenic
991231137 5:64333674-64333696 CTCAGAATACAAAAAGACAAGGG - Intronic
992132899 5:73712329-73712351 CTCACAATTCACAAGGACAAAGG - Intronic
992570478 5:78050232-78050254 GTGTCTATAAAAAAGGAAAAAGG - Intronic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
994658516 5:102624738-102624760 CAGACTAAACAACAGGAAAATGG - Intergenic
994742302 5:103635442-103635464 ATGACTCTACAAAAGTACATAGG - Intergenic
994783380 5:104121525-104121547 ATTACTATAGAAAAGTACAAGGG + Intergenic
995232051 5:109777226-109777248 CTGACAATACAAACTGAGAAAGG - Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999901295 5:156089451-156089473 TTCACTATACAAAATGACAACGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000897676 5:166875363-166875385 CTTACTATACAAGAGAAAAAAGG + Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005231826 6:23710507-23710529 GCAACTATACAAAAGGACTAAGG + Intergenic
1005563904 6:27069562-27069584 CTGACTTTGCCAAAGGAAAAGGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007896911 6:45372107-45372129 CTGACTATGCCAAACCACAATGG + Intronic
1008143948 6:47866731-47866753 TTAACTATTAAAAAGGACAAGGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009861250 6:69335880-69335902 CTGATTATAAAAAAGAAGAAAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1013432743 6:110069604-110069626 TAGACTATAGAAAAGGGCAAGGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014405895 6:121050113-121050135 CATTGTATACAAAAGGACAACGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018583358 6:165328263-165328285 GTGACTAAAGAAAAAGACAAAGG + Intronic
1018772514 6:166984306-166984328 CTGACTCTGTAAAAGGACACAGG + Intergenic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1023000685 7:35804330-35804352 CTGATGATGCAAAAGGACACAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025273412 7:57549247-57549269 ATTACTTTACAAAAGGAAAATGG - Intergenic
1027409790 7:77904290-77904312 TTGACTAAACAAAAGGGAAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1031057507 7:117009719-117009741 ATGACTATAAAAAAGGACATTGG - Intronic
1031429173 7:121645291-121645313 TTGATTATAAACAAGGACAAGGG - Intergenic
1032685416 7:134228471-134228493 CTGACTATATAAAACAGCAATGG + Intronic
1032967270 7:137113386-137113408 GAGACTACACAACAGGACAATGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041384388 8:57283590-57283612 CGGTATATACAATAGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042360966 8:67882625-67882647 CTGACTTTCCAAAAGAGCAAAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1045124656 8:99075697-99075719 CTGATACTACAAAATGACAAAGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1051590115 9:18769144-18769166 CTGACTGTACCCAAGGACACTGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1057239237 9:93393383-93393405 CTGACTGTTGAAAGGGACAAGGG - Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057750196 9:97786648-97786670 CTGCCTATACAACAAGAGAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1203625097 Un_KI270750v1:9912-9934 ATTACTTTACAAAAGGAAAATGG - Intergenic
1186867136 X:13731992-13732014 TCAACTGTACAAAAGGACAAGGG + Intronic
1187942578 X:24396282-24396304 CTTACAATACAAAAGAAGAAAGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188376034 X:29429075-29429097 CTGACATTATGAAAGGACAAAGG - Intronic
1188489993 X:30727492-30727514 CTCACTATAAAAAAGCCCAAGGG - Exonic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1189067046 X:37821128-37821150 ATGACAATATAAAAGCACAATGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1192808573 X:74530668-74530690 CTGAGTAAGCAAAAGGCCAAGGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195037908 X:100986953-100986975 CTGACTATAGAATGGGCCAAGGG - Intronic
1195123239 X:101778928-101778950 CTCACTATAAAAAAGCCCAAGGG + Intergenic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1196202559 X:112901919-112901941 CTCAGTAAACAAAATGACAAAGG - Intergenic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1197224252 X:123940533-123940555 CTGACTTTTTAAAAGGAGAATGG + Intergenic
1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202142494 Y:21742981-21743003 CTGTCTAAACAAAAGAAAAATGG + Intergenic
1202144364 Y:21762637-21762659 CTGTCTAAACAAAAGAAAAATGG - Intergenic