ID: 1143130382

View in Genome Browser
Species Human (GRCh38)
Location 17:4673619-4673641
Sequence TCATCAAGGAGGAGACTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143130382_1143130396 27 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130396 17:4673669-4673691 TGAGGCCTGGGGAAGAAGAATGG 0: 1
1: 0
2: 6
3: 84
4: 757
1143130382_1143130388 3 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130388 17:4673645-4673667 GCCCACACATGAGGATGGTCCGG 0: 1
1: 0
2: 0
3: 9
4: 123
1143130382_1143130386 -6 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130386 17:4673636-4673658 TGATGAGAGGCCCACACATGAGG 0: 1
1: 0
2: 3
3: 9
4: 123
1143130382_1143130392 14 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130392 17:4673656-4673678 AGGATGGTCCGGCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 206
1143130382_1143130394 16 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130394 17:4673658-4673680 GATGGTCCGGCTGAGGCCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 192
1143130382_1143130391 9 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130391 17:4673651-4673673 ACATGAGGATGGTCCGGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1143130382_1143130393 15 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130393 17:4673657-4673679 GGATGGTCCGGCTGAGGCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 413
1143130382_1143130387 -2 Left 1143130382 17:4673619-4673641 CCTGTGAGTCTCCTCCTTGATGA 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1143130387 17:4673640-4673662 GAGAGGCCCACACATGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143130382 Original CRISPR TCATCAAGGAGGAGACTCAC AGG (reversed) Exonic
900029452 1:360270-360292 TCATCAAGGAGAAGGCTCAAAGG - Intergenic
900050054 1:589043-589065 TCATCAAGGAGAAGGCTCAAAGG - Intergenic
900249460 1:1659886-1659908 TCCTCAAAGTGCAGACTCACTGG + Intronic
900260396 1:1725197-1725219 TCCTCAAAGTGCAGACTCACTGG + Intronic
902168545 1:14592408-14592430 TCATGAAGTTGGAGACTCACCGG - Intergenic
903068672 1:20715790-20715812 TCCTCAAGGAGTTGACTCTCTGG + Intronic
903582513 1:24382430-24382452 TCATGAAAGTGGAGACTCCCTGG - Intronic
905398185 1:37681245-37681267 TCATCAAGAAGGAGTTCCACAGG + Intergenic
906096368 1:43226879-43226901 TCTTCAACCAGGAGAGTCACAGG + Intronic
906349532 1:45046046-45046068 TGAGCAAGCAGGAGAATCACAGG + Intronic
907447066 1:54514958-54514980 TCAACAAAGAGGAAATTCACTGG - Intergenic
907602802 1:55787579-55787601 TCATCAGGGACAAGACTCCCTGG + Intergenic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
913034123 1:114945172-114945194 TCCTCAAGGATGTGACACACAGG - Intronic
915108736 1:153549729-153549751 TCAGAAATGAGGAGACTCAGAGG + Intronic
918635176 1:186765939-186765961 TCAGACAGGAGGAGACTCTCTGG - Intergenic
919856045 1:201706884-201706906 TCAGGAAGAAGGAGACTCATGGG - Intronic
920044159 1:203122677-203122699 TCCTCAAGGAGGAGAATCTTGGG - Intronic
920223988 1:204424766-204424788 TTCACAAGGAGGAGTCTCACAGG + Exonic
920266884 1:204730632-204730654 TCGTCAAGCAGAAGACTCAGAGG + Intergenic
920649448 1:207825803-207825825 TCCTGAAGGAGGAGGCTCCCTGG - Intergenic
921912883 1:220571384-220571406 ACATAGAGGAGGAGAATCACAGG + Intronic
1065148004 10:22791945-22791967 ACAACAATGAGGAAACTCACAGG - Intergenic
1067751172 10:48972254-48972276 TCATCACTGAAGAGCCTCACAGG + Intronic
1067854607 10:49781401-49781423 TCATCATGGAAGAGACCCAAGGG + Intergenic
1076805025 10:132851198-132851220 TCATCTGGGAGGAGGCCCACGGG - Exonic
1077713340 11:4557398-4557420 TCCTCAAGGAGGCCACTCAGTGG + Intergenic
1082683421 11:56208068-56208090 TTTTGAAGGAAGAGACTCACAGG - Intergenic
1083377367 11:62235626-62235648 ATATCAAGGAGCAAACTCACTGG + Intergenic
1084792542 11:71483670-71483692 ATATCTAGGAGGAGAATCACTGG - Intronic
1087945329 11:104153275-104153297 TCATTAAAAAGGACACTCACTGG + Intronic
1088734694 11:112719085-112719107 TAAACAAGAAGGATACTCACTGG + Intergenic
1089413450 11:118266622-118266644 TTAGCCAGCAGGAGACTCACTGG + Intergenic
1094041139 12:26122702-26122724 CCATCAAGCAGGAGCCTCCCGGG - Exonic
1094207329 12:27854208-27854230 ACATCAATGAGGAGAATAACTGG - Intergenic
1094227238 12:28059813-28059835 TGCTCAAGGAGGAAACTCATGGG - Intergenic
1099075141 12:78097147-78097169 TCAGCAATGAGGAGACTGCCTGG + Intronic
1100328746 12:93566515-93566537 CCATAATGGAGGACACTCACTGG - Intergenic
1106154908 13:27145199-27145221 TCTTCAAGAAGGAAACTCACTGG - Intronic
1108974278 13:56418426-56418448 ACATCAAGGAAGACACACACCGG - Intergenic
1109947029 13:69448253-69448275 TCACCAAGGAGGAAAGTCACTGG - Intergenic
1110972437 13:81781983-81782005 ACATTAAGCTGGAGACTCACAGG + Intergenic
1113869161 13:113547493-113547515 TCATCTCGGAGGAGGCCCACTGG + Intronic
1115903287 14:38178451-38178473 TCATAAAGGAGGAGACCCAGGGG - Intergenic
1117726385 14:58678844-58678866 TCATCAAGGAGATGACCCAAAGG + Intergenic
1117755695 14:58971985-58972007 TGGACAAGGAGGAGACCCACTGG - Intergenic
1118997510 14:70850102-70850124 TGAGCAAGGAGGAGACTCGGAGG + Intergenic
1122013053 14:98769587-98769609 TCCTCAATGAGGACACTCAGAGG - Intergenic
1125310435 15:38373092-38373114 TAATCTAGGAGGGGAGTCACAGG - Intergenic
1133932970 16:10247333-10247355 ACTTGAAGGAGGAGACACACAGG + Intergenic
1136500803 16:30668958-30668980 TCACCAAGGAGGAGAAGGACAGG + Exonic
1137866181 16:51899024-51899046 TCATCAAGGGGAAGACTGGCAGG - Intergenic
1138456400 16:57123512-57123534 TCTTCAGGGAGGACCCTCACTGG - Intronic
1141073003 16:80975172-80975194 TCAGCAGAGAGGAGACACACTGG + Exonic
1143130382 17:4673619-4673641 TCATCAAGGAGGAGACTCACAGG - Exonic
1144145781 17:12396749-12396771 CCAGCAAGGAGGAGAGTGACAGG + Intergenic
1144868593 17:18353785-18353807 TCATTAAGAAGGAGAGTAACCGG - Exonic
1147474211 17:40694679-40694701 TCACCCAGGAGGAGACAAACTGG - Intergenic
1148040951 17:44706979-44707001 TCCTCAGGGAGGAGTCCCACTGG + Intergenic
1148204711 17:45772873-45772895 GGACCAGGGAGGAGACTCACTGG - Intergenic
1151382483 17:73735373-73735395 TCATCCAGGAAAACACTCACTGG - Intergenic
1152252809 17:79220573-79220595 TCATCAAGCAGGGGACCCAGGGG + Intronic
1152950305 17:83226286-83226308 TCATCAAGGAGAAGGCTCAAAGG + Intergenic
1156354152 18:36327229-36327251 TCATCAAAGATAAAACTCACTGG + Intronic
1158883454 18:61803554-61803576 TCATCAAGCTGGAGACCCAGGGG - Intergenic
1160050352 18:75427583-75427605 TCATCAAGGAGACCTCTCACTGG - Exonic
1160337618 18:78056865-78056887 TCATGAAGGAGGAGACTTCATGG - Intergenic
1161023272 19:2021772-2021794 TCCACAAGGAAGAGCCTCACTGG - Intronic
1161437255 19:4271054-4271076 TCAACAAGGATGGGACTCACTGG + Intergenic
1164481067 19:28611381-28611403 TGATCAAGGTGGAAGCTCACTGG - Intergenic
1166348893 19:42184636-42184658 TTAGCAAGGAGGAGACTGTCAGG - Intronic
927699984 2:25261849-25261871 TCCTCATGGAGGGGACGCACAGG - Intronic
928197330 2:29225211-29225233 TCAGCCAGGAGGATACACACGGG + Intronic
928291095 2:30037954-30037976 TCAGCCAGGAGGAGCCACACTGG + Intergenic
929192508 2:39152612-39152634 CCTTCAAGGAGGAAACTCAGTGG - Intergenic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
935948269 2:108305567-108305589 TCATGAAGGAGGAAATTGACTGG - Exonic
938074186 2:128323077-128323099 CCATCTGGGAGGAGACCCACTGG - Intergenic
938746197 2:134280712-134280734 TTATCAATGAGGAAACTGACTGG - Intronic
938901357 2:135801002-135801024 TCACCAAGGAGGAAACTGAAAGG - Intronic
1169916253 20:10686696-10686718 TCTTCAAGGAGGAGGCGCAAGGG - Intergenic
1172131532 20:32659305-32659327 TCACCAAGGAGGAGAAGCCCTGG + Intergenic
1175459381 20:59140380-59140402 TCAACCAGGAGCAGACTCTCTGG - Intergenic
1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG + Intergenic
1178580802 21:33836525-33836547 TCAACAAGGAGGACCCTGACTGG + Exonic
1179572755 21:42287505-42287527 TCCTCAAGGAGGAGTCCCTCAGG + Intronic
1183381279 22:37491693-37491715 TCCTCAAGGAGGAAGCTCTCAGG + Intronic
1184573408 22:45341781-45341803 TCATCAATGGGGAGTGTCACAGG - Exonic
949193798 3:1281802-1281824 TCAGCAAGAATGAGTCTCACAGG + Intronic
949482676 3:4508976-4508998 TCATCAAGTAGAGGAATCACAGG + Intronic
951783721 3:26393961-26393983 TCATAAAGGAGGATTCTGACTGG + Intergenic
957623655 3:82629161-82629183 TCATCAAGACTGAGACACACTGG - Intergenic
960542161 3:118872903-118872925 TCTTCAAGGAGCATAGTCACAGG + Intergenic
963669685 3:148235998-148236020 TCAAAAAGGAGGAAACTCAAAGG + Intergenic
967604866 3:191433255-191433277 TGATGAAGGAGGAAACTCATGGG + Intergenic
968165354 3:196460349-196460371 TCTTCTAGAAGTAGACTCACTGG + Intergenic
968843070 4:3022424-3022446 TCATCAAGGAGAATATTCTCAGG - Exonic
969954645 4:10876198-10876220 TCAGAACGGAGGAGACTCATTGG - Intergenic
972275735 4:37555918-37555940 TGTTTAAGGAGGAGACTCAGGGG - Intronic
979668772 4:123340676-123340698 TCGGGAAGGAGGAGACTCTCTGG - Intergenic
986501426 5:8404069-8404091 TCATTAAGGAAGAAACTCATTGG - Intergenic
987229616 5:15880027-15880049 TCCTCAAGGTGGAGTCTCTCTGG - Intronic
988680902 5:33482703-33482725 TCATGAAGCATGAGATTCACAGG + Intergenic
989723287 5:44554592-44554614 TCATTAAGGAGGAGAGGCAGAGG - Intergenic
990926714 5:61033980-61034002 TCATCAAGGAGAAAATTGACTGG + Intronic
991571392 5:68057476-68057498 TCATCCAGGAGCAAACTCATTGG + Intergenic
996790186 5:127284214-127284236 GCATCTGGGAGGAGACTCATGGG + Intergenic
997853224 5:137351308-137351330 TCATCAACGAGGAGCCTGAGTGG - Intronic
999141293 5:149364093-149364115 TCATGCTGGAGGAGACTGACTGG + Exonic
1000434912 5:161196383-161196405 TCATCAAGTAGGAGACACATTGG + Intergenic
1000523964 5:162332265-162332287 TGATCAAGGAGGGCACACACTGG + Intergenic
1001337322 5:170809870-170809892 TGAACAAGGATAAGACTCACTGG - Intronic
1002570473 5:180136909-180136931 ACGCCAATGAGGAGACTCACTGG + Intronic
1002744538 5:181460101-181460123 TCATCAAGGAGAAGGCTCAAAGG + Intergenic
1004468201 6:15905305-15905327 TCATCCAGAAGCAGACTCCCTGG - Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1006954784 6:37858795-37858817 TCCTCAAGGAGTAAACACACTGG - Intronic
1013167672 6:107608276-107608298 TCACCAACGAGGAAACTCAGAGG - Intronic
1013180394 6:107712439-107712461 TCTTTAAGGAGGAGGCTCTCAGG + Intronic
1017034800 6:150257596-150257618 TCCTCAATGAGGAAAATCACTGG - Intergenic
1019249448 6:170733641-170733663 TCATCAAGGAGAAGGCTCAAAGG + Intergenic
1023684719 7:42722468-42722490 TGATCAAGGAGGATACCCTCTGG + Intergenic
1028488415 7:91385006-91385028 TCAGCAAGGAGGAGTAGCACAGG - Intergenic
1029110782 7:98212165-98212187 TCAGCAAGGAGGAGGCTGCCAGG + Intronic
1030388686 7:108898802-108898824 TCATTTAGCAGGAGACTCACAGG - Intergenic
1034075272 7:148225472-148225494 TGAGCAAGGAGGAGAGTAACAGG + Intronic
1034638197 7:152584309-152584331 TCATCAATTAGAAGACTCAATGG - Intergenic
1035498648 8:74008-74030 TCATCAAGGAGAAGGCTCAAAGG - Intronic
1036792557 8:11731129-11731151 TCTTCCAGGAGGAAACTCAGAGG - Intronic
1043540676 8:81258783-81258805 TCATCAAGGAGTATACTAAAGGG + Intergenic
1044259233 8:90098358-90098380 TCCTGAAGGTGGAGACTTACTGG + Intergenic
1046126963 8:109921899-109921921 TCTTCAAGGAATTGACTCACAGG + Intergenic
1048027423 8:130599443-130599465 GCCTCGAGGTGGAGACTCACAGG - Intergenic
1050038187 9:1460252-1460274 TCAGAAAGGTGGAGACTCCCAGG + Intergenic
1050642932 9:7687729-7687751 TCAACAAGGAGAAGATGCACAGG + Intergenic
1053553431 9:39108249-39108271 TCATCAAGCAGGAGACAAGCCGG + Intronic
1053817535 9:41928406-41928428 TCATCAAGCAGGAGACAAGCCGG + Intronic
1054107791 9:61072078-61072100 TCATCAAGCAGGAGACAAGCCGG + Intergenic
1054613066 9:67259047-67259069 TCATCAAGCAGGAGACAAGCCGG - Intergenic
1055999442 9:82198649-82198671 TCAGCAATTAGGAAACTCACTGG + Intergenic
1057941307 9:99287670-99287692 TCAACAAGCAGGGGACCCACTGG - Intergenic
1060794217 9:126503666-126503688 TCTTCCAGGAAGAGACTCAACGG - Exonic
1203610347 Un_KI270748v1:90580-90602 TCATCAAGGAGAAGGCTCAAAGG + Intergenic
1186793599 X:13023149-13023171 TCATCACTGAGGAGACTGAAGGG + Intergenic
1190248714 X:48706993-48707015 TTATCAAGGAGGGGACTGGCTGG - Intronic
1195959234 X:110368381-110368403 TAATCAAAGAGGAGAGTGACAGG - Intronic
1196418588 X:115499590-115499612 CCATCAAGGAGGATACACCCCGG + Intergenic
1200184228 X:154171166-154171188 TCATGAAGGAGGAGACCCCAGGG + Intergenic
1200189881 X:154208294-154208316 TCATGAAGGAGGAGACCCCAGGG + Intergenic
1200195634 X:154246103-154246125 TCATGAAGGAGGAGACCCCAGGG + Intergenic
1200201287 X:154283224-154283246 TCATGAAGGAGGAGACCCCAGGG + Intronic
1201613104 Y:15865157-15865179 TCCTGAAGCAGGGGACTCACAGG - Intergenic
1202176994 Y:22107151-22107173 TCATGGAGGACGACACTCACGGG - Intergenic
1202214367 Y:22479233-22479255 TCATGGAGGACGACACTCACGGG + Intergenic