ID: 1143130804

View in Genome Browser
Species Human (GRCh38)
Location 17:4675824-4675846
Sequence AAATCCTGGATTTCATCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143130804_1143130809 -2 Left 1143130804 17:4675824-4675846 CCGGCAGATGAAATCCAGGATTT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1143130809 17:4675845-4675867 TTCCTGCACAGGGACGGACACGG 0: 1
1: 0
2: 0
3: 11
4: 137
1143130804_1143130810 -1 Left 1143130804 17:4675824-4675846 CCGGCAGATGAAATCCAGGATTT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1143130810 17:4675846-4675868 TCCTGCACAGGGACGGACACGGG 0: 1
1: 0
2: 3
3: 10
4: 128
1143130804_1143130808 -8 Left 1143130804 17:4675824-4675846 CCGGCAGATGAAATCCAGGATTT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1143130808 17:4675839-4675861 CAGGATTTCCTGCACAGGGACGG 0: 1
1: 0
2: 0
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143130804 Original CRISPR AAATCCTGGATTTCATCTGC CGG (reversed) Exonic
900531761 1:3157241-3157263 GTGTCCTGGATTTCATCTGCCGG - Intronic
900880239 1:5376416-5376438 TTATCCCGGATTTCATCTTCAGG + Intergenic
902521932 1:17023550-17023572 AAATCCAGGCTTTCATTAGCTGG + Intronic
902721762 1:18308842-18308864 AAATCCAGGGTCTCTTCTGCAGG - Intronic
903023402 1:20410293-20410315 AAATGCTGGAGTGAATCTGCTGG - Intergenic
903470061 1:23580639-23580661 AAACCCTGAATTTCATAGGCGGG - Intergenic
905976603 1:42179735-42179757 TCATCCTGGATGTCATCTGGAGG + Exonic
910115104 1:83723541-83723563 AAATCCTGGAATTCCTCCCCTGG + Intergenic
910582349 1:88842504-88842526 AAGTCCTGGGGTTCATGTGCAGG - Intergenic
913342730 1:117775464-117775486 AAGTTCTGGAATTCATGTGCAGG - Intergenic
914989571 1:152486624-152486646 AAAGCCTGGGATTCCTCTGCTGG - Intergenic
917144921 1:171879707-171879729 AAAGCCTGCATGTCAACTGCTGG + Intronic
917543000 1:175933602-175933624 AAATTCTGGAATACATGTGCAGG - Intergenic
919566434 1:199194765-199194787 AAGTTCTGGATTACATATGCAGG + Intergenic
919606600 1:199691524-199691546 GCATCCTGGATTTTATCTGACGG + Intergenic
923028802 1:230230243-230230265 CAAACCTAGTTTTCATCTGCAGG - Intronic
924417928 1:243878379-243878401 AAATCATGGATTTAATATCCAGG - Intergenic
924526413 1:244855169-244855191 AAATTCTGGATACCCTCTGCTGG + Intronic
1064612623 10:17118959-17118981 AAAGCCTAGATTTGTTCTGCTGG - Intronic
1065646547 10:27840862-27840884 AGATCCTGCATTGCATCTGTAGG + Intronic
1067705388 10:48603225-48603247 AAATCCTGGATTTCAAAGACAGG + Intronic
1068948696 10:62755699-62755721 AGATCTGGGATTTGATCTGCAGG + Intergenic
1071354920 10:84784481-84784503 AAATCCAGCACTACATCTGCAGG - Intergenic
1071622514 10:87134682-87134704 AAAGCCTGGAGTGCCTCTGCTGG - Intronic
1071927886 10:90432113-90432135 CAATCCTGCATTCCATCTGGAGG + Intergenic
1073523593 10:104157877-104157899 GAATCCTGGATTCCTTTTGCTGG - Intronic
1073765584 10:106678949-106678971 GAATTCTGGTTTTCATCTGTGGG + Intronic
1074495819 10:113979270-113979292 GTCTCCTGGATCTCATCTGCTGG - Intergenic
1076050072 10:127325522-127325544 ACAGCCTGGATTTCATCTCTGGG + Intronic
1077790835 11:5438062-5438084 TACTCCTGAATTTCATCTCCTGG - Intronic
1078633629 11:13029027-13029049 AAAGCCTGGATTTGAACTACTGG - Intergenic
1079752234 11:24213381-24213403 AAATTCTGGAGTACATGTGCAGG - Intergenic
1081643797 11:44776357-44776379 AAATCCTGGTTCTCACTTGCTGG + Intronic
1081712597 11:45226928-45226950 AGATCCTGGATGCCATCAGCGGG + Intronic
1082096287 11:48132868-48132890 GAATACTGCATTTCATCTGAGGG - Intronic
1082182339 11:49134701-49134723 AAATGCTGGATTTCATTAGATGG + Intergenic
1084477185 11:69395702-69395724 GAATCCTGGATCCCATCTGTGGG - Intergenic
1085762410 11:79253463-79253485 ACATCCTTGACATCATCTGCTGG - Intronic
1086530387 11:87777993-87778015 AACTCATGGATTTCATCTCCAGG + Intergenic
1087706235 11:101495722-101495744 AATTCCTGGATATTATCTGCAGG + Intronic
1087979267 11:104590912-104590934 CCATCCTTGATTTCTTCTGCTGG - Intergenic
1088424852 11:109692173-109692195 AACTCCTGGATTTGGTCTCCTGG - Intergenic
1093293406 12:17357614-17357636 AAATCCTGGCTGTCATCTGTAGG + Intergenic
1096131162 12:49160021-49160043 AGACCTTGGATTTCATATGCTGG + Intergenic
1099148533 12:79078550-79078572 AAATTCTGGGGTTCATGTGCAGG + Intronic
1100342415 12:93692018-93692040 AAGTCCTGGACTACATGTGCAGG - Intronic
1102909019 12:116698293-116698315 AAAACCGGTTTTTCATCTGCAGG + Intergenic
1108967011 13:56320861-56320883 AAACCCTGGATGACATCTTCTGG - Intergenic
1110712172 13:78661986-78662008 AAATCCTAGATCACATTTGCTGG + Intergenic
1110776751 13:79416550-79416572 CTATCCTGTAATTCATCTGCTGG - Intergenic
1111933742 13:94538065-94538087 ATAACCTGGATATCATCTTCTGG - Intergenic
1113069228 13:106403754-106403776 ATATCCTGGATTTTGTATGCTGG + Intergenic
1115410153 14:33065032-33065054 AAATCCTGAATTTCAACACCAGG - Intronic
1115453056 14:33571035-33571057 AATGCTTGGATTTCATCTCCAGG - Intronic
1118281129 14:64429609-64429631 AAATCCTGGATTTGGGATGCTGG + Intronic
1118862006 14:69671647-69671669 AAATCCTGGAATACATCTGAAGG - Intronic
1120225306 14:81784466-81784488 AATTGCTGGATTTCACCTGTTGG + Intergenic
1121113114 14:91325924-91325946 GAAGCTTGGATTTCAGCTGCAGG + Exonic
1121400168 14:93669167-93669189 AAATCCTGGATTTTCTCTTCTGG + Intronic
1124722198 15:32120053-32120075 ATTTCCTGGCTATCATCTGCTGG - Intronic
1126308756 15:47291439-47291461 AGATCCTAGATGCCATCTGCAGG - Intronic
1126519811 15:49579968-49579990 AAGTCCTGGCTTTATTCTGCAGG + Intronic
1127215705 15:56821270-56821292 TAATCCTGGAAATCATCTGCTGG - Intronic
1131379778 15:91954330-91954352 AGATCCTGAATGCCATCTGCAGG + Intronic
1135956805 16:26962772-26962794 AAACCCCGTATCTCATCTGCTGG + Intergenic
1137536978 16:49334653-49334675 CAATCCTGGATTTCATCACTAGG + Intergenic
1137699854 16:50489588-50489610 CAATCCTGGATCTCTCCTGCTGG + Intergenic
1138070973 16:53992651-53992673 CAATCCTTGCCTTCATCTGCTGG - Intronic
1138975678 16:62204505-62204527 ATATCCAGAATTTCATCTGAAGG + Intergenic
1139368214 16:66446911-66446933 AAAGCCTGGTTGTCCTCTGCAGG + Intronic
1140575706 16:76166032-76166054 CAATCCTGCATTGGATCTGCCGG + Intergenic
1141247709 16:82325627-82325649 AAAACCTGGATTCCTTCTGTGGG + Intergenic
1143130804 17:4675824-4675846 AAATCCTGGATTTCATCTGCCGG - Exonic
1145752774 17:27367211-27367233 AAATCCTGGAGTGGATCTGCAGG + Intergenic
1148200714 17:45748298-45748320 AAGTCCTGCGTTTTATCTGCTGG + Intergenic
1148523398 17:48304418-48304440 AAATTCTTAATTTCAGCTGCAGG + Intronic
1155077976 18:22379446-22379468 AGATCCTTAATTACATCTGCAGG - Intergenic
1158809039 18:61009693-61009715 AAATCCTGGAATTAATCTGATGG + Intergenic
1159421037 18:68219848-68219870 AAATCCTGTCTTTTATCTGTAGG + Intergenic
1162298556 19:9829958-9829980 CCATCGTGGATTTCATCTGAAGG - Exonic
1168701447 19:58441985-58442007 AAAACCTAGATTTCATGTGTAGG - Intergenic
925259674 2:2518677-2518699 AAATCCTGGACTTGCTCTGATGG - Intergenic
925905169 2:8535844-8535866 AAATCCTGGAACTCTGCTGCAGG + Intergenic
926359731 2:12074910-12074932 AACTGCTGGATTCCATCTTCAGG + Intergenic
927512996 2:23656233-23656255 CAAAGCTGGCTTTCATCTGCCGG - Intronic
928676233 2:33654486-33654508 AAATCCTGCATTGTATCTGGGGG + Intergenic
931603962 2:64033035-64033057 AAATCCAGGTTCTCATTTGCAGG - Intergenic
932663530 2:73678276-73678298 ATATCCTGCATTTCTTCTGTAGG + Intergenic
934025939 2:88001701-88001723 AAAAGCTGGATTTGATCTGCAGG + Intergenic
934758169 2:96839079-96839101 ACATCCTGGATGGCATCTGCCGG + Exonic
936947943 2:117947436-117947458 AAGTCCTGGCTGTCATCTTCTGG - Intronic
938915029 2:135929471-135929493 AAAACATGGATTTTATTTGCTGG + Intronic
939499952 2:142971426-142971448 AAGTCAAGGATTTCATTTGCAGG - Intronic
940929163 2:159406496-159406518 ATATCCTTGCTTTCTTCTGCTGG + Intronic
942693709 2:178614858-178614880 ACAGCCTGGATTTCCTCTGTGGG + Exonic
942806258 2:179934525-179934547 AAGTCCAGGATAGCATCTGCAGG + Intergenic
943711474 2:191100405-191100427 GAATCCTGGATTTGACTTGCAGG + Intronic
943796816 2:192006716-192006738 AAATCCTGGATTTCAAATTCTGG + Intronic
943817726 2:192277404-192277426 AATTCCTGGATGTCTGCTGCAGG - Intergenic
943884517 2:193198984-193199006 AAATCCTGGAGATCATTTCCAGG - Intergenic
944001253 2:194841187-194841209 AAGTCCTGGTTTACATTTGCGGG - Intergenic
945618139 2:212099069-212099091 AAATCCTGGACTTGAACTCCTGG - Intronic
945786269 2:214241935-214241957 AACTTCTGGATTTCATATCCTGG + Intronic
945819059 2:214640575-214640597 AAATCCTGGCTTTGATTTTCAGG - Intergenic
947997140 2:234537561-234537583 ACATCTTGGCTTTCATCTTCAGG + Intergenic
949081142 2:242100623-242100645 AAATCCTGGGTGTATTCTGCAGG + Intergenic
1169058698 20:2644503-2644525 AGATGCTGGATTTTATCTGTTGG + Intergenic
1169378297 20:5085103-5085125 GAATCCAGAATTTCATCTGAAGG + Intronic
1170194138 20:13673477-13673499 AATTACTGCATTTCATCTGGGGG - Intergenic
1173392842 20:42650229-42650251 AAAACCTGGATTTCAAGTCCTGG - Intronic
1174668037 20:52278681-52278703 TATTTCTGGATTTCATCCGCTGG + Intergenic
1174713269 20:52729367-52729389 GCAGGCTGGATTTCATCTGCAGG - Intergenic
1177752471 21:25302288-25302310 AATGCCTGGATGTCATCTGAAGG + Intergenic
1180092229 21:45539021-45539043 AAATCGTGCCTTTCAGCTGCGGG + Intronic
1180593066 22:16956846-16956868 GGATCCTGGATTTGATCTCCTGG + Intergenic
1182049378 22:27301244-27301266 CAGCCCTGGATTTTATCTGCTGG - Intergenic
1184357005 22:43988738-43988760 AAATAATGCATTTCATTTGCAGG + Intronic
950824214 3:15799620-15799642 ATATCCTATATTTCATCTTCAGG + Intronic
951126637 3:18992489-18992511 AAAACCTGGTTTTCATCAGCTGG + Intergenic
952339859 3:32436516-32436538 CAAGCCTGGCTTTCATCTCCTGG + Intronic
952633848 3:35503472-35503494 AAATCATGGATTTCATCAAAAGG + Intergenic
953355766 3:42255080-42255102 AAGTCCTGGGTTTCATGTCCTGG + Intergenic
953777761 3:45837250-45837272 AAATTGTTGCTTTCATCTGCTGG + Intronic
956204136 3:66738523-66738545 AAACCCTGTGTCTCATCTGCTGG + Intergenic
956513845 3:70024466-70024488 AAATCCTACATTTCATTTGGTGG - Intergenic
956670095 3:71680761-71680783 AAAGCCTGGATCTCAACAGCTGG - Exonic
957314914 3:78564629-78564651 TACTCCAGGATCTCATCTGCAGG + Intergenic
959016100 3:101135693-101135715 AAGTTCTGGAATACATCTGCAGG + Intergenic
959775491 3:110156126-110156148 AAATCATGGATTAGATCTCCTGG + Intergenic
959832988 3:110886682-110886704 AAAGCCTGGAGTTCATTAGCCGG + Intergenic
961393708 3:126571450-126571472 AAGTCCTGGAGGTCATCTCCAGG + Intergenic
962283447 3:134068640-134068662 AACTGCTGGACATCATCTGCTGG - Intronic
964691519 3:159455031-159455053 AATACCTGGGTCTCATCTGCTGG - Intronic
966128381 3:176607169-176607191 AAATCCTGCAGTTCTTCTCCAGG + Intergenic
967545956 3:190728470-190728492 AAATTCTGGGTTACACCTGCAGG - Intergenic
968950093 4:3686543-3686565 TGATGCTGGATTTTATCTGCTGG - Intergenic
969537151 4:7763383-7763405 GAATCCAGGTTTTCATCTGGGGG + Exonic
970726762 4:19055366-19055388 ACCTCCTCTATTTCATCTGCAGG + Intergenic
970837654 4:20429880-20429902 CATGCTTGGATTTCATCTGCTGG + Intronic
972247541 4:37261050-37261072 ATATCCTGGGATTCATCTGAGGG + Intronic
973166884 4:47088959-47088981 AAATCAGGGACTCCATCTGCTGG + Intronic
973224951 4:47773461-47773483 AAAGCCTGGATTACACCAGCTGG + Intronic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
974874234 4:67683705-67683727 AAATCCTGCATTTCCTCTCTGGG - Intronic
975397832 4:73897913-73897935 AATTCCTGGATTTCATTTTGTGG + Intergenic
977291631 4:95171068-95171090 AAAATCTGAATTTCATCTGCAGG + Intronic
977422366 4:96818306-96818328 AAATGCTGGTTTTCAGCTCCTGG + Intergenic
978300815 4:107268210-107268232 CAATAGTGGATTTCATTTGCAGG + Intronic
980640987 4:135579068-135579090 AAATTCTAGATTTATTCTGCTGG + Intergenic
982124165 4:152169916-152169938 AAATCCTGGATGGCAGCTGTAGG + Intergenic
982375070 4:154681093-154681115 AAATACTAAATTTCATCTCCGGG - Intronic
982395505 4:154911091-154911113 AAGGCCTGGATTTAATCTGTAGG + Intergenic
982958100 4:161796877-161796899 AAATCCTTAATTTCATCTGATGG + Intronic
983335862 4:166391259-166391281 AAATCCTGGATTTAATTTCTAGG - Intergenic
983654549 4:170069522-170069544 TAATCCTGGATTTCAACCTCTGG - Intronic
985570275 5:641030-641052 AAATGCAGGTTTTCAGCTGCTGG - Intronic
985655185 5:1127985-1128007 ACGTCCTGGTTTTCATCTGGGGG + Intergenic
986796310 5:11216072-11216094 AAATCCTGAATCTTATCTGAAGG + Intronic
988516910 5:31912865-31912887 AAGTTCGGGCTTTCATCTGCTGG + Intronic
988700141 5:33665724-33665746 AAACCCTGTATCTCATTTGCTGG - Intronic
989730692 5:44644525-44644547 AACTCCTGCATGTCCTCTGCTGG - Intergenic
990115969 5:52391170-52391192 AAATTCTGTATTTTATCTGGTGG + Intergenic
990302052 5:54459132-54459154 AAACACCGCATTTCATCTGCTGG + Intergenic
994187872 5:96835891-96835913 ATTTCCTGAATTTCAACTGCAGG + Intronic
1000871272 5:166580318-166580340 AAACCCTGGATATCATATGTAGG - Intergenic
1001155375 5:169268362-169268384 AAATTCTGAATGTCATCTGATGG + Intronic
1001711537 5:173782500-173782522 CACTCCTGGATCTCATCTTCAGG - Intergenic
1002929396 6:1622967-1622989 AAATACTGTATTTCATGTGGAGG + Intergenic
1004735009 6:18396884-18396906 AAATCCTGAATTTGACGTGCAGG + Intronic
1010556927 6:77293757-77293779 AAATTCTGTATTTCAAATGCTGG - Intergenic
1014641722 6:123919710-123919732 AAATCTTGAATTTCAAATGCTGG - Intronic
1016316278 6:142791574-142791596 AATTCCAGAATTCCATCTGCAGG + Intronic
1016809882 6:148250073-148250095 AGGCCCTGGAGTTCATCTGCAGG - Intergenic
1019042380 6:169117899-169117921 AAATTTTGCATTTCATCTGGGGG + Intergenic
1021426694 7:20508077-20508099 AAATCCTCGATCTGACCTGCAGG - Intergenic
1023041798 7:36179143-36179165 ATGTCCTGGCTTTAATCTGCGGG + Intronic
1023294495 7:38700821-38700843 AAATCCTAGGTTTGTTCTGCAGG + Intergenic
1024792464 7:52982691-52982713 AAGTCCTTTATCTCATCTGCAGG + Intergenic
1025017025 7:55448147-55448169 AAATACTGGATTTAAGTTGCTGG - Intronic
1026150177 7:67781512-67781534 AAATCCAGGCTTTGATCTGGTGG + Intergenic
1026917054 7:74126831-74126853 AAATGCTGAAATTCATCTGCTGG - Intergenic
1031260317 7:119509757-119509779 AATTCCTGGATTTTCTTTGCTGG - Intergenic
1033431712 7:141295398-141295420 AAATAGTGGATTACACCTGCTGG - Intronic
1034570994 7:151956309-151956331 AACTCCTGGATTCCACCTGCTGG + Intergenic
1035371954 7:158385808-158385830 ACACCATGGATTTCATCTCCAGG + Intronic
1035539051 8:417429-417451 AAATCCTGGATGTATTCTGCAGG + Intronic
1038468444 8:27788916-27788938 ACATGCTGCATTTCATCTTCAGG - Exonic
1045954191 8:107887886-107887908 AAAACTTGGATTTGATCTACAGG - Intergenic
1046207005 8:111013787-111013809 AATTCCTGCATTTCATCTTTTGG + Intergenic
1046420086 8:113970112-113970134 AGATCCTGAATGTCATCAGCTGG - Intergenic
1046947283 8:119986298-119986320 CAATCCAGAATTTCATATGCAGG - Intronic
1048169069 8:132087765-132087787 AGATCTTGGGTTTCATCTGCTGG + Intronic
1048301072 8:133251818-133251840 TAATCCTGGATTACATGAGCCGG + Intronic
1048443087 8:134474399-134474421 GAATCCTGGATTTCATCCAAGGG + Intergenic
1049528247 8:143140379-143140401 ACATCATGGACTTCCTCTGCAGG + Intergenic
1059785142 9:117573948-117573970 GATCCCTGGATTTCATCCGCAGG + Intergenic
1060245897 9:121946072-121946094 AAATCCAGCATTCCTTCTGCTGG + Intronic
1060535205 9:124380570-124380592 AAATCCTGGGTTTGATGTACTGG - Intronic
1060562024 9:124553613-124553635 ACATCCTCGATTTCAACTTCTGG + Intronic
1060788966 9:126472889-126472911 ACATCCTTGCTTTCATCTGCTGG + Intronic
1061046455 9:128167700-128167722 AAAGACTGCATTTCACCTGCTGG + Intronic
1061243180 9:129386245-129386267 AAATCCTGGAGTGCATTTGGGGG - Intergenic
1185888993 X:3807845-3807867 ACATCCTTGATTTCCTCAGCCGG - Intergenic
1186491182 X:9973934-9973956 AAATCCCCGTCTTCATCTGCAGG - Intergenic
1188752902 X:33925633-33925655 AACTCCTGGAGTTTATCTCCAGG - Intergenic
1190552945 X:51603485-51603507 AAATCCTGCATTTTCTCTGAAGG - Intergenic
1190565508 X:51726650-51726672 AAGTCCTAGGTTTAATCTGCAGG + Intergenic
1190580429 X:51888464-51888486 AAATCCTTGCTAGCATCTGCTGG - Intronic
1195425245 X:104721658-104721680 AAGTTCTGGGTTTCATGTGCAGG - Intronic
1200340679 X:155392023-155392045 AACTCATGGATTTTATCTCCTGG - Intergenic
1201072026 Y:10155770-10155792 AACTCATTGATGTCATCTGCTGG - Intergenic