ID: 1143131269

View in Genome Browser
Species Human (GRCh38)
Location 17:4678994-4679016
Sequence TCCCTCTGTTGAGGGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143131269_1143131273 13 Left 1143131269 17:4678994-4679016 CCTCAACACCCTCAACAGAGGGA 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1143131273 17:4679030-4679052 ACCTTTTTTTTTTTTGAGACAGG 0: 25
1: 426
2: 3018
3: 21683
4: 32615
1143131269_1143131275 14 Left 1143131269 17:4678994-4679016 CCTCAACACCCTCAACAGAGGGA 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1143131275 17:4679031-4679053 CCTTTTTTTTTTTTGAGACAGGG 0: 97
1: 1640
2: 18204
3: 27138
4: 65480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143131269 Original CRISPR TCCCTCTGTTGAGGGTGTTG AGG (reversed) Intronic
901467885 1:9434508-9434530 GCCCTCTGTCAAGGGTGTGGAGG - Intergenic
901637162 1:10675796-10675818 TCCCTTTGTTGGGGGTGGGGGGG - Intronic
901719417 1:11184531-11184553 TCACTATGTTGAGGCTGGTGTGG - Intronic
902368041 1:15990118-15990140 TGTCTCTGTTGAGGGTCCTGGGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
906647524 1:47486402-47486424 TGCCTCTTTTGTGGGTGTCGTGG + Intergenic
907520460 1:55020266-55020288 TCCCTCTGGTGGGTGTGGTGGGG - Intergenic
908796991 1:67840016-67840038 TCCCTCAGGGGAGGGTGCTGGGG + Intergenic
909616145 1:77610811-77610833 TTATTGTGTTGAGGGTGTTGAGG - Intronic
910141698 1:84033339-84033361 ACCAGCTGTTGAGGATGTTGGGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912584624 1:110751078-110751100 TCCATCTGTGTAGGGTGGTGTGG + Intergenic
913158505 1:116123944-116123966 TCACTCTGCTGAGGGTGGAGTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915844238 1:159247090-159247112 TCCCTGGGTTGAGGGCCTTGTGG + Intergenic
1064247660 10:13682138-13682160 TCCTTCAGCAGAGGGTGTTGAGG + Intronic
1065919390 10:30378827-30378849 CCCAGCTGTTGAGGATGTTGTGG + Intergenic
1067742858 10:48909545-48909567 TCCTTCTGGTGAGGGCTTTGGGG + Exonic
1068650211 10:59514267-59514289 TGCCTCGGTTGAGGAGGTTGAGG - Intergenic
1070993346 10:80752354-80752376 TTGCTCTGTTGAGAGTGTTAGGG + Intergenic
1072528533 10:96296379-96296401 TCCCTCTGTAGTGGATGCTGTGG - Intergenic
1073025786 10:100486435-100486457 TCACTCTGCTGGGTGTGTTGAGG - Intergenic
1073571560 10:104584735-104584757 TTCCTCTGTTGAGGGAGACGTGG + Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1080701089 11:34644696-34644718 TCTCTCCTCTGAGGGTGTTGTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081664552 11:44909245-44909267 GACCTTTGTTTAGGGTGTTGAGG + Intronic
1082814438 11:57498965-57498987 CCCCTCTGTGGAGTGTGTTTAGG - Intronic
1083049563 11:59765142-59765164 TTCATCTGATGAGTGTGTTGGGG + Intronic
1083787728 11:64962120-64962142 TCCCTCTGTTAGGGGTGGGGCGG - Intronic
1083995117 11:66267785-66267807 TCCCCCTGTTGCGGGTGAGGCGG + Exonic
1086845738 11:91747695-91747717 TTCCTCTGTGGAGGCTGTGGGGG + Intergenic
1089126162 11:116177962-116177984 TGTTTCTGTTGAGGGTGTTTGGG + Intergenic
1091402647 12:189988-190010 CCCCTCTGTTGGAGGTGGTGAGG - Intergenic
1092154315 12:6272591-6272613 TCACTCTGCTGAGGTTGCTGGGG - Intergenic
1092426718 12:8381189-8381211 TCCTTGTGTTCAGGCTGTTGTGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096107209 12:49003351-49003373 TCCCTCTGTTGAGGTTGGATGGG - Intronic
1096487907 12:51996127-51996149 TCTCTTTGTGGAGGGGGTTGTGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098729838 12:74021012-74021034 TCCCTCTGGTGATGGTGCTAGGG + Intergenic
1100470662 12:94890016-94890038 TCACTCTGTAGAGGGTGGAGTGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104792119 12:131489888-131489910 TCCCACGGATGAGGGAGTTGGGG + Intergenic
1104841789 12:131829138-131829160 TTGCTCGGTTGAGGGTGTTGGGG + Intronic
1104988438 12:132610766-132610788 TCCCTCCGCTTAGGGTGGTGGGG - Intergenic
1106153569 13:27130282-27130304 TCCCTTTATTGAGGGGGATGGGG + Intronic
1107384639 13:39894674-39894696 TCCCACTGTTGATGGGGTTCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1113015288 13:105822320-105822342 TCCCTCTGAGGAGGGTGATAGGG + Intergenic
1113275237 13:108721463-108721485 TTCCTCTGTTGATAGTGTTCAGG + Intronic
1119503123 14:75147826-75147848 TCCCTCTATTGAGAGGGTAGGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120346422 14:83296373-83296395 TCCCCATCTTGAGGGTGCTGAGG + Intergenic
1120833163 14:89016111-89016133 TCCCTCTGTGGAGGGTGACTAGG + Intergenic
1120834705 14:89029238-89029260 ATCCTCTGTTGAGTGTGTTGTGG + Intergenic
1122071123 14:99205976-99205998 GTCCTCTGTTGAGGGTATCGGGG - Intronic
1122108363 14:99478346-99478368 TGCTTCTGTTGAGGGTGGAGAGG - Intronic
1122319816 14:100847696-100847718 TCCTCCTGATGAGGGTGTTGGGG + Intergenic
1125476800 15:40053312-40053334 TCCCTCACTTGAGTGTCTTGGGG + Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1128185056 15:65637826-65637848 GCCCTGTGATGAGGGTTTTGAGG + Intronic
1128309265 15:66620380-66620402 TCCCTCAGTTCAGGATGTGGGGG + Intronic
1129036265 15:72650417-72650439 CCCAGCTGTTGAGGATGTTGTGG - Intergenic
1129213624 15:74086807-74086829 CCCAGCTGTTGAGGATGTTGTGG + Intergenic
1129396779 15:75254278-75254300 CCCAGCTGTTGAGGATGTTGTGG - Intergenic
1129400389 15:75278555-75278577 CCCAGCTGTTGAGGATGTTGTGG - Intronic
1129474008 15:75771264-75771286 CCCAGCTGTTGAGGATGTTGTGG - Intergenic
1129730761 15:77931131-77931153 CCCAGCTGTTGAGGATGTTGTGG + Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131187472 15:90287270-90287292 CCCAGCTGTTGAGGATGTTGTGG - Intronic
1131985238 15:98036562-98036584 TCCCTCTGTAGGTGGTGTTATGG - Intergenic
1138323813 16:56143733-56143755 TCCCTCTGTAGTGGTTGGTGTGG - Intergenic
1139290928 16:65857285-65857307 CCCCACTGTTGAGGATGCTGAGG + Intergenic
1139736212 16:68991113-68991135 TCCCTCTGTTGAGGCTGTGTTGG + Intronic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1144321417 17:14124690-14124712 TACCTCTGTGGAGTGTTTTGGGG + Intronic
1144621856 17:16823150-16823172 TCTCTTTGATGGGGGTGTTGGGG - Intergenic
1144767293 17:17739752-17739774 TCCCTGTGTTGGTGGTGGTGCGG + Intronic
1144884568 17:18449564-18449586 TCTCTTTGATGGGGGTGTTGGGG + Intergenic
1145147662 17:20494813-20494835 TCTCTTTGATGGGGGTGTTGGGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1149396997 17:56255167-56255189 GCCCTGTGTTGATGGTGTTTTGG + Intronic
1150270868 17:63863872-63863894 ACCATCTGTTGTGGGTCTTGGGG + Intergenic
1150274496 17:63887403-63887425 ACCATCTGTTGCGGGTCTTGGGG + Intergenic
1150276633 17:63902201-63902223 ACCATCTGTTGTGGGTCTTGGGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152112433 17:78364736-78364758 TCCCTCTGCTGGGGGGGTCGAGG + Intergenic
1152886217 17:82852131-82852153 TCCATCTGTCGGGGGGGTTGGGG - Intronic
1155316828 18:24579987-24580009 TCCCTCTGGGGAGCGTGTTTTGG - Intergenic
1155950073 18:31902168-31902190 TCTGGCTGTTGAGGGTGTTCAGG - Intronic
1156640234 18:39086264-39086286 ATCCTCTGTTGTGGGTGTGGAGG + Intergenic
1157108135 18:44793860-44793882 TCCCTCTGTTGAGCTTCTTGTGG + Intronic
1157818768 18:50750381-50750403 CCCCTCTGCTCAGTGTGTTGGGG - Intergenic
1158118940 18:54026772-54026794 TGCCTCTTGTCAGGGTGTTGAGG - Intergenic
1162528333 19:11220330-11220352 TCCCTCTGTTGAGACTTTTTAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165417499 19:35703777-35703799 TCCCTCTGTTGCCGGTGCTGGGG - Intergenic
1166909602 19:46143142-46143164 TCACACTGATGAGGGTGATGAGG - Intronic
1168405115 19:56106655-56106677 TTCCGGTGTTGAGGTTGTTGGGG - Intronic
926919946 2:17930458-17930480 CCCCTGTGATGAGTGTGTTGGGG + Intronic
928057612 2:28073644-28073666 TCCATCAGTTGAGGCTGTTTTGG + Intronic
928408233 2:31031827-31031849 CCCCTCTGTGGAGGGTGGAGGGG - Intronic
928437201 2:31262234-31262256 TCCCTCTGATGAGTGCTTTGGGG - Intronic
928866509 2:35923083-35923105 CCCAGCTGTTGAGAGTGTTGCGG - Intergenic
929600189 2:43199878-43199900 TCCTTCAGTGGAGTGTGTTGGGG - Intergenic
930319107 2:49831935-49831957 TCCTTCTGCAGAGGGTGTTTTGG + Intergenic
930624921 2:53686376-53686398 TGGCTCTGAGGAGGGTGTTGGGG - Intronic
931119145 2:59197107-59197129 TTCCTGAGTTGGGGGTGTTGGGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
935207590 2:100909940-100909962 TCCCTCTGCTGAGGGGCTTTTGG + Intronic
937826187 2:126370982-126371004 TCACTCTGTTGATGGTGTCTTGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
939048618 2:137280291-137280313 TCACTCTGTTTGGGGTGTTACGG + Intronic
940412360 2:153380355-153380377 TCCCACTGTTCAGGAGGTTGAGG + Intergenic
940727079 2:157346081-157346103 TCCATCTTTTGTGGGGGTTGGGG - Intergenic
943258810 2:185631459-185631481 TCCCTCTTTTCAGGGATTTGAGG - Intergenic
943785419 2:191872412-191872434 TCTCTTTGTTGGGGGTGGTGGGG - Intergenic
944278912 2:197871888-197871910 TCCCTTTGTAGAGGGTGTAAAGG - Intronic
947597068 2:231419588-231419610 TCCCTCTGATGTTGGGGTTGGGG + Intergenic
947693569 2:232162672-232162694 TGCCTTTGTAGAGGGTATTGCGG - Intronic
947808125 2:232982396-232982418 TCCCTCTCTTAGGGGTGCTGGGG - Intronic
947844412 2:233232468-233232490 TCCCTCTGTTGTTGGGGTCGGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168733840 20:112838-112860 TTACTCTGTTGAGAGTTTTGTGG + Intergenic
1168808460 20:687037-687059 CCATTCTGTTGAGGGTGTGGTGG + Intergenic
1170115954 20:12859725-12859747 GCCATCTGTTGTGGCTGTTGTGG - Intergenic
1173249507 20:41357241-41357263 TCCCTCTGTGCTGGGTGTGGTGG + Intronic
1173495829 20:43516733-43516755 TCCTTGTGTTGATGGTTTTGAGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175931435 20:62495683-62495705 TCCCTCTGTGGCAGGTGGTGAGG - Intergenic
1178774640 21:35538074-35538096 TCCCTCTGATGAGGGTCAAGAGG + Intronic
1181762750 22:25069245-25069267 TCCCTGTGTTCAGGGCTTTGAGG - Intronic
1182857116 22:33527639-33527661 TCCCTCTAAAGAGGGTGTAGAGG - Intronic
1183230743 22:36580420-36580442 TACCTCTCTTGTGTGTGTTGTGG + Intronic
1183600226 22:38835683-38835705 TCCATCTGCTGAGGATTTTGGGG - Intronic
1184707270 22:46223276-46223298 ACCCTCAGCTGAGGGTGATGGGG - Intronic
1184751272 22:46487912-46487934 TCCAGCTGATGAGGGTGTGGGGG + Intronic
1184751290 22:46487972-46487994 TCCAGCTGATGAGGGTGTAGGGG + Intronic
1184841119 22:47052900-47052922 TCCCCGTGTTGATGGTCTTGGGG + Intronic
1184916017 22:47569570-47569592 TGCCTCTGTTGAGGCTGCAGTGG + Intergenic
1185430339 22:50807078-50807100 TCGCTCGGTTGAGGGTGGCGGGG - Intergenic
949605368 3:5646858-5646880 ACCCTCTGTAGAAGGTGTTATGG + Intergenic
950694670 3:14689755-14689777 TCCCCCTCTTGAGAGGGTTGGGG + Intronic
951188003 3:19736298-19736320 GCCCTGTGCTGAGGGTGGTGGGG - Intergenic
952707968 3:36399266-36399288 ACCCACTGTAGAGGGTGCTGTGG - Intronic
953137908 3:40199437-40199459 TCCCTGTTTTGTGAGTGTTGTGG + Intronic
953172634 3:40521843-40521865 TGCTTCTGTTGAGGCTGTTCTGG + Intergenic
953664992 3:44918900-44918922 GGCCTCTGTGCAGGGTGTTGTGG - Intronic
957034455 3:75281092-75281114 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
957286833 3:78227538-78227560 GCCATCTTTTGGGGGTGTTGTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
961078366 3:124002994-124003016 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
962208358 3:133454588-133454610 TCCCTCTGCAGAGGAGGTTGTGG - Intronic
962395420 3:135011523-135011545 GCCTTCTGCTGAGGGTGCTGGGG + Intronic
962531305 3:136283390-136283412 GCCTTCTGTGGAGGGTGTGGAGG + Intronic
964619524 3:158707127-158707149 TCCCTCTGTCCAGTGTGTGGTGG - Intronic
965123336 3:164592138-164592160 TCCATTTGTTGAGTGGGTTGAGG - Intergenic
965759461 3:172060322-172060344 TCCCTCAGGTGAGAGTGTAGTGG + Intronic
972310149 4:37873920-37873942 TCTCTCTGTTGAGTGTGTGTGGG + Intergenic
972390090 4:38606098-38606120 TCCCTCTGTGGAGGGTGGAGTGG - Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
976693525 4:87893964-87893986 CCCCCCTCTTGAGGGTGATGAGG + Intergenic
978446783 4:108787787-108787809 TCCTCCTGGTGGGGGTGTTGGGG - Intergenic
978661861 4:111136984-111137006 TCCTTCCTTTCAGGGTGTTGAGG + Intergenic
982066226 4:151657101-151657123 TTCCTCTGTGGAGGGTCTAGAGG + Intronic
985394789 4:189530819-189530841 TCACTCTGATGAGGGTGGCGGGG + Intergenic
988799959 5:34687383-34687405 ACTCTCTGTTAAGGGTTTTGTGG + Intronic
993353346 5:86876690-86876712 TCAGTCTGTTGGGGGTCTTGGGG + Intergenic
1001845926 5:174921410-174921432 CCCAGCTGTTGAGGATGTTGTGG + Intergenic
1002538247 5:179890136-179890158 TCACTCTGCTGTGGGTGTAGTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003516805 6:6824861-6824883 TCCCGCTGTTGCAGGTGTGGAGG + Intergenic
1005408787 6:25520669-25520691 TCCATCTGTTGAGGATGAAGAGG - Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005696168 6:28354714-28354736 TCCCTACCTTTAGGGTGTTGGGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007782739 6:44263705-44263727 TCCCTCTGTTGGAGGTGTCTGGG - Intronic
1010902393 6:81442962-81442984 TCCCTCTGTTGAGCGGGGTGGGG + Intergenic
1013154994 6:107484808-107484830 TCCCTCTGTTCTGGGTGCTTGGG - Intergenic
1014056618 6:117023703-117023725 TCCTTCTTTTGAGGAGGTTGGGG + Intergenic
1014376082 6:120676517-120676539 ACCCTCTTCTGAGGGTGTTTTGG - Intergenic
1016231003 6:141803938-141803960 TCCTTCTCTTCAGGGTGGTGAGG + Intergenic
1016399127 6:143659360-143659382 ACCCTCTGCTGAGGGTGTCAGGG + Intronic
1021133013 7:16934028-16934050 TCTCTCTGTTGTGGGTTTGGGGG + Intergenic
1021321338 7:19216422-19216444 TCCCTCTGTTAGGAGTGATGGGG + Intergenic
1022124499 7:27342252-27342274 TCCCTTTATTGTGGGTGGTGGGG + Intergenic
1027555884 7:79664480-79664502 TGCTTTTGTTGAGGGGGTTGGGG - Intergenic
1028012910 7:85671937-85671959 TCCAGCTGTTGATGATGTTGGGG - Intergenic
1030297122 7:107940275-107940297 TGTCTGCGTTGAGGGTGTTGAGG - Exonic
1031561709 7:123246982-123247004 TTGTTCTGTTGACGGTGTTGGGG - Intergenic
1032464215 7:132133798-132133820 CCCCTCTGGTGGGGGAGTTGAGG - Intronic
1034466739 7:151234131-151234153 TCCCTGTGTCGAGGCTGTAGGGG + Exonic
1036674560 8:10819133-10819155 TCCATCTGCTGAGGGTGCAGGGG + Intronic
1037534011 8:19808227-19808249 TCCCTCTGTGGAAGGTTTTGAGG - Intergenic
1039333647 8:36566504-36566526 TCCCTCTGTAAAGGGTGAGGAGG + Intergenic
1040389828 8:46940476-46940498 TCCATCAGTGGAGGGTGCTGGGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043889929 8:85643702-85643724 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043891467 8:85655610-85655632 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043892540 8:85662447-85662469 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043893017 8:85714888-85714910 TCAGTCTCTTGAGGGTGTTCAGG - Intergenic
1043895704 8:85736342-85736364 TCAGTCTCTTGAGGGTGTTCAGG - Intergenic
1043896975 8:85745466-85745488 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043899299 8:85763833-85763855 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043900909 8:85776027-85776049 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043902873 8:85791302-85791324 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043904483 8:85803495-85803517 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043906095 8:85815686-85815708 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1043907703 8:85827876-85827898 TCAGTCTCTTGAGGGTGTTCAGG + Intergenic
1044084264 8:87924523-87924545 TGCCTCTGCTCAGGGTTTTGAGG - Intergenic
1044729467 8:95218542-95218564 TCCCTCTTTGGTGGGTGTGGTGG + Intergenic
1045857617 8:106782203-106782225 TCACTTTGTTGATGGTGTAGAGG + Intergenic
1045932926 8:107647868-107647890 TCCCTCTGAAGAAGCTGTTGTGG + Intergenic
1046082939 8:109394502-109394524 TCACTCTGTTGCGGGGGTGGTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1049219818 8:141424071-141424093 TCCCTCTGCTGAGGGTGCAGAGG + Intronic
1049382589 8:142324896-142324918 TCCCTCGGCTGAGGGGGCTGTGG + Intronic
1051493110 9:17689179-17689201 ACCCTCTGTTGGGGGTTTTCTGG - Intronic
1052379802 9:27757748-27757770 TCCCTTTTTTGGGGGTGGTGGGG + Intergenic
1053353856 9:37430562-37430584 TCCCTCGGTTGCAGGTGTTAAGG - Exonic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1055552616 9:77445361-77445383 TCCTTGTTTGGAGGGTGTTGAGG - Intronic
1055670449 9:78600280-78600302 TCCCTCTATTGAAGGGGTGGTGG + Intergenic
1058272160 9:102986156-102986178 TCCCACTGTTGGGAGTCTTGAGG + Intergenic
1058575987 9:106401798-106401820 CCTCTGTGTTGAGGGTGTTGAGG - Intergenic
1059467917 9:114481113-114481135 TTTGTCTGTTGAGAGTGTTGGGG - Intronic
1060017150 9:120096683-120096705 TTCCTCTGCTGAGGGAGTAGGGG + Intergenic
1060101888 9:120847932-120847954 TCTCTCTTTTGAGGGTGTAAGGG - Intergenic
1060580805 9:124744820-124744842 ACCATCTGTTGAGGATGGTGTGG - Intronic
1060657247 9:125380535-125380557 TCCATCTGTTGGGGGTGGGGTGG + Intergenic
1062100434 9:134725166-134725188 TCCCTCCCTTGAGTGTGGTGGGG + Intronic
1062312854 9:135948638-135948660 TCTCCCTGTGGAGGGTGCTGGGG - Intronic
1062321217 9:135991267-135991289 TCCCTCTGTTCTGGGCGTTCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1190501498 X:51083176-51083198 TTCTTCTGTTGAGGGTGTTGGGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193488248 X:82114971-82114993 TCCTTCTCTTCAGGGTGATGAGG + Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1194242891 X:91473657-91473679 TCACTCTGTTGATGGTTTTTTGG - Intergenic
1197147283 X:123184625-123184647 TACCTATGCTGATGGTGTTGGGG - Exonic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201515803 Y:14817847-14817869 TTCCTCTGTTGAGAGTGTAGAGG + Intronic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic