ID: 1143135393

View in Genome Browser
Species Human (GRCh38)
Location 17:4709940-4709962
Sequence ACTCACCCGCTCCCATCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143135393_1143135397 -1 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135397 17:4709962-4709984 TGAGTGGATGTTAGCTGGGATGG No data
1143135393_1143135399 3 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135399 17:4709966-4709988 TGGATGTTAGCTGGGATGGGTGG No data
1143135393_1143135400 4 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135400 17:4709967-4709989 GGATGTTAGCTGGGATGGGTGGG No data
1143135393_1143135395 -6 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135395 17:4709957-4709979 GTGAGTGAGTGGATGTTAGCTGG No data
1143135393_1143135396 -5 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135396 17:4709958-4709980 TGAGTGAGTGGATGTTAGCTGGG No data
1143135393_1143135402 16 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135402 17:4709979-4710001 GGATGGGTGGGTGAAGGAGATGG No data
1143135393_1143135398 0 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135398 17:4709963-4709985 GAGTGGATGTTAGCTGGGATGGG No data
1143135393_1143135401 10 Left 1143135393 17:4709940-4709962 CCGATGGATGGGAGCGGGTGAGT No data
Right 1143135401 17:4709973-4709995 TAGCTGGGATGGGTGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143135393 Original CRISPR ACTCACCCGCTCCCATCCAT CGG (reversed) Intergenic
No off target data available for this crispr