ID: 1143135548

View in Genome Browser
Species Human (GRCh38)
Location 17:4710576-4710598
Sequence CCTCCCTCCCGGCCCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 587}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143135548_1143135555 -3 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135555 17:4710596-4710618 AGGGGGAAGAGGCGAGAGCGCGG 0: 1
1: 0
2: 1
3: 54
4: 716
1143135548_1143135562 27 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135562 17:4710626-4710648 GCGTGCGCATTGGCGCGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1143135548_1143135559 22 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135559 17:4710621-4710643 GGCGCGCGTGCGCATTGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 105
1143135548_1143135561 24 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135561 17:4710623-4710645 CGCGCGTGCGCATTGGCGCGGGG 0: 1
1: 0
2: 1
3: 6
4: 48
1143135548_1143135558 17 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135558 17:4710616-4710638 CGGAGGGCGCGCGTGCGCATTGG 0: 1
1: 0
2: 1
3: 5
4: 46
1143135548_1143135560 23 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135548_1143135557 1 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135557 17:4710600-4710622 GGAAGAGGCGAGAGCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 301
1143135548_1143135556 0 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135556 17:4710599-4710621 GGGAAGAGGCGAGAGCGCGGAGG 0: 1
1: 0
2: 4
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143135548 Original CRISPR CCTCCCTCCCGGCCCCGCTC TGG (reversed) Intronic
900163753 1:1236591-1236613 CTCTCCTCCCGGCCCCGCTCTGG - Intergenic
900180432 1:1308758-1308780 CCTCCTTCCCGCCTCCGCCCGGG - Intronic
900191509 1:1354163-1354185 CCCCCCTCCCGGCCCTCCTGGGG - Intronic
900266541 1:1760000-1760022 CTGCCCTCCCGGCCCCGCCGTGG - Intronic
900650920 1:3729780-3729802 CCTGCCTCCCGGCCCCGCCATGG + Intronic
900661924 1:3789054-3789076 CCTCCCTTCCGGCCCCACATGGG + Intronic
901002177 1:6154353-6154375 CCTCCCTCCAGGCCCACGTCGGG + Intronic
901026002 1:6279078-6279100 ACTCCCACCTGGGCCCGCTCTGG - Intronic
901525984 1:9823741-9823763 CCTCCCTGCCGCTCCCGCCCCGG - Exonic
901629663 1:10641958-10641980 CCACCCTCCAGGCCACGCTCCGG - Intronic
901821673 1:11834404-11834426 ACTCCCTCCAGGCCCCTGTCAGG + Intronic
902323579 1:15684337-15684359 CTTCCCCGCCGGCCGCGCTCCGG + Exonic
902388332 1:16088645-16088667 CCACCCTCCTGGCCCTGCCCAGG - Intergenic
902812509 1:18896579-18896601 TTTCCCTCCAGGCCCCGCCCTGG - Intronic
903273939 1:22209003-22209025 CCTCCCTCATGGCCCCGACCTGG + Intergenic
903338865 1:22642148-22642170 CCGCCCACTTGGCCCCGCTCCGG - Intergenic
903448445 1:23437099-23437121 CCTCCCTCCTGCCCCGGCCCCGG + Intronic
904037639 1:27567378-27567400 CCCCCCTCCCGGCCCCCCGACGG - Intronic
904237317 1:29123766-29123788 CCTCCCTCCCTCCCTCGGTCAGG - Intronic
904420774 1:30389809-30389831 CCTCCCTCCAGGCTCCCCTGTGG - Intergenic
904467738 1:30718358-30718380 CCTCCGCCCCGGTCCCGCCCTGG + Intronic
904467800 1:30718531-30718553 GCTCCTCCCCGGCCCCGCCCCGG + Intronic
904677650 1:32208155-32208177 CCTACCTCCCTGACCAGCTCTGG + Exonic
904913842 1:33955261-33955283 ACTCCCACCCCGCCCCACTCAGG - Intronic
905066865 1:35192145-35192167 CCTCGCCCCCGCCCCCGCGCTGG - Intronic
905150130 1:35920695-35920717 CCTCCCGCCCCGCCCAGGTCTGG + Exonic
905336286 1:37246839-37246861 CCTGGCTCCCGCCCCTGCTCCGG - Intergenic
905417472 1:37814080-37814102 CCTCCATCTCTGCCCCCCTCTGG - Exonic
905670660 1:39788459-39788481 CCGCGCTCCCCGGCCCGCTCTGG - Exonic
906430293 1:45750609-45750631 CTTCCCTCCGGCGCCCGCTCAGG + Exonic
906654022 1:47534526-47534548 CCTCCCTCCTGGCACTGCCCTGG + Intergenic
907261209 1:53220232-53220254 CCTCTCCCCGGGCCCCGCCCCGG + Intronic
908252245 1:62274409-62274431 GCTCCCTCCTGGACCAGCTCTGG + Exonic
910301075 1:85708187-85708209 ACTCCCTCCCTGCCAGGCTCTGG + Exonic
911440670 1:97921514-97921536 CCTCCCTCCCCTCCCCGCTGGGG - Intergenic
911527603 1:99004937-99004959 CCTCCCTCGCGACCCCGCGCCGG - Intronic
912390535 1:109299743-109299765 CCGTCCTCCCTGCCCTGCTCAGG + Intronic
912519214 1:110233869-110233891 CCTCCCTCCCTGCTCCTCCCTGG + Exonic
914747817 1:150512423-150512445 CCACCCTCCCAGCCCTACTCGGG + Exonic
914772079 1:150696776-150696798 CCTCCCCCCCTGCCCCGCGAAGG - Intronic
915118220 1:153613243-153613265 CCACCCTCCCAGCCCCGCAGGGG + Intergenic
915280114 1:154816659-154816681 CCTCACTCCTGCCCCAGCTCTGG + Intronic
915479210 1:156173622-156173644 CTTCACTCCCAGCCCAGCTCAGG - Intronic
915553273 1:156647195-156647217 CCTCCCTCCCTCCCTCCCTCTGG - Intronic
915590207 1:156866413-156866435 CCTCCTTCCGGGCCCTCCTCAGG - Intronic
915932794 1:160070278-160070300 CCGCCTGCCCGGCCCCCCTCCGG - Intergenic
916071625 1:161173563-161173585 CCTCCCTCCTGACCCCAGTCTGG - Intronic
916643462 1:166757548-166757570 CCTTCCTCCCCGCCCAGCCCTGG + Intergenic
916694179 1:167220446-167220468 CTTCCCTCCTGGCTTCGCTCCGG - Intergenic
916792546 1:168136813-168136835 CCTTCCTCCCCGCCGCGCTCCGG + Intronic
917964833 1:180171933-180171955 CCGCCCTCCTGGCCTCTCTCTGG - Intronic
919685530 1:200479925-200479947 CATCCCTCCCAGCCCAGGTCAGG + Intergenic
919824813 1:201495967-201495989 CCTGCCACCCCGACCCGCTCTGG + Intronic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
920033235 1:203049615-203049637 CCTCCCTCTCTGCCCCTCCCTGG + Intronic
920165330 1:204031635-204031657 CCTCCCTCCCTGCCCCTCCTTGG - Intergenic
920249943 1:204616938-204616960 CCTCCCTCCCTTCCTCACTCTGG + Intergenic
920315973 1:205075836-205075858 CATCCCTCCTGGCCCCCCTCTGG + Exonic
920692247 1:208155721-208155743 CCACCCTCCCTGCCCAGCTCTGG + Intronic
921386170 1:214572263-214572285 CCTCCTTCCAGGCCCAGCCCAGG - Intergenic
921894029 1:220380269-220380291 CCTCCCACCAGGCCCCTCTCAGG - Intergenic
922216322 1:223523003-223523025 CCTGCCTTCCGGCACCGCTCAGG - Intergenic
922496508 1:226062254-226062276 CCTCCCTCCCCTCCCCGCCGCGG + Intronic
922677468 1:227561509-227561531 CGGCCCTCCCCGCCCCGCCCCGG - Intergenic
923592169 1:235328496-235328518 CCTCCCCCCCGCCCCCGCACCGG - Intronic
923625166 1:235607778-235607800 CCACCCTCCCTGCCTCTCTCCGG + Intronic
924415025 1:243849944-243849966 CCGCCCTCCCTGCCTCCCTCAGG - Intronic
924706452 1:246506832-246506854 GCCCCCTCCCAGCCCCGCTGCGG + Intronic
1062804874 10:411044-411066 CCTCCTTCCCGGGCTTGCTCCGG - Intronic
1062843507 10:688821-688843 CCTCCCCCCGGGCCGGGCTCCGG - Intronic
1063264048 10:4426119-4426141 CCTCCCACCAGGCCCCACACTGG - Intergenic
1063593149 10:7410979-7411001 CCTCCCTCGCGCGCCCGCTCCGG + Intronic
1064049731 10:12049649-12049671 CCTCCCTCCTCGCCCAGCTTAGG - Intergenic
1064281665 10:13956948-13956970 CCTCCCTCCAGCCCCCACACTGG + Intronic
1064888926 10:20146527-20146549 CCTCCCTCCCTCCCTCCCTCAGG + Intronic
1065343284 10:24724835-24724857 CTTCCCACCCCGCCCCGCTCCGG + Intergenic
1065712697 10:28533032-28533054 CCTTCCTCCCCGCACCGCGCGGG - Intronic
1066047138 10:31603762-31603784 CCTCCCTCCCGCTGCCGCACTGG + Intergenic
1066370624 10:34815509-34815531 CCTCCCTCCCTCCCTCCCTCCGG + Intergenic
1067132076 10:43574250-43574272 CCTCCCTCCTGGCCGAGCTCTGG - Intronic
1067336973 10:45374159-45374181 CCCCGGTCCCGGCCCCGCCCCGG - Intronic
1067440993 10:46309209-46309231 GCTCCCTGCCCGCCCAGCTCTGG + Intronic
1067471438 10:46541330-46541352 CCTCCCTCCCGAATCCCCTCAGG + Intergenic
1067527394 10:47046848-47046870 CCACCCTCCCGCCCACACTCAGG - Intergenic
1068679827 10:59807737-59807759 CCTCCCTCCTTTCCCAGCTCTGG - Intronic
1069588989 10:69630417-69630439 CGTCCCTCCCGCCCCCGGCCCGG + Intronic
1069660105 10:70117774-70117796 CCTCCCTCCCTGCCCTGCCCTGG - Intronic
1070329026 10:75404950-75404972 CCCCACTCCCGGGCCCGCGCCGG - Intergenic
1071498076 10:86182266-86182288 CCTCTCTCCCGGCCCCAAGCAGG + Intronic
1072881349 10:99232681-99232703 CCGCCCTCACCGCCCGGCTCTGG + Intronic
1073009112 10:100346613-100346635 CCTCCCTCCCGGGCGAGCGCGGG - Intergenic
1073044997 10:100631898-100631920 CCTCCCGCCCGTGCCCGCTGCGG + Intergenic
1073076858 10:100829708-100829730 CCGCCCTCGCCGCCCCGTTCGGG - Exonic
1074566686 10:114585735-114585757 CCAGGCTCCCGGCCCCTCTCAGG + Intronic
1074781737 10:116807200-116807222 CCTCCCTCTAGGCCCTGCACTGG - Intergenic
1076806103 10:132859613-132859635 CCTCCCTCCCGACCTTGCCCTGG - Intronic
1076840504 10:133042998-133043020 TCTCCCTCGCGACCCAGCTCCGG - Intergenic
1077076902 11:706145-706167 CTCCTCTCCCGGCCCCGCCCCGG + Exonic
1077150006 11:1068455-1068477 CCTCCCACCCTTCCCCACTCGGG - Intergenic
1077177243 11:1196484-1196506 CCTCCCTCCTGGCCCTGCCATGG + Intronic
1077229142 11:1450816-1450838 GCTCTCTCCCAGCCCCACTCTGG - Intronic
1077404599 11:2377469-2377491 CCACCCGCCAGGCCCCGCGCCGG + Exonic
1077492589 11:2868971-2868993 CCTCCCTCCAGGGCCCCCTCTGG - Intergenic
1077500862 11:2909279-2909301 CCTCCAGCCCGGCCCTGCCCGGG + Exonic
1077505768 11:2929468-2929490 CGCCCCTCCCCGCCCCGCCCCGG + Intergenic
1077916782 11:6616730-6616752 CCTCAATCCCGGCCCGGCCCCGG + Exonic
1078101086 11:8330718-8330740 CCTCCCCACCCGCCCCTCTCTGG + Intergenic
1078317566 11:10305606-10305628 CCGCCCTCCGTGCCCCGCCCGGG + Exonic
1079112090 11:17610680-17610702 CGTCCCTCCCAGCTCCTCTCTGG + Exonic
1079250144 11:18781140-18781162 GCACCCCCCCGGCCCCGCCCCGG + Intronic
1080540436 11:33258518-33258540 CCTTCCTCCCGCCGCCGCTGGGG - Intronic
1081612027 11:44568557-44568579 CCTCCCTCCCATCCCAGCCCAGG + Intronic
1081669576 11:44935532-44935554 CCTCCCTCACTGCCCACCTCAGG + Intronic
1082807762 11:57461140-57461162 CCTCCCTCCCCGCTCCGGGCCGG - Intronic
1083261859 11:61527526-61527548 CCTCCCTCCCTGCCCTCCTCAGG + Intronic
1083310362 11:61780732-61780754 CCTGTCTCCTGGCCCTGCTCCGG + Exonic
1083421022 11:62553362-62553384 CCTCCCTCCCTGCTCCCCACTGG - Intronic
1083514617 11:63245083-63245105 CCTCCCTCCCTGCCTCCATCTGG + Intronic
1083636271 11:64122605-64122627 CCTCTTTCCCTGCACCGCTCTGG - Intronic
1083796257 11:65018504-65018526 CCACCTTCCCTGCCCTGCTCTGG - Intronic
1083995066 11:66267651-66267673 CCTCCCACCCGGCCCCGCCCAGG + Exonic
1084040422 11:66539494-66539516 CCTTCCTCCCTGCACAGCTCTGG + Exonic
1084062854 11:66687291-66687313 CCTCCCCTGAGGCCCCGCTCTGG + Intronic
1084207052 11:67601267-67601289 TCTCCCTGCTGGCCCAGCTCAGG - Intergenic
1084603285 11:70159053-70159075 CCTCCTTCCCGGCCCCGCACTGG - Intronic
1084729499 11:71064400-71064422 CCTGCCTCCCGGCCCCTTGCCGG - Intronic
1084973058 11:72781776-72781798 CCCGCCGCCCGGCCCCGCCCCGG + Intronic
1085530804 11:77190905-77190927 ACCTCCTCCCGGCCCCACTCCGG + Intronic
1085544172 11:77301692-77301714 CCTCCCGCCCCGCCTCCCTCGGG - Intergenic
1085800135 11:79581741-79581763 CATCCCTCCCTCCCCTGCTCTGG - Intergenic
1087252958 11:95924056-95924078 TCTCCCTCCCGGGCCGGCGCTGG - Exonic
1089253056 11:117179037-117179059 CCTCCCTCCCCGCCCCCTCCCGG + Exonic
1091434121 12:460230-460252 CGTCTCTCCCGGCCGCTCTCCGG - Intergenic
1091773975 12:3172314-3172336 TCTGCCTCCCCGCCCAGCTCTGG + Intronic
1092143599 12:6200262-6200284 CCGCCCCACCGGCCCCGCCCGGG - Intronic
1093728745 12:22544368-22544390 CCTTCCTCCCGCCGCCTCTCCGG - Exonic
1094041508 12:26125111-26125133 CCTCCTCCCCCGCCCCCCTCCGG - Exonic
1095672330 12:44876116-44876138 CCTCCCTCCGGGCCCCCTCCGGG - Intronic
1096068836 12:48762724-48762746 CCTCCCCCACTGCCCCGCTTTGG - Intergenic
1096156231 12:49342806-49342828 ACTCCCTCTCGGCTCCCCTCGGG - Intergenic
1096693892 12:53336846-53336868 CCTTCCTCCAGGCCTTGCTCTGG - Intronic
1096865934 12:54562843-54562865 CCTCCCTCCCTGCCTCCTTCTGG + Intronic
1096870310 12:54588563-54588585 GCTCCCTCTCCGCTCCGCTCCGG + Exonic
1096981224 12:55729036-55729058 CCTGCCGCGCGGCCCCGCCCCGG + Intronic
1097237470 12:57549983-57550005 CCTCCATCGCGGCCCCGCCCAGG + Exonic
1097938445 12:65278709-65278731 GCTCCCTCCCTCCCCGGCTCCGG - Exonic
1097938578 12:65279176-65279198 CCTCTCTCCTGGGCCCGCGCGGG - Intronic
1101816899 12:108152330-108152352 CCTCCCACCCTGCCCTGCTCAGG - Intronic
1101873456 12:108583331-108583353 CCTGGCTCCTGGCCCTGCTCTGG + Intergenic
1103084685 12:118053259-118053281 CCTCCCTGCAGGCCACACTCTGG + Intronic
1103363958 12:120369207-120369229 CCCCTCCCCCGACCCCGCTCGGG + Intergenic
1103506103 12:121443123-121443145 CCTCCCTCCAGCCCCTCCTCTGG - Intronic
1103724708 12:122991856-122991878 CCGCCCTCCAGGACCAGCTCAGG + Intronic
1103781566 12:123402274-123402296 CCACGGCCCCGGCCCCGCTCCGG - Intronic
1104019545 12:124982458-124982480 CCTCCCTCCAGGGCCCCCTAGGG - Intronic
1104568135 12:129903419-129903441 CCTCGCCACCGGCCCCGCTGCGG - Exonic
1104982649 12:132581191-132581213 CCTCCCTCCCTGCCCCCCTTGGG + Intronic
1105012028 12:132762127-132762149 CCCCGCGCCCGGCCCCGCCCTGG - Intergenic
1105277235 13:18943417-18943439 CAACCCTCCCGGCCCTGCGCAGG + Intergenic
1105964404 13:25371929-25371951 CCTCCCGCGGGGCTCCGCTCAGG + Intergenic
1106032466 13:26015789-26015811 GCTCCCTCCAGGCCCCCATCAGG + Intronic
1106226295 13:27789688-27789710 CCTCCCACCCCGCCCCGCTCTGG + Intergenic
1106312878 13:28569052-28569074 CTTCCCTCCCGGCCCTGCAGTGG + Intergenic
1106474693 13:30088671-30088693 CCTCCCACCAGGCCCCACTGGGG + Intergenic
1106602558 13:31200220-31200242 CCTCCCTCCCCGCGCCGACCGGG - Intronic
1107935298 13:45341143-45341165 CCTCCCCCCGAGCGCCGCTCCGG - Exonic
1109094560 13:58096524-58096546 CCTCCCACCGGGTCCCTCTCAGG - Intergenic
1109683565 13:65784285-65784307 GCTCCATCCCGGCCTCCCTCCGG + Intergenic
1110161684 13:72385949-72385971 CCTCCCACCAGGTCCCACTCTGG + Intergenic
1111445929 13:88345775-88345797 CGCCCCTCCCGGCCCAGCCCCGG + Intergenic
1111675685 13:91385492-91385514 CCTCCCTACCCGCCCCGCACCGG + Intergenic
1112299030 13:98213535-98213557 CCTCCCTCCCCGCCCCCCAATGG + Intronic
1113489426 13:110679649-110679671 CCTCCCTCCCTCCCTCCCTCCGG - Intronic
1113748903 13:112765149-112765171 CCTCCCCCCCGCCCCGGCTCTGG + Intronic
1113896181 13:113765977-113765999 CCTGCCTCCAGGCCCACCTCAGG - Intronic
1114037877 14:18646358-18646380 CCTCCCTCCCGACCAGGCGCTGG + Intergenic
1114063323 14:19038742-19038764 CCTCTCCCCCGGCTCCGCCCTGG - Intergenic
1114073185 14:19131735-19131757 CCTCCCTTCCCTCCCCCCTCAGG - Intergenic
1114089081 14:19268248-19268270 CCTCCCTTCCCTCCCCCCTCAGG + Intergenic
1114098933 14:19361254-19361276 CCTCTCCCCCGGCTCCGCCCTGG + Intergenic
1114120744 14:19668670-19668692 CCTCCCTCCCGACCAGGCGCTGG - Intergenic
1114554073 14:23551471-23551493 CCTCCCTCCAGCGCTCGCTCCGG + Exonic
1114612660 14:24052614-24052636 CCCTCCTCCCGGCCCCGCCCCGG + Intronic
1115752906 14:36508348-36508370 TCTCCCTCCCGTTCCCGCGCTGG - Intronic
1115850008 14:37583788-37583810 CCTCCCTCCCGGCCTCCAGCTGG - Intergenic
1118366497 14:65101828-65101850 CCTCCCTGCAGACCCAGCTCGGG + Intronic
1119322394 14:73739677-73739699 CCACGCTCCGGGCCCCGCCCTGG + Exonic
1119410376 14:74426336-74426358 CTTCCCGCCCCGCCCCGCCCCGG - Intergenic
1121234637 14:92383314-92383336 CCTGCCTCCCGGCCCCCTCCAGG - Intronic
1121319670 14:92984250-92984272 CCTCACTTCCGGCCCTGCACAGG - Intronic
1122108989 14:99481680-99481702 CCGGCCTCCCTGCCCCGCCCCGG - Intronic
1122445153 14:101762175-101762197 CCTCCCTCCACGCCCAGCCCCGG - Intronic
1122486637 14:102086689-102086711 TCCCCCGCCCGGCCCCGCTGGGG - Intronic
1122558227 14:102592780-102592802 GCGCCCGCCCGGCCCCGCGCCGG + Exonic
1122623165 14:103071109-103071131 CCTCCCTCCCGGCCTCCATCAGG - Intergenic
1122736573 14:103847186-103847208 CCGCCCGCCCGGCCTCGCACCGG + Intronic
1122856572 14:104563048-104563070 CCTCCCTCCCTCCCTCCCTCAGG - Intronic
1122978537 14:105181031-105181053 CCGCGCTGCCGGCCCCGCCCCGG - Intronic
1122983178 14:105200661-105200683 CCCACCTCCCGGCCCCACCCAGG + Intergenic
1123040986 14:105490173-105490195 CGGCCCTCCCGGCCCCGCCTCGG - Intronic
1124012577 15:25850636-25850658 CCTCCCTCCCCCCCCAGCCCCGG + Intronic
1124055611 15:26238492-26238514 CCTCCTTCCTGGCCTCGCTGTGG - Intergenic
1125520656 15:40346236-40346258 CCTCCCTCCCTGCCCCACCATGG + Intergenic
1125535028 15:40437666-40437688 CCTCCCTCCAGCCCCTGCCCAGG - Intergenic
1126619564 15:50623487-50623509 GCCCCCTCCCCGCCCCGCCCTGG + Intronic
1128078311 15:64841820-64841842 CCCCCTCCCCGGCCCCGCCCCGG + Intergenic
1128742068 15:70090602-70090624 CTCCCCTCCCCTCCCCGCTCTGG - Intronic
1129170500 15:73804572-73804594 CCTCCCTCCCAGCTCCACTGGGG + Intergenic
1129265136 15:74389322-74389344 CCTCCTTCCCTGCCTCACTCTGG + Intergenic
1129278007 15:74460232-74460254 CGTCCCTCCCTGCCCCACCCCGG + Intronic
1129710766 15:77819328-77819350 GCTGCCTCCGGTCCCCGCTCCGG + Intronic
1129903998 15:79173153-79173175 CCACCCTCCAGGTCCAGCTCCGG + Intergenic
1130147240 15:81283226-81283248 TCTGCCTCCCGGCCCAGCCCTGG - Intronic
1131137992 15:89953026-89953048 CCTCCCTCCCCGCCCCCATGTGG - Intergenic
1132184353 15:99791143-99791165 CCTCCCTCCCCACCCCGCAATGG + Intergenic
1132320144 15:100919489-100919511 GCTGCCTCCCGGCCCCGCCCGGG + Intronic
1132348136 15:101120958-101120980 CCTCACTCCAGGGCCAGCTCAGG + Intergenic
1132434012 15:101781986-101782008 CCTCCCTCCCCACCCCGCGATGG - Intergenic
1132478328 16:153549-153571 CCTCCCTCCCAGCCCCAGACTGG - Intronic
1132480413 16:164139-164161 CCTCCCTCCCAGCCCCAGACTGG - Intronic
1132482302 16:172730-172752 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132483150 16:176534-176556 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132552887 16:560577-560599 CGCCCCTCCCCGCCCCGCGCCGG - Exonic
1132581078 16:684902-684924 CCTCCCTCCCGCCCGCCCCCAGG - Exonic
1132583042 16:694082-694104 CCGCCCTCCCAGCCCCGCCCCGG - Exonic
1132584710 16:701084-701106 GCTCCTTTCCCGCCCCGCTCGGG + Intronic
1132649623 16:1014604-1014626 CCTCCCTCCCAGCCCTGAGCAGG + Intergenic
1132675423 16:1119356-1119378 CCTCCCTCCAGGCCCCGGCGCGG + Intergenic
1132683452 16:1153026-1153048 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1132701700 16:1224872-1224894 CCGCCCTCCAGGTCCTGCTCAGG + Intronic
1132841353 16:1979810-1979832 CCTCCCTCCCGGCCTTGGCCCGG + Exonic
1132895596 16:2228020-2228042 TCTGCCTCCCAGCCCCTCTCTGG + Intronic
1133299733 16:4775045-4775067 CCTCCCTCCCGGACGGGCCCAGG + Intergenic
1133575863 16:7088917-7088939 CTTCCCTCCAGTCCCTGCTCTGG + Intronic
1134346263 16:13394541-13394563 CCTCCATCCCTGCCCTACTCAGG + Intergenic
1135295784 16:21278209-21278231 CCTCCACCTCGGCCGCGCTCAGG + Exonic
1135504687 16:23026199-23026221 TCTCCCTCCCGTCCCCACTCTGG - Intergenic
1136037369 16:27550223-27550245 CATCCCTCCCGACCGCGCTTTGG + Intronic
1136169191 16:28477909-28477931 TCTCCTTCCCTGCCCCGCCCTGG - Intronic
1136401906 16:30023909-30023931 CCTCCCTCCCCGCCAGGGTCTGG + Intronic
1136590352 16:31214670-31214692 CCGCGCTCCCGGCCCAGCCCTGG - Intronic
1137565136 16:49528065-49528087 CCTCTCTCCCTGCCCAGCTAGGG + Intronic
1138173412 16:54874271-54874293 CCTCCCACCAGGCCCCTCCCTGG + Intergenic
1138389114 16:56657638-56657660 CCCGCCCCCCGGCCCCGCCCCGG - Intronic
1138528116 16:57620461-57620483 CCTGCCTCCCGTCCATGCTCAGG - Intronic
1138599700 16:58047141-58047163 GCTCCCTCCCTGCCCCACCCCGG - Intergenic
1139402838 16:66696268-66696290 CCTCCCTCCCCGCCCCGCTGCGG - Intronic
1139429520 16:66903750-66903772 CCTCACGCCCTGCCCCGCCCAGG + Intergenic
1139652177 16:68368018-68368040 CCAGCGTCCCGGCCCCTCTCCGG + Intronic
1139774904 16:69311131-69311153 CGTCCCGCCAGGCCCCGCCCCGG + Intronic
1139775058 16:69311636-69311658 CCGGCCTCGCGACCCCGCTCCGG + Intronic
1140470198 16:75209441-75209463 CATCCCTCCCGCTCCCACTCTGG - Intergenic
1141502390 16:84453065-84453087 CCTCACTCCCGGCCCCACCTCGG - Intronic
1141522134 16:84587697-84587719 CGTCCCTCCTGGCCACTCTCTGG - Intronic
1141647211 16:85373910-85373932 CCTCCCTCCCCGCTCCCCGCAGG + Intergenic
1141670038 16:85486812-85486834 CCTCCCTCCCGGCATGGCTGGGG + Intergenic
1141830984 16:86509979-86510001 CCTCCGTCCCTGCCCCCCTCGGG - Intergenic
1141840191 16:86568855-86568877 CTCCCCTCCCCGGCCCGCTCCGG + Exonic
1141961275 16:87411097-87411119 CCTCCCTGCCGGCGCGGCTGTGG - Intronic
1142113885 16:88346412-88346434 CCTCCCTCCCAGCCCTGGCCTGG + Intergenic
1142585917 17:973244-973266 CCTGCCTCCCGTCCCAGCTCTGG - Intronic
1142586864 17:979460-979482 CCCCGCTCCCGGCCCCGGCCCGG + Exonic
1143030349 17:3964085-3964107 CCTGCCTCCCCACCCGGCTCTGG - Intronic
1143135548 17:4710576-4710598 CCTCCCTCCCGGCCCCGCTCTGG - Intronic
1143201454 17:5116258-5116280 CGCCACTCCCGGCCCCGCTCCGG + Intronic
1144021268 17:11241404-11241426 CCTCCCGCCCGGCCCCGCCATGG + Exonic
1144948820 17:18983171-18983193 CCTCAGTCCCGGCCCAGCCCAGG - Intronic
1144993349 17:19249293-19249315 TCTCCCTCCCAGCCACCCTCAGG - Intronic
1145163148 17:20589238-20589260 CCTACCCCCCGGCCAGGCTCTGG + Intergenic
1145826997 17:27884559-27884581 CCTTCCTCACGGTCCCTCTCTGG + Intronic
1145878139 17:28335335-28335357 CCTACCTGCCGGCCCCGCGGCGG + Exonic
1146052892 17:29567072-29567094 CCTCCCGCGCGGGCGCGCTCTGG + Exonic
1146057705 17:29589457-29589479 CCTGCTGCCCGGCCCGGCTCCGG + Exonic
1146258200 17:31403987-31404009 CCTCCCTCCCTGCCCAGTGCTGG - Intronic
1146276917 17:31522090-31522112 TCTCCCTCCAGGCCCTGCCCTGG - Intronic
1147150776 17:38512426-38512448 CCTGTCTCCCAGCCCCACTCTGG - Intergenic
1147167704 17:38602203-38602225 CCTCCCTCCCTTCCTCCCTCGGG + Intronic
1147690613 17:42312548-42312570 CCTGGCTCCCAGCCCCGCCCAGG - Intergenic
1147987605 17:44315378-44315400 CCCCCATCCCCGCCCCGCCCCGG - Intronic
1148124040 17:45227941-45227963 TGTCCCTCCCTGCCCCCCTCAGG + Intronic
1148204935 17:45774283-45774305 CCTCCTTCCCAGCCTTGCTCCGG - Intergenic
1148206612 17:45783925-45783947 CCTCCCGCCCGGCCGAGGTCGGG - Intergenic
1148225284 17:45894817-45894839 CCTCCCTGCCTCCCCTGCTCGGG + Intronic
1148262116 17:46193121-46193143 CCGCCCTCCCGGCCGGGCTGCGG - Intronic
1148488006 17:48003600-48003622 CCCCACTCCTGGCCCCTCTCAGG - Intergenic
1148495081 17:48048615-48048637 CTTTCCTCTCGGCCCCGCGCGGG - Intronic
1148547619 17:48529750-48529772 CCACCCTCCGGGCCCGGCTCAGG + Exonic
1148564880 17:48626792-48626814 CCTCCCTCCCCGACCCGCCTGGG - Intronic
1148681133 17:49474119-49474141 CCTCCCTCCCCCACCCGCCCGGG + Intronic
1148818226 17:50345998-50346020 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1148862662 17:50612730-50612752 CCTCCCTCCCTGCCCCGAAGTGG + Intronic
1149442987 17:56690796-56690818 CCTCCGTCCTGGCCTCTCTCCGG - Intergenic
1149553012 17:57553998-57554020 CCTCCCTCCCTGCCCCTTTATGG + Intronic
1149595263 17:57861530-57861552 CCTCCCTCCCGGCCTGGGGCAGG - Exonic
1149626501 17:58083868-58083890 CCTCCCTCTCGGCGCAGCCCGGG + Intronic
1149850373 17:60030349-60030371 CCTCCCTCCCCACCCTGCTTTGG - Intergenic
1149859793 17:60116175-60116197 CCTCCCTCCCCACCCTGCTTTGG + Intergenic
1150313169 17:64146156-64146178 GCCCCCTCCCAGCTCCGCTCGGG - Intergenic
1150643540 17:66964832-66964854 CCTCCCTCCGCGCGCCGCTCCGG - Intergenic
1150830760 17:68517616-68517638 CCTCCCACCAGGTCCCTCTCAGG + Intronic
1151475618 17:74342975-74342997 CCTCCCTCCCAGCCCCACCCCGG + Intronic
1151566551 17:74901648-74901670 CCTCACTCCCCTCCCAGCTCTGG - Intergenic
1151600113 17:75100814-75100836 CCTCCCTCCCAGCTCCTCACCGG - Exonic
1151819759 17:76491132-76491154 CCTCCATCCTGGCCCTGCTGTGG - Intronic
1151969887 17:77452115-77452137 CCTCCCTCCCCGCTCCTCCCAGG - Intronic
1152260328 17:79263274-79263296 CCTCTCTCCCGGCCCAGCATTGG + Intronic
1152453828 17:80401291-80401313 CCTCCCTCCCACACCCGGTCCGG + Intergenic
1152460569 17:80439976-80439998 GCTCCCTCCATGCCCCTCTCTGG - Intergenic
1152506210 17:80750455-80750477 CCTCCCTCCCAGCCCCTTTCCGG + Intronic
1152686137 17:81694681-81694703 CCTCCCTCCGTGCCCTCCTCTGG - Intronic
1152690654 17:81716363-81716385 GCTGCCTCCCTGCCCAGCTCAGG + Intronic
1152870561 17:82751350-82751372 CCCCGCTCCCGCTCCCGCTCTGG + Intergenic
1153581961 18:6582478-6582500 CCTGCCTGCCGGCCCCTCCCAGG + Intronic
1153935200 18:9914533-9914555 CCTCCCGCCCGCCCTCGCTGCGG + Intronic
1155158575 18:23177890-23177912 CCACCCTCCTTGCCCGGCTCAGG + Intronic
1155165919 18:23232423-23232445 CCTCCCTCCCTGCCCACCGCAGG + Intronic
1155235083 18:23810971-23810993 CCTCTCTCCCTGCCCTCCTCTGG + Intronic
1156404708 18:36773058-36773080 CCTCCAGCCTGGCCCTGCTCTGG - Intronic
1156448593 18:37254055-37254077 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1157205067 18:45691156-45691178 CCCCCCGCCCCGCCCCGCCCAGG + Intergenic
1157308121 18:46531680-46531702 CCTCCCTCCCCGTCCCACCCAGG + Intronic
1158643048 18:59219789-59219811 CACCCCTCCCGGCCCAGATCAGG + Intergenic
1160225479 18:77008237-77008259 CGACCCTGCCGGCCCCGCCCTGG - Intronic
1160667110 19:336053-336075 CCTCCCTCCTTCCCCTGCTCAGG - Intronic
1160739398 19:679090-679112 GCTCCCTCCAGACCCCCCTCTGG + Intronic
1160823343 19:1068163-1068185 CCTCCCCGCAGGCCCCGCCCCGG + Intronic
1160851535 19:1195244-1195266 CCTCCCTCCTGGCCTCTCTCTGG - Intronic
1160851959 19:1197058-1197080 CCTCCCTCCTGGCCTCTCTCTGG - Intronic
1161067963 19:2247817-2247839 CCTCCCTGCTGGCCCCCCTGGGG + Exonic
1161241130 19:3224612-3224634 CCTCCCGCCCGCGCCCGCCCCGG - Intergenic
1161254042 19:3296398-3296420 CCACCCTACCGCCCCCCCTCCGG - Intronic
1161265393 19:3361233-3361255 CCTGCCGCCCCGCCCCTCTCGGG - Intronic
1161316384 19:3619472-3619494 CCTCCCACCTGGCCCACCTCCGG - Intronic
1161585877 19:5105160-5105182 CCTCCTGCTCTGCCCCGCTCTGG - Intronic
1161628577 19:5340208-5340230 CCTGCCTCCAGGACCCGCCCGGG + Intronic
1161702950 19:5805019-5805041 CCCCGCCCCCGGCCCCGCGCCGG + Intergenic
1161733779 19:5978098-5978120 CCTCCCACAAGGCCCCGCGCCGG + Exonic
1161793131 19:6372794-6372816 CCTCTCTCATGACCCCGCTCCGG + Exonic
1161849754 19:6732222-6732244 CAGCCCTCCCCGCCCTGCTCCGG + Intronic
1162079356 19:8209297-8209319 CCGCCCCCACGGCCCCGCCCCGG + Intronic
1162110364 19:8396708-8396730 CCTCCCTCCCGCCCCCCCCCCGG - Intronic
1162751196 19:12830408-12830430 GCTCCCTGCCGGCCCTTCTCTGG + Intronic
1162971251 19:14182701-14182723 CAGCCCTCCCGGCCCAGCTGGGG + Intronic
1163102586 19:15107352-15107374 GCGCCCTCCCCGCCCCGCCCGGG - Intergenic
1163329423 19:16627490-16627512 TCTCCCTCCCCTTCCCGCTCCGG + Intronic
1163462766 19:17448697-17448719 CCTCCCTCCCGGGGCCCCGCGGG + Intronic
1163566043 19:18051979-18052001 CCTGGCTCCCGTCCCCGCCCTGG - Intergenic
1163783410 19:19261940-19261962 CCTCCCTGCCCGCCCCGGCCCGG - Intronic
1164731063 19:30504621-30504643 CCTCCCTCCCACCCTCTCTCTGG + Intronic
1165071889 19:33260675-33260697 CCTCCCACCCGGCCCCTCCCTGG + Intergenic
1165445760 19:35856217-35856239 CCTCCCTGCCTGCCCCGGCCCGG + Intronic
1165948297 19:39458392-39458414 CCTCCCCACCAGCCCCGGTCTGG + Intronic
1166139840 19:40799809-40799831 CCTCCCTCCCAGCTTCCCTCCGG + Exonic
1166280946 19:41792879-41792901 CCTCTCTCCCGTCCCCACCCCGG + Intergenic
1166807556 19:45496520-45496542 CGTACCGCCCGGCCCCGCCCGGG - Intronic
1166836590 19:45671057-45671079 CCCTCCTCCCGGCCCCACTCTGG - Intronic
1166869830 19:45864421-45864443 GCCCCCACCCGCCCCCGCTCCGG - Exonic
1166986161 19:46661012-46661034 CCCCGCAGCCGGCCCCGCTCAGG + Exonic
1166995277 19:46717006-46717028 CCCCCCACCCAACCCCGCTCCGG - Exonic
1167103757 19:47419114-47419136 CCTCCCCCGCGGCCAGGCTCTGG - Exonic
1167268065 19:48493303-48493325 CCTCCCTCCAGGCCCCGCCCTGG + Intronic
1167469398 19:49666932-49666954 ACTCCCTCCCTCCCCCGCTGAGG - Intronic
1167622288 19:50566922-50566944 ACTCCCTCCCCGCCCCTCTTTGG - Intronic
1167752468 19:51389129-51389151 CCCCCCGCCCGGCCCCTCTCTGG + Exonic
1168114103 19:54211378-54211400 CCTCCCTCCTGGCCCCCTACTGG - Intronic
1168347029 19:55654938-55654960 CAGCCCTCCCCGCCCCGCCCGGG - Intronic
926198009 2:10775221-10775243 CCTCCCCCCAGACCCTGCTCAGG - Intronic
926240454 2:11081107-11081129 CCTCCCTCCCTCCCTCCCTCTGG + Intergenic
926340575 2:11901499-11901521 CCGCTCTCCAGGCTCCGCTCTGG - Intergenic
927191072 2:20517303-20517325 CCTCCCGCCCTGCCCTGCCCTGG - Intergenic
927486487 2:23491749-23491771 CCTCCCTCCAGATGCCGCTCAGG + Intronic
927557985 2:24049621-24049643 CCTTCCCCCGGGCCCCGCCCCGG + Intronic
927558101 2:24049926-24049948 CCGCCCTCCGGGCTCCGCCCCGG - Intronic
927652392 2:24920326-24920348 CCTCCCTCGCCGCCCCACTCCGG - Intergenic
928998711 2:37324800-37324822 CCTCCCTCCCCGTCCCGTCCTGG + Intronic
930033002 2:47069659-47069681 CCTCCCTCCCGTTCCAGGTCTGG + Intronic
931649255 2:64454045-64454067 CCGCCCTCCCGGACCCGGACAGG + Intronic
932182642 2:69662432-69662454 CCTCCCACCCCTCCCCACTCAGG - Intronic
932190547 2:69738511-69738533 CCTCCCACCCCTCCCCACTCAGG + Intronic
932722479 2:74147986-74148008 TCAGCCTCCCGGCCCCGCCCCGG + Exonic
933595312 2:84277612-84277634 CCTTCCTCCTGCCCCAGCTCTGG - Intergenic
935445968 2:103157388-103157410 CCTCCCGCCCTGCCATGCTCAGG + Intergenic
936572297 2:113627142-113627164 CCTCCCGCCAGGCGCCGCGCTGG + Intergenic
937159612 2:119747586-119747608 CCACCCTCCCCACCCAGCTCTGG - Intergenic
937593566 2:123645244-123645266 CCTCCCACCAGGCCCCTCCCTGG - Intergenic
937670956 2:124536695-124536717 GCCCCCTCCCTGGCCCGCTCTGG - Intronic
937912095 2:127080756-127080778 CCCCCCTCCCTGCCCTGCCCTGG - Intronic
937986480 2:127640396-127640418 CCTCCAACACGGCCCCTCTCAGG + Intronic
938771776 2:134506938-134506960 CCTCCCTCCTGCCCCAACTCTGG + Intronic
940844004 2:158620004-158620026 CCTCCCTCCCTGTCTCCCTCTGG - Intronic
941911705 2:170770854-170770876 CCCGCCTCCCAGCCCCGCCCCGG + Intergenic
942151018 2:173076021-173076043 CCTCCCTCCCCGCCCTCCGCGGG - Intronic
942458326 2:176152453-176152475 CCTCCCTCCCGCCCTCTCCCCGG - Intronic
942678159 2:178450561-178450583 CCTGTCTTCCGGCCCCGCTGCGG + Intronic
945080766 2:206085246-206085268 CCGCCCGCCCCGCCCCGCCCCGG + Intronic
945404066 2:209423976-209423998 CCCTCCTCCCCGCCCCGCGCAGG - Intergenic
946248789 2:218400969-218400991 CCTCCCACCCCACCCCCCTCCGG - Intronic
946330055 2:219003916-219003938 CCTCCCTCCCGTCCTCACTGGGG + Intronic
946339344 2:219058081-219058103 CCTCCCTCCCGGCCGCTGGCTGG - Intronic
947742152 2:232489582-232489604 CCTCCCTCCCGGGTCAGCTCTGG + Intergenic
947744553 2:232500841-232500863 CCTGCCTCCTGGCCCTGCCCTGG - Intergenic
947749946 2:232526687-232526709 CCTCCCTCCCAACCCAGCACCGG - Intronic
947820084 2:233063346-233063368 ACTCCCTCCCAGGCCCCCTCTGG + Intronic
948081354 2:235207789-235207811 CCTCCCTCCCTGCTCCCCTCTGG + Intergenic
948141788 2:235678731-235678753 CCTCCCTCCCGCCCCCACCTTGG + Intronic
948159377 2:235811731-235811753 CCCCCGGCCCGGCCCAGCTCTGG + Intronic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
948809711 2:240468346-240468368 CCTGCCTCCTGCCCCTGCTCTGG + Intergenic
948900892 2:240956460-240956482 CTTCTCTCCTGGCTCCGCTCAGG - Intronic
949021954 2:241745951-241745973 CCTCTCTCCTGGCCCCCCTTGGG + Intronic
1168769731 20:407889-407911 CCGCCCTCCAGCCCCGGCTCCGG + Intronic
1168769797 20:408018-408040 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1169278350 20:4248295-4248317 CCGCCATCCTGGCCCTGCTCTGG - Exonic
1169426964 20:5504235-5504257 CCTCCCTCCCGGCTCAGGCCGGG - Intergenic
1170578649 20:17682084-17682106 CCTCTCTCCCGGCTCCGCGGCGG - Exonic
1170736931 20:19020917-19020939 CCCCACTCCCAGCCCCACTCAGG - Intergenic
1171473645 20:25390915-25390937 CCCCTCCCCCGGCCCCGCCCCGG + Exonic
1171489104 20:25504170-25504192 CCTCCCTCCCTCCCTCCCTCTGG + Intronic
1171499918 20:25585478-25585500 CCGCGCTCCTGGCCCCGCGCGGG - Exonic
1171567417 20:26208395-26208417 CCTCCGACCCGGTCCCGCTCCGG + Intergenic
1172094629 20:32454612-32454634 CCTGCCTCGGGGCACCGCTCTGG + Intronic
1172274478 20:33672352-33672374 CCTCCCACCCTGCCCCACTGTGG + Intronic
1172422029 20:34825655-34825677 CCTCCCTCCCCGGCCCGGTCCGG - Intergenic
1172624211 20:36337968-36337990 CCTCCCTCCCCTCCCCTCTTGGG - Intronic
1172951391 20:38725245-38725267 CATCCCTCCCAGCCCTGCGCGGG + Intronic
1173294149 20:41740695-41740717 CCTCCCTCCCTGCCCCCTTTTGG + Intergenic
1174135481 20:48376079-48376101 CATCCCTCCCCTCCCCTCTCCGG - Intergenic
1174216810 20:48922022-48922044 GCTCCCGCCCTGCCCCGCGCTGG + Intronic
1174258751 20:49278132-49278154 CCGCCCGCCCGGCTCCGCCCAGG - Exonic
1175196030 20:57243945-57243967 CCTCTCGCCCGGCTCTGCTCTGG - Intronic
1175561369 20:59933513-59933535 CCTCCCTCCGCGCCCCGCCGTGG + Intronic
1175877812 20:62238679-62238701 CCGCCCTCCCCTCCCCGCCCCGG - Intronic
1175941379 20:62539020-62539042 CCCCCACCCCTGCCCCGCTCCGG + Intergenic
1175941395 20:62539057-62539079 CCCCCACCCCTGCCCCGCTCTGG + Intergenic
1175975497 20:62708606-62708628 CCGCCATCCCCGCCCCGCCCGGG - Intergenic
1176029925 20:63006966-63006988 CCTCCCCCTCGCCCCCGCTTCGG + Exonic
1176100537 20:63362411-63362433 CCCCCCTCCCTGCCCACCTCTGG + Intronic
1176159692 20:63641918-63641940 GCTCCGCCCCGGCCCCGCCCCGG + Intronic
1176194914 20:63832319-63832341 CCTCCCTTCCCGCCGCGCCCGGG - Intergenic
1176223550 20:63981300-63981322 CCTCACCCCCGGCCCAGCCCCGG - Exonic
1176547419 21:8207879-8207901 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1176555324 21:8252088-8252110 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1176566370 21:8390926-8390948 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1176574246 21:8435113-8435135 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1176693897 21:9950128-9950150 CCTCCCTCCCCTCCCGGCTGAGG - Intergenic
1179416003 21:41199312-41199334 CCTCCCTCCCTGCCTCCTTCTGG + Intronic
1179707295 21:43188997-43189019 GCTCCCTCCCGGCCCCCACCGGG + Intergenic
1180181124 21:46119136-46119158 CCTGCCTCAGGGCCCCGCTCTGG + Intronic
1180462004 22:15573400-15573422 CCTCCCTCCCGACCAGGCGCTGG + Intergenic
1180481819 22:15761376-15761398 CCTCTCCCCCGGCTCCGCCCTGG - Intergenic
1180491626 22:15854088-15854110 CCTCCCTTCCCTCCCCCCTCAGG - Intergenic
1180843446 22:18969832-18969854 ACGCCCCCCCGGCCCCGCTGGGG + Intergenic
1180980877 22:19877439-19877461 CCTCCCACCCAGCCACGCCCTGG + Intronic
1181107929 22:20585657-20585679 CCTGCCTCACAGCCCTGCTCTGG - Intronic
1181343100 22:22198588-22198610 CTTCCCTCCCTGCCCAGCTGAGG + Intergenic
1181463525 22:23098821-23098843 CCTCACTGCCGGCACCACTCTGG - Intronic
1181811094 22:25404608-25404630 CCACCCCCCCCGCCCCCCTCCGG + Intronic
1182303045 22:29349445-29349467 CTTCCCTCCTGGCCCCTGTCTGG - Intronic
1182780417 22:32863144-32863166 CCTCCCTCCATGCACCGCTATGG + Intronic
1183383289 22:37501267-37501289 CCTCCGTCCCAGCCCCGCCCAGG - Intronic
1183663281 22:39233836-39233858 CCTAGGTCCCGGCCCCGCCCTGG - Intronic
1183856081 22:40636248-40636270 CCGCCCGCCCGGCCCGGCCCGGG + Intronic
1183858392 22:40652105-40652127 CCTCCCTCCTGGCCAGGCTTCGG + Intergenic
1184128282 22:42502423-42502445 CTTCCCTCCCAGCCCTACTCCGG - Intergenic
1184137072 22:42555736-42555758 CTTCCCTCCCAGCCCTACTCCGG - Intronic
1184194308 22:42916483-42916505 CCTCTCTCCTGCCCCTGCTCCGG + Intronic
1184486476 22:44783060-44783082 CCTCCCTCCCTCCCTCCCTCTGG + Intronic
1184596822 22:45518942-45518964 CCTCCCTCCTGGCACCGGCCTGG + Intronic
1185065395 22:48629408-48629430 TCTGCCTCCAGGCCCCCCTCCGG + Intronic
1185148183 22:49150447-49150469 TCTGCCTCCCTGCCCCACTCAGG + Intergenic
1185335810 22:50270417-50270439 CGGGCCTCCCGGCCCCGCCCCGG - Intronic
1185409718 22:50675156-50675178 CCGCCCTCCCGGGGCCGCGCCGG + Intergenic
1185427891 22:50783738-50783760 CCTCCCGCCAGGCGCCGCGCTGG - Intergenic
1203252292 22_KI270733v1_random:124164-124186 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1203260349 22_KI270733v1_random:169250-169272 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
950182547 3:10925993-10926015 CCTCGCTCCAGGCCCCGGCCTGG + Exonic
950400970 3:12768923-12768945 CCGCCCCCCCCGCCCCGCCCCGG - Intronic
951543922 3:23806891-23806913 CTTCCCTCCCTGCCCCGCCGTGG + Intronic
952301245 3:32106472-32106494 CCGGCCTCCAGGCCCGGCTCCGG - Intronic
953383577 3:42492275-42492297 CCTCCTTCCCAGCCCTGCGCAGG + Intronic
953418245 3:42735167-42735189 CCTCCCCCACGGCCTCGGTCTGG - Intronic
954196317 3:48999190-48999212 GCTCCCTCAGGGCCCTGCTCTGG - Intronic
954249852 3:49358899-49358921 CCTCCCTCCCTGGCCTCCTCAGG + Intergenic
954391698 3:50271016-50271038 CCTCCCTCCCTGCCTAGATCCGG - Intronic
954659343 3:52218691-52218713 CCTCCCACCCAGCCCCACCCTGG + Intergenic
955741172 3:62093208-62093230 CCTCCATCCCGGCTCCTATCAGG + Intronic
957407453 3:79790265-79790287 CCTCCCTCCTGGCTCCTTTCAGG + Intergenic
960590111 3:119357410-119357432 CCTCCCTCTCAGCCCCACACAGG - Intronic
960925925 3:122795025-122795047 CCTCCCCGCCGGCCCGGCTCGGG + Exonic
961013590 3:123450440-123450462 CCTCCCTGTCCGCCCCGCCCCGG - Intergenic
961444332 3:126972123-126972145 CCTTCCTCCAGCCCCCGCACAGG - Intergenic
961811290 3:129523284-129523306 CCTCCCTACCTGCCCTGCTTGGG + Intergenic
962352076 3:134663702-134663724 CCTCCTTCCTGGCCCCTCTGGGG - Intronic
962629755 3:137263997-137264019 CCTCCCTCCCACCCCTGCTGTGG - Intergenic
962750778 3:138433629-138433651 CCCCCCTCCCCACCCCGCCCCGG - Intergenic
962809860 3:138950615-138950637 ACTCCCTCCCGGCCCCTCACAGG + Exonic
963081987 3:141402680-141402702 CACCCCGCCCCGCCCCGCTCCGG - Intronic
963133299 3:141877195-141877217 CCTCCCGCCCGGCGCGGCGCCGG + Intronic
963526992 3:146427521-146427543 CCTCCCTCCCTGCCCAGCACCGG + Intronic
964011913 3:151901790-151901812 CCTCACTCCCAGCCAAGCTCTGG - Intergenic
964400306 3:156291298-156291320 GCTCCCTCCCGCCTCCGCTCCGG - Intronic
966234886 3:177689643-177689665 CCCCCCTCCCCGCCCCACACTGG - Intergenic
966331047 3:178814145-178814167 CCTCCCTCCCTGCCCCCTTTTGG + Intronic
967055219 3:185824714-185824736 CCTCCCTCCCGGCGCCGTCCCGG + Intronic
967055235 3:185824737-185824759 CCCCCCGCCTCGCCCCGCTCAGG - Intronic
967895997 3:194396830-194396852 CCCGCCTCCCCGCCCCGCTGCGG - Exonic
967948681 3:194823909-194823931 CCTCCCGCTCTGCCCTGCTCTGG + Intergenic
968006336 3:195245670-195245692 CCTCCCACCAGGCCCCAGTCCGG - Intronic
968433723 4:574840-574862 CCACCCACCCCGCCCCGCTCAGG - Intergenic
968579847 4:1384814-1384836 CCTCCCACCCGAGCCCACTCAGG - Intronic
968605513 4:1533288-1533310 CCTCCCTGCCTGCCCCACCCAGG - Intergenic
968809334 4:2792990-2793012 CCCTCCTCCTGGCCCCGCCCCGG - Intergenic
968907958 4:3463276-3463298 CCGCCCTCCTGGCCCAGCCCAGG + Intergenic
969504624 4:7577187-7577209 CCTCTCTCCCCTCCCTGCTCTGG - Intronic
970475232 4:16415462-16415484 CCTCCCACCAGGCCCCTATCAGG - Intergenic
971294499 4:25376976-25376998 CCTCCCTCTCCGCGCCCCTCGGG + Intergenic
973619403 4:52712314-52712336 CCCTCCACCCCGCCCCGCTCAGG + Intergenic
975983227 4:80182640-80182662 CATCCCGCCCGGCCGCGCTTGGG + Intergenic
976419788 4:84828072-84828094 CCTCCCTCCCTCCCTCCCTCTGG - Intronic
976765501 4:88593214-88593236 CCTCGCCCCCGGCCCCGCCCAGG - Intronic
977370310 4:96126411-96126433 GCTCCCGCCGGGCGCCGCTCGGG - Intergenic
980366518 4:131810325-131810347 CCTCCCTCCCCTCCCGGCTGGGG - Intergenic
984734969 4:183099724-183099746 CATCCCTCCCGGGACCCCTCGGG - Intronic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
985485577 5:146499-146521 CCTCCCTCCTGTCCCCACTGTGG + Intronic
985532734 5:443399-443421 CCGCCCTCCAGGTCCCGGTCCGG - Intronic
985545747 5:508153-508175 TCTCCATCCCGGGCGCGCTCTGG - Intronic
985757713 5:1729099-1729121 CCTCCCTCCCGGCCTCCGGCGGG - Intergenic
985783794 5:1883888-1883910 CGTCCCTCCCGGCGCCCCGCAGG + Intronic
985784562 5:1887027-1887049 CCCCGCTCCCGCCCCCGCCCCGG - Exonic
986341190 5:6790773-6790795 ACTCCCTCCCCACCCCACTCTGG - Intergenic
986535811 5:8785768-8785790 CCTCCATCCCAGCCTTGCTCAGG - Intergenic
991163286 5:63531100-63531122 CCTCCCACCAGGCCCCACTCTGG - Intergenic
991351090 5:65721791-65721813 CCTCCCTTCCGTCCTCCCTCAGG + Intronic
993386348 5:87267762-87267784 CCGGCCCCCCGCCCCCGCTCCGG + Intergenic
994043567 5:95284501-95284523 CCTCCTTCCAGGCCCGGCTCTGG - Exonic
996319151 5:122194264-122194286 CCTCCCTCCCAGCATCCCTCCGG - Intergenic
997400897 5:133601464-133601486 CCTCCTTCAGGGCCCAGCTCTGG - Intronic
997585362 5:135040239-135040261 CCTCCCTGGCTGCCACGCTCTGG - Intronic
998130237 5:139648199-139648221 CCTCCCTCCCAGCGCAGCTCGGG - Intronic
998174620 5:139894198-139894220 CCTCCCTCCCGGCACCCAGCGGG + Intronic
998353207 5:141514268-141514290 CCTCCCTCCCGTCCCCCCGGAGG - Intergenic
998406866 5:141878887-141878909 CCTCCCTTCCCGCTGCGCTCGGG + Intronic
999375003 5:151080843-151080865 CCTCCCCTCCATCCCCGCTCCGG + Intronic
999561060 5:152803433-152803455 CCTCCCACCAGGTCCCTCTCAGG + Intergenic
1000997264 5:167971925-167971947 CCTGCCTTCCAGCCCCACTCCGG - Intronic
1002091639 5:176810053-176810075 CTTTCCTCGCGGCCGCGCTCCGG - Intergenic
1002158848 5:177303320-177303342 TTTGCCTCCCGTCCCCGCTCAGG - Exonic
1002204627 5:177554179-177554201 CCCCACTCCCGCTCCCGCTCGGG + Intronic
1002714835 5:181220336-181220358 CCTTCCACCCGTCGCCGCTCTGG - Intergenic
1002784723 6:392408-392430 CCGCTCTCCCGGGCCTGCTCCGG + Intronic
1003931198 6:10926141-10926163 CCTCCCTACAGGACCAGCTCGGG - Intronic
1003986717 6:11442942-11442964 CCTCCCTCCTGGCTGCTCTCAGG - Intergenic
1004194000 6:13487772-13487794 GCTCCTCCCCGGCCCCGCCCAGG + Intergenic
1005901427 6:30220091-30220113 CCCCCCTCCCCGCCCCACCCCGG + Intergenic
1006132931 6:31879620-31879642 CCCACCTCCCTGCCCCGCACTGG + Intergenic
1006303878 6:33207821-33207843 CCTCCCTCCCTTCCCCGCCCCGG + Intergenic
1006304125 6:33208658-33208680 CCCCGCTCCCGCCCCCGCGCCGG - Intronic
1006454258 6:34122964-34122986 CCTGCCTCCTGGCCCTGCTCGGG - Intronic
1006920852 6:37626182-37626204 CCTCCCTGCAGGCCCTCCTCAGG + Intergenic
1007747113 6:44049984-44050006 CTTCCCTCCCCACCCTGCTCAGG - Intergenic
1013099468 6:106974839-106974861 CCGCCTTCCCCGCCCCGCTCCGG + Intronic
1015323223 6:131899125-131899147 CCTCCCACCAGGCCCAACTCTGG + Intergenic
1016738555 6:147506832-147506854 CAGCCCTCCCCGCCCCGCGCGGG - Intergenic
1017163779 6:151390283-151390305 CCGCGCCCCCGGCCCCGCCCCGG - Intronic
1017497551 6:154995245-154995267 CCTCCCGCCCCGCCCCGCCCCGG - Intronic
1019076731 6:169393975-169393997 CCTCCCTCCCTTCCCAGCTGCGG - Intergenic
1019429222 7:991028-991050 CCGCCCTCCCGGCCCTGCAGGGG + Intergenic
1019473322 7:1232648-1232670 CCTCCCTCCCTCCCTCCCTCCGG + Intergenic
1019524738 7:1475883-1475905 CCTCCCTCCCTGCCCGGCCAGGG + Intronic
1019546547 7:1579732-1579754 CCTCCCTCCCTCCCCAACTCTGG - Intergenic
1019666540 7:2254769-2254791 CCTGCCTCCCCGCACAGCTCTGG + Exonic
1019989504 7:4682093-4682115 CCTCGCCCCCAGCCCCGCGCTGG + Intergenic
1020139552 7:5605151-5605173 CCACCCTCCAGTCCCGGCTCCGG - Intronic
1020256058 7:6503722-6503744 GGTCCCATCCGGCCCCGCTCCGG - Intronic
1020900969 7:14003060-14003082 CATCGCACCCGGCCCCGTTCTGG + Intergenic
1020995219 7:15255201-15255223 CCTCCCTCCCCTCCCCGGACAGG - Intronic
1023758772 7:43444651-43444673 CTTCCCTTCCAGCCCGGCTCTGG - Exonic
1023937158 7:44748512-44748534 CCTTCCACTCGGCCCCGCCCCGG + Intergenic
1027015839 7:74779208-74779230 CTGCCCTCCCAGCCCCTCTCGGG + Intronic
1027072190 7:75166729-75166751 CTGCCCTCCCAGCCCCTCTCGGG - Intergenic
1027228651 7:76260210-76260232 CCTCCCTTCCCGCTCCGGTCAGG - Intronic
1027239669 7:76318641-76318663 CATCCCTCCCGGCCCAGGTCTGG - Intergenic
1029248629 7:99220404-99220426 CCTCCTTCCCTGCCCCTCTAGGG - Intergenic
1029444320 7:100604244-100604266 CCCCCCTCCAGGCCCCGCCCCGG + Intronic
1029688378 7:102164443-102164465 ACTCCCTCCCAGCCCCACTGTGG - Intronic
1031287156 7:119885180-119885202 CCTCCCACCAGGTCCCTCTCAGG + Intergenic
1032087275 7:128890845-128890867 CCTGCCGCCCCGCCCCGCCCCGG - Intronic
1032781917 7:135170599-135170621 TTTGCCTCCCGGCTCCGCTCTGG - Intronic
1033348016 7:140540487-140540509 CCACCCTCCCTGCCCTGCTCTGG - Intronic
1034273277 7:149813416-149813438 CCTCCCTCCCCTCCACCCTCAGG + Intergenic
1034940046 7:155224795-155224817 CCTGCCTCCCAGCCCCTCCCTGG - Intergenic
1034985898 7:155515299-155515321 CCCCCCCCCCGGCCCCGGCCAGG + Intronic
1034994740 7:155570711-155570733 CCTCCTTCCAGGCCCCTCACAGG + Intergenic
1035021643 7:155804152-155804174 CTTCCCTCCCGCCCCGGCGCGGG + Intronic
1035038454 7:155910508-155910530 CCTCCCTACCTCCCCTGCTCTGG - Intergenic
1035169683 7:157010529-157010551 CCTCCGTGCGGGCCCCGCCCCGG + Exonic
1035203997 7:157282689-157282711 CCACCCCCCCAGCCCCGCCCCGG - Intergenic
1035236171 7:157498937-157498959 CCTCCCTCCCTGCCCGGCGCAGG - Intergenic
1035476196 7:159145316-159145338 CTCCTCTCCCGGCCCCGCGCCGG - Intergenic
1035476854 7:159149874-159149896 CCTCCCACCAGGCCCCACCCGGG - Intergenic
1036432228 8:8702048-8702070 CCTCCCTCCCGGGCCAGGTTTGG + Exonic
1037577189 8:20218535-20218557 CCTCCTTCCCAGCCCCTCTGCGG + Intronic
1038359984 8:26866248-26866270 GGTCCCTCCCGGCTTCGCTCGGG - Intronic
1038444359 8:27593072-27593094 CCGCCCCCCCGGCCCCGCGCAGG - Intergenic
1038537967 8:28368166-28368188 CCTCCCTCCAGTCCTGGCTCTGG - Intronic
1038542481 8:28401825-28401847 CCTCCCTCCCGCCCCACCTCCGG + Intronic
1039712567 8:40071161-40071183 CCTCTCTCTGGGCCCCTCTCTGG - Intergenic
1040471243 8:47737586-47737608 CCCCGCGCCCGGCCCCGCCCGGG - Exonic
1040590428 8:48787868-48787890 GCTCCCTCCCAGCCCAGTTCAGG + Intergenic
1041624915 8:60014649-60014671 CCTCCCACCAGGTCCCTCTCTGG + Intergenic
1041687030 8:60653225-60653247 CCTCTCTCCCGGGCGTGCTCTGG + Intergenic
1044554012 8:93542447-93542469 CCTCCCCCCGGCCCCCGCTCTGG - Intergenic
1045368035 8:101493924-101493946 GCTCCCTCCCGCGCCCGCCCAGG - Intronic
1045582904 8:103499751-103499773 CCTCCCTCCCCGCCCGGCCCCGG + Intergenic
1045884554 8:107079954-107079976 CCTCCCACCAGGTCCCTCTCAGG + Intergenic
1047251790 8:123186421-123186443 GTTCCCTTCCGGCTCCGCTCGGG - Intronic
1048283577 8:133123529-133123551 CTTCCCTCCCTGCCCGTCTCTGG + Intronic
1048326476 8:133443045-133443067 CCCCCCACCAGGCCCAGCTCAGG + Intergenic
1048484417 8:134833259-134833281 CCTCCCTCCCATCCCCGCAAAGG + Intergenic
1048529347 8:135233609-135233631 CCACCCTCCCTGCCCCGCTCTGG + Intergenic
1048622848 8:136153605-136153627 CCTCCCACTGGGCCCCTCTCAGG - Intergenic
1048752892 8:137699782-137699804 CCTCCCTCCCAGTCTTGCTCTGG - Intergenic
1048965044 8:139609105-139609127 CACCCCACCCCGCCCCGCTCCGG + Intronic
1048994717 8:139787293-139787315 CCCCCCACCCCTCCCCGCTCAGG - Intronic
1049277479 8:141727021-141727043 CCTCCCTCCCAGCCGCCCGCTGG + Intergenic
1049432812 8:142573179-142573201 CCTCCCACCAGGCCCAGCCCTGG + Intergenic
1049595967 8:143483520-143483542 CCTCCCTGCCGGCCCAGCTTGGG - Intronic
1049638859 8:143705397-143705419 CCTCCCTGCCCGCCCGCCTCGGG + Intronic
1049657503 8:143805253-143805275 CCCCCCTCCCCGCCGCTCTCGGG + Exonic
1049775302 8:144401182-144401204 CCGCGCTCCCGCCCCCGCCCAGG - Intronic
1049829632 8:144692215-144692237 CCTCCCTCCCTGCCCTCATCTGG + Intergenic
1052494929 9:29213467-29213489 CCGCCCGCCCAGCCCCGCACCGG - Intergenic
1052824866 9:33167274-33167296 CCGCTCGCCCGCCCCCGCTCCGG - Exonic
1053010320 9:34629092-34629114 CCGCCCGCCCTGCCCCGCTCGGG - Intergenic
1053239887 9:36487275-36487297 CCTCCCTGCCTGGCCCGCTCCGG + Intronic
1056714041 9:89013904-89013926 GCTCCCTCCCTGGCCCTCTCAGG + Intronic
1056925142 9:90828236-90828258 CCCCCCCCCCCGCCCCGCCCAGG + Intronic
1057076879 9:92142516-92142538 CCGCACCCCCAGCCCCGCTCTGG + Intergenic
1057178178 9:93014363-93014385 CCTCCCTCCCGGCCAGGGTTTGG - Intronic
1057210525 9:93198787-93198809 CCCCACTCCCTGCCCAGCTCTGG + Intronic
1057227441 9:93299834-93299856 CCACCCTGCCCGCCCCTCTCCGG + Intronic
1057311841 9:93947954-93947976 CCTCCCTCCCAGCTCAGCCCGGG - Intergenic
1057494874 9:95553128-95553150 CCACCCTCCTGGCTCCGCGCTGG - Intergenic
1057519678 9:95751462-95751484 CCTCCCTCCCTCCCGCGTTCAGG - Intergenic
1058459934 9:105173309-105173331 CCTCCCTCCAGGTCCAGCCCAGG + Intergenic
1060876779 9:127089537-127089559 TCTCCCTCCCCGCCCACCTCAGG - Intronic
1061026689 9:128054432-128054454 CCTGCCTCCAGGCCCTGCTGAGG - Intergenic
1061056256 9:128224497-128224519 CCTGCCTCCCCACCCCGCTGAGG - Intronic
1061587707 9:131579348-131579370 GCTCCCGCCCGGCCCCGCTGAGG + Exonic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1062048500 9:134435385-134435407 CCTCCCTCCCGCCCCCCCACTGG + Intronic
1062139753 9:134949352-134949374 CCACCCACCCAGCCCCGTTCTGG - Intergenic
1062145889 9:134989470-134989492 CCACCCTCCCAGCCCAGTTCCGG - Intergenic
1062467339 9:136687064-136687086 CCGCCCGTCCCGCCCCGCTCCGG - Intronic
1062529043 9:136991983-136992005 GCCCCCTCCCGCCCCCGCCCCGG - Intergenic
1062610416 9:137371032-137371054 CCTGCCGGGCGGCCCCGCTCGGG + Intronic
1062621068 9:137422915-137422937 TCTCCCGCAGGGCCCCGCTCCGG - Intronic
1062623674 9:137433699-137433721 CCTCCCTGCAGGCCCCACCCAGG + Intronic
1062652418 9:137584833-137584855 CCCCACTCCCGGCTCCTCTCTGG - Intronic
1203468697 Un_GL000220v1:107315-107337 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1203476518 Un_GL000220v1:151287-151309 CCTCCGACCCGGTCCCGCTCCGG - Intergenic
1185469339 X:373448-373470 CTGCCCTCCCGGCCCCGCGTGGG - Intronic
1185587781 X:1253273-1253295 CATCCCTCCGGGCCACGTTCTGG + Intergenic
1185587836 X:1253650-1253672 CATCCCTCCAGGCCACGTTCTGG + Intergenic
1187835978 X:23432969-23432991 CCTCCCTCCCTCCCCCAGTCTGG - Intergenic
1189414938 X:40805072-40805094 CCCCCCTCCCCTCCCAGCTCGGG - Intergenic
1192152790 X:68722475-68722497 CAGCCCTCCCGGCCCAGCCCTGG + Exonic
1192180736 X:68914137-68914159 CCCCCCTCCCCGCCCCACTATGG - Intergenic
1196563029 X:117173505-117173527 TCTCCCTCCCCTCCCAGCTCGGG + Intergenic
1197758753 X:130013759-130013781 TCTCGCTCCCGTCCCCACTCCGG + Exonic
1197764981 X:130054413-130054435 TCTCCTTCCAGGCCCAGCTCAGG - Intronic
1199976448 X:152897601-152897623 CCCCCCTCCCCGCCCCTGTCTGG + Intergenic
1200074528 X:153544543-153544565 TCTCCCTCCAGGGCCCCCTCAGG - Intronic
1200075174 X:153547171-153547193 TCTCCCTCCCTGCCAAGCTCTGG - Intronic
1200698533 Y:6382588-6382610 CCCCTCTCCCCGCCCCGCCCTGG + Intergenic
1201035581 Y:9782111-9782133 CCCCTCTCCCCGCCCCGCCCTGG - Intergenic