ID: 1143135554

View in Genome Browser
Species Human (GRCh38)
Location 17:4710587-4710609
Sequence CGCCTCTTCCCCCTCCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 1, 2: 10, 3: 74, 4: 665}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143135554_1143135559 11 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135559 17:4710621-4710643 GGCGCGCGTGCGCATTGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 105
1143135554_1143135563 22 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135563 17:4710632-4710654 GCATTGGCGCGGGGAGGAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 255
1143135554_1143135560 12 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135554_1143135564 23 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135564 17:4710633-4710655 CATTGGCGCGGGGAGGAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 172
1143135554_1143135565 30 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135565 17:4710640-4710662 GCGGGGAGGAGCAGGGATCTTGG 0: 1
1: 0
2: 2
3: 72
4: 462
1143135554_1143135562 16 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135562 17:4710626-4710648 GCGTGCGCATTGGCGCGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1143135554_1143135557 -10 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135557 17:4710600-4710622 GGAAGAGGCGAGAGCGCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 301
1143135554_1143135561 13 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135561 17:4710623-4710645 CGCGCGTGCGCATTGGCGCGGGG 0: 1
1: 0
2: 1
3: 6
4: 48
1143135554_1143135558 6 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135558 17:4710616-4710638 CGGAGGGCGCGCGTGCGCATTGG 0: 1
1: 0
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143135554 Original CRISPR CGCCTCTTCCCCCTCCCTCC CGG (reversed) Intronic
900113625 1:1019829-1019851 CTCCTCTCCCCGCCCCCTCCCGG + Intergenic
900180387 1:1308545-1308567 CGCCCCCCCCCCCTCCCCCCCGG - Exonic
900410057 1:2508357-2508379 CGTCTCTCACCGCTCCCTCCGGG - Intergenic
900415530 1:2532799-2532821 CGCCTCTTCCTCCCTCCCCCTGG + Intergenic
900613680 1:3554937-3554959 GGCCTCTTCCAGCTCCCTCAGGG + Intronic
900643555 1:3698563-3698585 AGCTTCTGCCCCCTGCCTCCCGG - Intronic
900716826 1:4150426-4150448 AGCCTCCTCCCCCACTCTCCAGG - Intergenic
901083674 1:6597792-6597814 CAGTTCTTCCCCTTCCCTCCTGG + Intronic
901434720 1:9240145-9240167 GGCCTTTTCCACCTCCCTACAGG + Intronic
901526086 1:9824089-9824111 CTCCTCTCCCCCGCCCCTCCCGG - Exonic
901759716 1:11462849-11462871 CGCCCCTTCCCCAGCCCTCTGGG + Intergenic
902214140 1:14924094-14924116 CTCCTCCTCCCGCTCCTTCCGGG - Intronic
902274716 1:15331161-15331183 CTCCTCTTCCCCCTCAAACCTGG - Intronic
903115616 1:21176520-21176542 CCCCTCCTCCTCCTCCCCCCAGG - Intronic
903485662 1:23688173-23688195 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
903499669 1:23794202-23794224 CCCCTCTCTCTCCTCCCTCCAGG + Exonic
903664997 1:25000950-25000972 TGCCTCTTGTTCCTCCCTCCAGG + Intergenic
903894578 1:26595462-26595484 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
903921395 1:26803565-26803587 CCCCCCCTCCACCTCCCTCCCGG + Intergenic
903974140 1:27138216-27138238 CCCCTCTTCCCCCGCACTTCAGG + Intronic
904287368 1:29461138-29461160 CTCCTCTGCCCCCAGCCTCCTGG - Intergenic
904343926 1:29856028-29856050 ACCCTCTGCCTCCTCCCTCCTGG + Intergenic
904388686 1:30164673-30164695 CTCCTCTTCCTTCTCCCTCCTGG + Intergenic
904417668 1:30373108-30373130 CTCCTCTGCCCCCATCCTCCTGG + Intergenic
904450242 1:30606307-30606329 ATCCTCTGCCTCCTCCCTCCTGG - Intergenic
904603615 1:31686935-31686957 CGCTTCTTCCCCTTCTCTTCGGG - Intronic
904684209 1:32248787-32248809 CTCCTCCTCCCCCTCCCAGCTGG - Exonic
904704243 1:32378283-32378305 CTCCATTTTCCCCTCCCTCCAGG - Exonic
905288971 1:36908367-36908389 CTCCACTACCCTCTCCCTCCTGG + Intronic
905489443 1:38332107-38332129 CTCCTCCTCTCCCTCTCTCCTGG + Intergenic
905770727 1:40636424-40636446 TGCCTCTTCCCACTCTCTTCTGG + Intronic
906066414 1:42984426-42984448 CACCTGTCCCCCCTCTCTCCTGG - Intergenic
906094934 1:43216478-43216500 GGCCTCTTCCCCTACCCTCTGGG - Intronic
906129260 1:43446320-43446342 CTCATCTTCACCTTCCCTCCAGG + Exonic
906135987 1:43501269-43501291 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
906202916 1:43971503-43971525 CGCCGCTTCCCCCTTGCCCCAGG + Exonic
906407151 1:45551021-45551043 CGGCCCCTGCCCCTCCCTCCGGG + Exonic
906775856 1:48529004-48529026 AGCCTCTTTCCCCTCCCTCAAGG + Intergenic
907313324 1:53552269-53552291 CGCCTGGTCCCCCTCCTACCGGG - Intronic
907937709 1:59057573-59057595 AACCTGTTCCCACTCCCTCCAGG + Intergenic
908701914 1:66911444-66911466 AGCCTCTTTCCCCTCCCTGAAGG + Intronic
910209432 1:84778166-84778188 TGCCTCTTCACCCTCCCTCCAGG - Intergenic
911055646 1:93706094-93706116 TGCCTCTTCCTCCTTTCTCCAGG + Exonic
912203032 1:107480082-107480104 CTCCTCATCCCCATGCCTCCCGG + Intronic
912414670 1:109499818-109499840 CTCACCTTCCCCCTCCTTCCTGG + Intronic
912515070 1:110211988-110212010 CGCCGCTGCCGCCTCCGTCCGGG - Exonic
912680384 1:111725500-111725522 TGGCCCTTCCCCCTCCGTCCCGG + Exonic
914814327 1:151052475-151052497 CCCCTCTTCCTCCTCTCACCTGG + Exonic
915225216 1:154406411-154406433 TGCCTCTGCCCTCTCCCTCACGG - Intronic
915513920 1:156401843-156401865 CACCTCCTCCCCTTCCCTCTGGG - Intergenic
915590213 1:156866424-156866446 CCCCTCCTCCTCCTCCTTCCGGG - Intronic
916582677 1:166122834-166122856 CACCTTCTCCTCCTCCCTCCTGG + Intronic
916803015 1:168231983-168232005 CTCCTCTTTCACCTCCCTCAAGG - Intronic
918011122 1:180587304-180587326 AGGCTCCTCCACCTCCCTCCAGG - Intergenic
919691382 1:200531354-200531376 TGCCCCTTTCCCCTCCCTCTTGG - Intergenic
919878972 1:201889668-201889690 GGCCTCCTCTTCCTCCCTCCCGG + Intronic
920648573 1:207820779-207820801 TGCCCGTTCCCCCTCTCTCCAGG - Intergenic
921902261 1:220463306-220463328 CCCCTCATCCCCATCCCTGCAGG + Intergenic
922102258 1:222486869-222486891 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
922102286 1:222486984-222487006 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
922314733 1:224433609-224433631 CGCCCCTTCCCCTACCCCCCTGG + Intronic
924938058 1:248789063-248789085 TGCCTCTTCCTTTTCCCTCCGGG - Intergenic
1062774669 10:135402-135424 CGCCTCCTCCTCCTCCCTGCCGG - Intronic
1063961250 10:11307176-11307198 CGCCTCTTCTCCCTTGCCCCAGG + Intronic
1063981350 10:11454458-11454480 TGCCTGTGCCTCCTCCCTCCTGG + Intronic
1065706606 10:28476549-28476571 CACGTCTTCCCCCTGCCTTCAGG - Intergenic
1065721072 10:28629282-28629304 CTCCTCTTGCCCCTTTCTCCTGG + Intergenic
1065818775 10:29506610-29506632 GGCCTCTGTCCCCTCCCTCTAGG - Intronic
1065818783 10:29506632-29506654 GGCCTCTGTCCCCTCCCTCTAGG - Intronic
1065818792 10:29506654-29506676 GGCCTCTGTCCCCTCCCTCCAGG - Intronic
1065818820 10:29506745-29506767 GGCCTCTGTCCCCTCCCTCTAGG - Intronic
1065829201 10:29599015-29599037 AGCCTCTCTCCACTCCCTCCAGG + Intronic
1065953983 10:30677296-30677318 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954012 10:30677386-30677408 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954027 10:30677430-30677452 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954040 10:30677474-30677496 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954055 10:30677518-30677540 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954070 10:30677562-30677584 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1065954144 10:30677786-30677808 GGCCTCTGTCCCCTCCCTCTAGG + Intergenic
1068044748 10:51871769-51871791 CGGTGTTTCCCCCTCCCTCCAGG - Intronic
1069052875 10:63812474-63812496 CCCCTCTCCCCTCTCCCTCTCGG - Intergenic
1069487155 10:68831049-68831071 CAGCTCTTTCCCCGCCCTCCTGG - Intronic
1069564628 10:69455197-69455219 CCCCTCCTACCCCTCTCTCCTGG + Intronic
1069882781 10:71603950-71603972 CGCATCTTCCCCATCTCTCAGGG + Intronic
1069887215 10:71631396-71631418 CTCCTCTTCCCCTTCCCTTGGGG - Intronic
1070674296 10:78401664-78401686 CACCTCGTCCCCCTGCCGCCTGG - Intergenic
1071516431 10:86300805-86300827 AGCCACTTCCCACTCCCACCTGG + Intronic
1072423718 10:95311164-95311186 CGCCTCTACCCTCTCCCCCTGGG - Intergenic
1072692916 10:97583554-97583576 CGCCCCGTCCCGCCCCCTCCAGG + Exonic
1072914812 10:99531273-99531295 CGCCTCTCCCACCTCCCGACAGG + Intergenic
1073053463 10:100684228-100684250 CTCCCCTCCCCCCTCCCCCCCGG - Intergenic
1073179202 10:101573898-101573920 CTCCTCCTGCCCCTCCCACCTGG + Intronic
1073181360 10:101585367-101585389 CTCCTCCTCCTCCTCCCACCAGG - Exonic
1073216683 10:101840348-101840370 GGCCTCTTTCTCCTTCCTCCTGG - Intronic
1073291974 10:102417566-102417588 TTCCTCTTCCCTCTCCTTCCAGG - Intronic
1073468526 10:103708507-103708529 CACCCCTTTTCCCTCCCTCCAGG - Intronic
1073578093 10:104641600-104641622 CGCCTCTGCCGCCGCCCTGCTGG - Exonic
1073635012 10:105188910-105188932 CTCCTCTACCACCTCCATCCAGG - Intronic
1075045520 10:119143276-119143298 GAACTCTTCCCTCTCCCTCCTGG + Intronic
1076286013 10:129297001-129297023 AGCCTCCTCCCCATCCCTGCAGG - Intergenic
1076286115 10:129298115-129298137 AGCCTCCTCCCCATCCCTGCAGG - Intergenic
1076556046 10:131322188-131322210 CTTCTCTTCCCCCTCCCAGCAGG + Intergenic
1076760885 10:132605295-132605317 AGCTGCTTCCCCCTCACTCCTGG - Intronic
1076760909 10:132605353-132605375 AGCCGCTTCCCCCTCACTCCTGG - Intronic
1076760934 10:132605411-132605433 AGCCCCTTTCCCATCCCTCCTGG - Intronic
1076839411 10:133038709-133038731 AACTTCTTCCACCTCCCTCCTGG + Intergenic
1076998603 11:311160-311182 CGCCGCTTCCCCCTCCCCGCCGG - Intronic
1077000140 11:318599-318621 CGCCGCTTCCCCCTCCCCGCCGG + Intergenic
1077102662 11:829055-829077 CCTCTCGTCCTCCTCCCTCCAGG + Intronic
1077360375 11:2138081-2138103 CTCCTCCTCCTCCTCCCCCCCGG + Intronic
1077362209 11:2145731-2145753 CACATGTTCCCCCTCCCTCGTGG + Intronic
1077545012 11:3165366-3165388 CGCCTCCTCCTCCCGCCTCCGGG - Intronic
1077581292 11:3418863-3418885 CGTCTCCTCCCTCTCCCTCCAGG - Intergenic
1077900070 11:6480917-6480939 CGTTTCTTCCCCCTTCCTTCAGG + Intronic
1078211654 11:9274872-9274894 AGCCTCTTCCCCCTTCTCCCTGG + Intergenic
1079056048 11:17207662-17207684 CCCGACTCCCCCCTCCCTCCGGG - Intronic
1079346389 11:19656450-19656472 TGCCTCTCCCCCCTCACTCACGG - Intronic
1080207751 11:29750602-29750624 TGCTTCTCCCCCCTCCCCCCAGG + Intergenic
1080258810 11:30323295-30323317 CTCCTCTTCCACCTCTCCCCGGG - Intronic
1080887245 11:36377670-36377692 CGCCTCTTCCCCCGCGGTGCCGG + Intronic
1081703552 11:45166748-45166770 TGCCCCTTCCACCTCCTTCCTGG + Intronic
1081858906 11:46320821-46320843 CGCCTCGTGCCCCTGCCTCCTGG + Exonic
1082844971 11:57717713-57717735 CCCCTCTCCCCTCTCCCTCTCGG - Intronic
1083241029 11:61388948-61388970 AGCCTCTTCCCTCTACCTCTTGG + Intergenic
1083270180 11:61568179-61568201 CTCCTGTTCCCCCACCCTACAGG + Intronic
1083274186 11:61587638-61587660 CGCCTCGTCCCCCGCCCCCCAGG - Intergenic
1083612102 11:64009274-64009296 CCTCTCTCCCACCTCCCTCCTGG - Intronic
1083849210 11:65355391-65355413 AGCCGCCTCCCACTCCCTCCCGG + Intronic
1084165276 11:67372579-67372601 CGCCCCCTCCCGCTCCCGCCCGG + Intronic
1084173203 11:67410367-67410389 GCCCTCCTTCCCCTCCCTCCAGG + Intronic
1084195583 11:67522409-67522431 ATCCTCTTCCCCCTAGCTCCAGG + Intronic
1084238213 11:67801702-67801724 TGTCTCCTCCCTCTCCCTCCAGG - Intergenic
1084264008 11:67995797-67995819 CGCCTCAGCCGCCTCACTCCTGG - Exonic
1084561209 11:69906399-69906421 CTCCCCCTCCCCCTCCCCCCAGG + Intergenic
1084834199 11:71791132-71791154 TGTCTCCTCCCTCTCCCTCCAGG + Intronic
1085010975 11:73141763-73141785 CGCCCCTTCCCCCTCCCGCAAGG - Intronic
1085311767 11:75521046-75521068 GGTCTCCTCCTCCTCCCTCCAGG + Intronic
1085458797 11:76680894-76680916 CCCCTCCTCCCTCTCCCTGCTGG + Intergenic
1086281332 11:85193080-85193102 TGTCTATTCCCCCTTCCTCCAGG + Intronic
1086365871 11:86109809-86109831 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1086365899 11:86109924-86109946 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1086690602 11:89786186-89786208 CGCCTCTGCCCCGCGCCTCCAGG - Intergenic
1086715197 11:90053474-90053496 CGCCTCTGCCCCGCGCCTCCAGG + Intergenic
1087047041 11:93850920-93850942 CCCCTCATCCCTCTCACTCCAGG - Intergenic
1088167647 11:106957234-106957256 TGACTCTTGCCCCTCCCCCCAGG + Intronic
1088754888 11:112877714-112877736 AGCCTCCTCCCCCTACCTGCAGG - Intergenic
1088866565 11:113853211-113853233 AGCCTCTGCCCTCTGCCTCCTGG - Intronic
1088912551 11:114202751-114202773 CCCCTCTGCCCCCTCACCCCGGG - Intronic
1088978001 11:114832980-114833002 CCCCTCTTCCCCTGCCCCCCAGG - Intergenic
1089138872 11:116270763-116270785 CAGCTCCTGCCCCTCCCTCCTGG + Intergenic
1089540851 11:119188261-119188283 CGCCTCTTCCCGTTCACTCTGGG + Intronic
1089555416 11:119313474-119313496 CGCAACCTCCACCTCCCTCCCGG + Intronic
1089691194 11:120187675-120187697 CAGCTCTTCCCCCACCCTGCTGG - Intergenic
1089730845 11:120517760-120517782 GGCCCCTTCCCACTCCCTCCTGG - Intronic
1090193910 11:124799535-124799557 CGCCTCTTGCCCCCACCGCCGGG - Intronic
1090349804 11:126100795-126100817 ATCCACTGCCCCCTCCCTCCTGG - Intergenic
1090532187 11:127602060-127602082 CCTCTCTTGCCCCTCCCTCCAGG - Intergenic
1091367848 11:135037266-135037288 TGCTTCTTGGCCCTCCCTCCTGG + Intergenic
1091392368 12:133441-133463 GGCCTCCTCAGCCTCCCTCCTGG - Intronic
1092230796 12:6774246-6774268 CCCCCCCTCCCCCTCCCTCTGGG - Intronic
1092408892 12:8239332-8239354 CGTCTCCTCCCTCTCCCTCCAGG - Intergenic
1093395398 12:18675214-18675236 CTCCTCCTCCCTCTCCCACCTGG + Intergenic
1094219296 12:27975293-27975315 CTCCCCTCCCCTCTCCCTCCAGG + Intergenic
1095096201 12:38150718-38150740 CGTCTCTCCTCCCTGCCTCCTGG + Intergenic
1095570897 12:43684336-43684358 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1096109472 12:49020477-49020499 CCCCTCTCCCCCCACCCCCCGGG - Exonic
1096575656 12:52551284-52551306 AGCCTCCTTCCCCTCCCTCTGGG + Intronic
1096581458 12:52588123-52588145 GGCCCCTGCCCTCTCCCTCCTGG + Intronic
1096634527 12:52949785-52949807 GTCCCCTTCCCCCTCTCTCCTGG - Intronic
1096647575 12:53047143-53047165 CTCCTCCTCCTCCTCCCTCCCGG - Intronic
1096975860 12:55698990-55699012 AGCCCCTGCCCCCTCCCTACAGG + Intronic
1096980465 12:55725746-55725768 CCCCTCAGCCCCTTCCCTCCAGG + Intronic
1097052118 12:56230008-56230030 CTCCCCTACCCCCTCCCTGCAGG + Intergenic
1097128064 12:56789685-56789707 CGCCCCCCCCACCTCCCTCCCGG + Intergenic
1097261114 12:57720762-57720784 CACCTCTACCCTCTCCCACCAGG + Exonic
1099251244 12:80257614-80257636 CTCCTTTTCTCCCTCCTTCCTGG - Intronic
1101514075 12:105418507-105418529 CGCCCCTTCCCACTCCATCTGGG - Intergenic
1101876674 12:108600679-108600701 GGCTTCTTCCTCCACCCTCCCGG + Intergenic
1101897739 12:108768835-108768857 CGCCACTTCCCCCGGGCTCCGGG - Intergenic
1102492330 12:113296812-113296834 TGCCTCATGCCCCTTCCTCCGGG - Exonic
1102956337 12:117061432-117061454 CACCTCTCCTCCCTCTCTCCTGG - Intronic
1103402002 12:120649492-120649514 TGGCTCTTCCTCGTCCCTCCAGG - Intronic
1103954499 12:124568618-124568640 CCCCTCCTCCCACCCCCTCCAGG + Intergenic
1103962050 12:124615158-124615180 CTCCTATGCCCCCTCCCCCCAGG + Intergenic
1104088207 12:125494245-125494267 TCCCTCTTCCCCCTCCTCCCTGG + Intronic
1104088263 12:125494406-125494428 TGCCTCCTCCCCCTCCTCCCTGG + Intronic
1104088389 12:125494784-125494806 CCCCTCTTCCCCCTCCTCCCTGG + Intronic
1104088405 12:125494827-125494849 CCCCTCCTCCCCCTCCTCCCTGG + Intronic
1104088419 12:125494861-125494883 CCCCTCCTCCCCCTCCTCCCTGG + Intronic
1104088519 12:125495170-125495192 TCCCTCTTCCCCCTCCTCCCTGG + Intronic
1104157597 12:126148829-126148851 TCCCTCTGCGCCCTCCCTCCAGG + Intergenic
1104774161 12:131382430-131382452 CTCTGATTCCCCCTCCCTCCTGG + Intergenic
1104774297 12:131382879-131382901 CTCTGATTCCCCCTCCCTCCTGG + Intergenic
1104784186 12:131439119-131439141 TGCCTCTCCCCGCTCCCTCCCGG + Intergenic
1104834506 12:131779326-131779348 TTCCTCTCCACCCTCCCTCCAGG + Intronic
1104910536 12:132238202-132238224 CCCCTCTCTCCCCTCTCTCCTGG - Intronic
1104958447 12:132477053-132477075 CGCACCTTCCTCCTCCCTCCAGG + Intergenic
1108408384 13:50125720-50125742 CGCTTCTTCCCCCTCCCAGCCGG + Intronic
1108581436 13:51831665-51831687 CGCCTGATCCCCCTGCCTCCTGG + Intergenic
1108698121 13:52920747-52920769 CACCTCTACCCCCTACCTCCGGG - Intergenic
1109378484 13:61526398-61526420 TGCATCCTCCCCCTCCCTCAAGG - Intergenic
1109784522 13:67156467-67156489 CGCCTCATCCCACTCCCACCGGG - Intronic
1110347708 13:74467541-74467563 AGCCTGTTTCCCCTCCCTCCTGG + Intergenic
1110436163 13:75480989-75481011 CGCCAGCTCCCCCTCCATCCCGG + Intronic
1112344327 13:98577212-98577234 GGCCTCTCCCCTCCCCCTCCCGG - Intronic
1112949794 13:104978945-104978967 CGCCTCTTCCCCCTGCCACCAGG + Intergenic
1113285791 13:108847784-108847806 CTTCTCTTCCCTTTCCCTCCTGG + Intronic
1113450839 13:110408196-110408218 CACAGCTGCCCCCTCCCTCCTGG - Intronic
1113492962 13:110706344-110706366 CGCCTCTTCCCACGGCCTCCCGG - Intronic
1113821966 13:113221071-113221093 CGCATCCTCCCCATCCCTTCAGG - Intronic
1113905399 13:113817235-113817257 GGGCTGTCCCCCCTCCCTCCAGG + Intergenic
1114174610 14:20309328-20309350 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1114588350 14:23835675-23835697 CACCTCTTCCCACTGCCACCAGG + Intergenic
1114674419 14:24430940-24430962 CTTCTCTCCCCCATCCCTCCAGG + Intronic
1116518768 14:45827174-45827196 CGCCCCCGCCCCCTCCCCCCTGG - Intergenic
1117105803 14:52395833-52395855 TCCCTCTCCCCTCTCCCTCCGGG + Intergenic
1117141076 14:52791601-52791623 CGCCTCTGCCCCCTCACGCAGGG + Exonic
1117156995 14:52951194-52951216 CGCCTCTGCCCCCGCCCTCCCGG + Intronic
1117571691 14:57055400-57055422 CTCCTCTTGCCCCTGACTCCTGG + Intergenic
1119140709 14:72264977-72264999 CCCCTCCTCCAACTCCCTCCTGG - Intronic
1119319516 14:73721399-73721421 CTCCTCCTCCCCCTCCTTCCTGG + Exonic
1119401834 14:74367946-74367968 CACCTCAGCCCCCTACCTCCCGG - Intergenic
1119443842 14:74647674-74647696 TCCTTCTTCCCCCTCCCTCTAGG + Intergenic
1120867048 14:89304299-89304321 CGCCCCTTCCCGCCCCTTCCCGG - Intronic
1121127311 14:91416838-91416860 CTCCTCGTCCCCCTCCCCGCAGG - Exonic
1121417496 14:93789063-93789085 AGCCTCTCCCGCCTCCCGCCCGG + Intergenic
1122297276 14:100712636-100712658 TGCCTCCTCCCCAGCCCTCCTGG - Intergenic
1122329750 14:100904335-100904357 CACCTCTCCCTTCTCCCTCCAGG - Intergenic
1122474785 14:101999706-101999728 TGCCTCTTCTCCCGCCTTCCAGG + Intronic
1122688146 14:103519618-103519640 CTGCCCTTCCCCCTCCCCCCTGG + Intergenic
1122715903 14:103696951-103696973 CCCCTCGGCCCCTTCCCTCCAGG + Intergenic
1123008428 14:105335534-105335556 CACCTCTTCACCCTCCCTCATGG + Intronic
1123055733 14:105568749-105568771 TGCCTCTGCCCCATCCCTCTGGG - Intergenic
1123080090 14:105688268-105688290 TGCCTCTGCCCCATCCCTCTGGG - Intergenic
1123087459 14:105723471-105723493 CGCCTCCCCACCCTCCCTCCCGG + Intergenic
1123165823 14:106324190-106324212 CGGCTCCTCCGCCTCCCTGCAGG + Intergenic
1123168520 14:106349219-106349241 CGCCCCCTCCGCCTCCCTGCAGG + Intergenic
1123431285 15:20219240-20219262 CTCCTCTTCACTCTCCCTTCTGG - Intergenic
1124785068 15:32671913-32671935 CGCCTCTCCACCTTCTCTCCTGG + Intronic
1125293460 15:38175749-38175771 TGCCTTTTCCACCTCCATCCAGG + Intergenic
1125542254 15:40476361-40476383 CGCCTCTGCCCCCACACCCCAGG + Intergenic
1125684794 15:41557984-41558006 CTCCCCTTGCCCTTCCCTCCAGG - Intronic
1125832914 15:42729126-42729148 TGCCTCTCCCTCCTCCCCCCAGG - Exonic
1127224828 15:56918440-56918462 CGCCTCATGCCCCTCCCCACCGG + Intronic
1128081994 15:64862282-64862304 CGCCTCCCCCACCTCCTTCCTGG - Intronic
1128234535 15:66058755-66058777 CACCTCCTCCTCCTCCTTCCTGG - Intronic
1128322512 15:66703321-66703343 CGCCGCTGCCGCCTTCCTCCCGG - Exonic
1128581228 15:68811498-68811520 GGCCTCCACCCCTTCCCTCCCGG - Intronic
1128620839 15:69148512-69148534 CAGCTCTTACCTCTCCCTCCAGG - Intergenic
1129104295 15:73295436-73295458 AGCCCCTTCCTCCTTCCTCCTGG + Intronic
1129232294 15:74203429-74203451 TGCCTCTCGCCCCTTCCTCCAGG - Intronic
1129258461 15:74348055-74348077 CCCCTCTCCCCCACCCCTCCAGG - Exonic
1129600058 15:76993543-76993565 GGCCTCTTCCCTCTCCCTGGAGG - Intronic
1129607985 15:77034127-77034149 CGCCTCTTCCCAGTCCTGCCTGG - Intronic
1129881023 15:79006021-79006043 CGCCACTGCCCCCTCTCCCCAGG - Intronic
1131123699 15:89840042-89840064 GTCCTCTTCCCCCTGCCTCATGG - Intronic
1132717890 16:1301246-1301268 TGCCTCTGCCCGCCCCCTCCCGG + Intergenic
1132733862 16:1376122-1376144 CGCTCCTCCCTCCTCCCTCCAGG + Intronic
1132733919 16:1376292-1376314 CCACTCTCCCTCCTCCCTCCAGG + Intronic
1132935089 16:2475818-2475840 CACCTGTTCCCGCCCCCTCCAGG + Intronic
1133026531 16:2991137-2991159 TGCCCCTTCCCCCTCCCTCCTGG - Intergenic
1133201974 16:4209314-4209336 CCCCTCTGCCCCCTGCCCCCAGG + Intronic
1133349859 16:5094149-5094171 CGTCTCCTCCCTCTCCCTCCAGG - Intronic
1133365020 16:5202930-5202952 CGCCCCCCCCACCTCCCTCCCGG + Intergenic
1133675052 16:8063355-8063377 AGCCTCTAGCCCCACCCTCCCGG - Intergenic
1133867102 16:9654592-9654614 CACCTGTACCTCCTCCCTCCAGG + Intergenic
1133977398 16:10609176-10609198 CGCTACTTCCCACTCCCTGCTGG - Intergenic
1134125320 16:11612369-11612391 CACCTCTTCACCAACCCTCCAGG - Intronic
1134787915 16:16961786-16961808 CTCCTCTTCCCCATCCTCCCAGG + Intergenic
1135536878 16:23301794-23301816 CGCCTCTTCCACCTCCACCAAGG - Intronic
1135954098 16:26941143-26941165 TCACTCTTCTCCCTCCCTCCAGG + Intergenic
1136447875 16:30335142-30335164 CGCCTCCTCCTCCTCCTTCTCGG - Intergenic
1136458607 16:30396050-30396072 GGCCTCTGTCCCCTCCCTCACGG + Intronic
1136512621 16:30748568-30748590 CGCCCCTTCCCCCTGCCTCCTGG + Intronic
1136853358 16:33631984-33632006 CTCCTCTTCACTCTCCCTTCTGG + Intergenic
1137540296 16:49357112-49357134 CACCCCTTCCTCCTCCCACCAGG + Intergenic
1137780313 16:51092601-51092623 TGACTCTTCCCACACCCTCCAGG - Intergenic
1138590958 16:57999722-57999744 CTCCTCTCCTCCCTCCCTTCCGG - Exonic
1138653529 16:58475763-58475785 TGACTCTTCCTCCTGCCTCCTGG - Intronic
1139327510 16:66163882-66163904 CGTTTCTAGCCCCTCCCTCCTGG + Intergenic
1139846564 16:69925457-69925479 CCCCTGGGCCCCCTCCCTCCTGG + Exonic
1140766647 16:78165570-78165592 CTCCTCCTCCCCCTCCTCCCAGG - Intronic
1141138021 16:81479102-81479124 AGCTCCTTCCCCCTCCCCCCAGG - Intronic
1141437562 16:84009023-84009045 TGCCTCCTCCCACTCCCTTCTGG + Intergenic
1141593811 16:85085642-85085664 CGGCTCCTTCCCCTCCCTCCAGG - Intronic
1141642820 16:85351193-85351215 AGCCAGTTCCCTCTCCCTCCTGG - Intergenic
1141916297 16:87099482-87099504 GGTCACTGCCCCCTCCCTCCAGG + Intronic
1141987014 16:87586650-87586672 CGCCCCATCCTCCTTCCTCCTGG - Intergenic
1142332367 16:89462930-89462952 CCCCACCTCCACCTCCCTCCCGG - Intronic
1203114953 16_KI270728v1_random:1480429-1480451 CTCCTCTTCACTCTCCCTTCTGG + Intergenic
1142762578 17:2050685-2050707 CCCCGCTTCCCCGGCCCTCCTGG - Intergenic
1143135554 17:4710587-4710609 CGCCTCTTCCCCCTCCCTCCCGG - Intronic
1144662491 17:17080243-17080265 AGCCTCTGCCTCCTCCCACCTGG - Intronic
1144834224 17:18148523-18148545 CACCTCTTCCCCCGTACTCCAGG - Exonic
1144862632 17:18315129-18315151 CCCCTCTTTCCCCTCCTTCCCGG + Intergenic
1144954345 17:19011634-19011656 AGCTTCTTCCCCCTCCCGTCTGG - Intronic
1145289264 17:21530415-21530437 CGACTCCTGCCCCTCCCTCTTGG + Exonic
1145684064 17:26637526-26637548 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1146000261 17:29126493-29126515 CGCCGCTTCCCCCACCCACCTGG - Intronic
1146064482 17:29623541-29623563 AGCCTCTTCCCCCTGCATCTGGG - Intergenic
1146398528 17:32486870-32486892 CGCCTCAGCGCCCTCCCTCGCGG - Exonic
1146581291 17:34040407-34040429 CGGCGCTTCCCCCACCCCCCAGG - Intronic
1146648170 17:34589311-34589333 TGGCCCTTTCCCCTCCCTCCTGG - Intronic
1146848722 17:36203110-36203132 CTCCCCTTCCCCCTCCCCCTGGG + Intronic
1147131684 17:38413363-38413385 CCCCACTGCCACCTCCCTCCTGG - Intergenic
1147176205 17:38657724-38657746 CTCCTCTTGACCCTCCCTCCCGG - Intergenic
1147225799 17:38975975-38975997 CTCCACTGCCCTCTCCCTCCAGG - Intergenic
1147742522 17:42677033-42677055 CCCCCCGGCCCCCTCCCTCCCGG + Intergenic
1147747560 17:42704464-42704486 AGCCTCTACCCTCTGCCTCCCGG - Intronic
1147948810 17:44095700-44095722 CTCTTATTCCCCCTCCCCCCAGG - Intronic
1148013354 17:44503452-44503474 CGCCTCCTCCCACGCCCACCGGG + Intergenic
1148211887 17:45813556-45813578 CCGCGCCTCCCCCTCCCTCCTGG - Intronic
1148478125 17:47942294-47942316 CCCCTCTTCCCCCGCCCTTGAGG - Intronic
1148512608 17:48185316-48185338 CTTCTCTTCCCCTTCCCTGCTGG + Intronic
1148887851 17:50786583-50786605 TGCCTCTTTCCCCTCGCTCTTGG - Intergenic
1149053576 17:52335775-52335797 CCCCTCTCCCCTCTCTCTCCTGG + Intergenic
1149337627 17:55653028-55653050 CGCCCCATCTCCATCCCTCCAGG + Intergenic
1149461810 17:56834628-56834650 CGCCTCGTCCCCCCGTCTCCCGG - Intronic
1149512687 17:57256431-57256453 CTCCTCCTCCCCCTCCTCCCCGG - Intronic
1149536481 17:57437506-57437528 CTCCTCTCCCCAGTCCCTCCAGG - Intronic
1149623726 17:58064990-58065012 CCACTCTTCCCCCTCAGTCCAGG + Intergenic
1149791291 17:59479902-59479924 TGCAACTTCCGCCTCCCTCCAGG + Intergenic
1149863008 17:60134617-60134639 CCCCTCCTCCCCCACCCCCCAGG + Intergenic
1150223103 17:63508146-63508168 TGCCTCTTCCCTCACCCTCCTGG - Intronic
1150249545 17:63698440-63698462 AGCCTCATCCCCTTCCCACCTGG + Exonic
1150380461 17:64716008-64716030 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1152226462 17:79095083-79095105 CGCTTGTACCCCCTCCCTCCTGG - Intronic
1152271758 17:79329046-79329068 AGCCTCCTCCCTGTCCCTCCTGG - Intronic
1152321393 17:79610389-79610411 CGCCTCTGCCTCCCCCCGCCGGG + Intergenic
1152562293 17:81084676-81084698 CCCCTCTCCGCCCTCCCTTCTGG + Intronic
1152758601 17:82097358-82097380 GGCCTCCGCCCCCTCCCCCCAGG - Intronic
1152898109 17:82925201-82925223 GCCCTCTGCCCCCTTCCTCCTGG - Intronic
1152918005 17:83051901-83051923 CGCCCCTTCCACGCCCCTCCGGG - Intergenic
1153647256 18:7206328-7206350 CGCATCTCCCACCTGCCTCCTGG + Intergenic
1155065721 18:22267398-22267420 GGCCACTTTCCCCTCCCTGCTGG + Intergenic
1155212990 18:23619156-23619178 TGCCTCTTGCCCCTCCTCCCTGG - Intronic
1155438086 18:25833749-25833771 CCCTTCTCCCCCATCCCTCCTGG - Intergenic
1156457874 18:37304872-37304894 CACCTGCTCCCCCTCCCTTCTGG - Intronic
1157191391 18:45585141-45585163 CTCCTCCTCCTCCTCCTTCCTGG + Intronic
1157481722 18:48059560-48059582 GCCCTCCTGCCCCTCCCTCCAGG - Intronic
1157564440 18:48670440-48670462 TTCCTCTCCCACCTCCCTCCAGG + Intronic
1157629657 18:49081514-49081536 CCCCTCTCCCCTCTCCCTCTCGG - Intronic
1158405122 18:57153794-57153816 CACCTCTCCCTCCTCCCTCGTGG + Intergenic
1158689676 18:59649262-59649284 CCCCTCCTGCCCCTCCCTACTGG + Intronic
1160196090 18:76756687-76756709 TGCGTCGTCACCCTCCCTCCTGG - Intergenic
1160218845 18:76957657-76957679 CTCCTCTCCCTCCTCCCTCAAGG + Intronic
1160533371 18:79578053-79578075 CGCCACCTCTCCCTCCTTCCTGG - Intergenic
1160582269 18:79890463-79890485 TGCCCCTTCCCCCTCCCCACTGG + Intronic
1160668570 19:344858-344880 CGCCCCCTGCCCCGCCCTCCAGG - Intergenic
1160762291 19:791728-791750 CCCCCCTCCCCCCTCCCCCCGGG - Intergenic
1160766034 19:808472-808494 CGCCCCTGCCCCCTCCACCCCGG - Intronic
1160913700 19:1487074-1487096 CGCCCCCTCCCCGCCCCTCCTGG - Intronic
1161021578 19:2013880-2013902 TCCCTCTTCCCCCACCATCCAGG - Intronic
1161105517 19:2441859-2441881 TGCCTCTTCCACCTCACCCCTGG - Intronic
1161162491 19:2768933-2768955 TGCCACTTCCCCCTCTCCCCGGG - Intronic
1161241147 19:3224648-3224670 CGCGCCTCCCGCCTCCCTCCCGG - Intergenic
1161307660 19:3576836-3576858 CTCCCCTTTCCCCTACCTCCGGG - Intronic
1161390390 19:4017451-4017473 CACCTGTTCCCCGCCCCTCCAGG + Intronic
1161778332 19:6275943-6275965 AGGCTCCTCCCCCTCCCCCCTGG - Intronic
1162564211 19:11436204-11436226 CTCCTGTTCACCCTCCCGCCAGG + Intronic
1162808649 19:13151681-13151703 CTCCTCTTCCCCCACCCGGCTGG + Intronic
1163019131 19:14473328-14473350 CGCTCCTTCCCGCTCCCTCTCGG - Intronic
1163209235 19:15828502-15828524 CACCCCCTCCCCCTACCTCCCGG - Intergenic
1163297199 19:16420062-16420084 CCCCTCCTCCCAGTCCCTCCTGG + Intronic
1163634078 19:18430410-18430432 CTGCTTTTCACCCTCCCTCCTGG + Intronic
1163693249 19:18749145-18749167 AGGCTCTTCCCTCTACCTCCAGG - Intronic
1165097015 19:33414954-33414976 GGCCGCTTCCACCTCGCTCCTGG + Intronic
1165448330 19:35868801-35868823 CGCCCCTTCCCCCATCCCCCAGG - Intronic
1165743236 19:38216057-38216079 CGCCTTGCCTCCCTCCCTCCAGG + Intronic
1166228770 19:41413482-41413504 GGCCTCTGCCCCCTCTCTCCTGG + Intronic
1166283292 19:41809197-41809219 CTCCTTCTCTCCCTCCCTCCAGG - Intronic
1166329424 19:42069747-42069769 CCCCCTTTCCCCCTCCCCCCTGG + Intronic
1166807771 19:45497188-45497210 GGCCGCTTTCCCCTCCTTCCTGG - Intronic
1166811638 19:45517907-45517929 CCCCCCTTTCCCCTCCCACCAGG + Exonic
1167149212 19:47699247-47699269 CGCCCCTTCCCCCTTCTTGCTGG + Intronic
1167154181 19:47728314-47728336 GCCTTCTTCCCCCTCCCACCTGG + Intronic
1167163842 19:47784716-47784738 CCCCTGTGCCTCCTCCCTCCAGG + Intergenic
1167347446 19:48955278-48955300 CGCCTCTGCCCCCTCAGGCCAGG + Intronic
1167456894 19:49601127-49601149 GGCCTCATCCTCCTCCCTCCAGG - Intronic
1167525452 19:49980926-49980948 CGCCTGTTCCCGCTCCCTTCAGG + Intronic
1167603469 19:50467553-50467575 CACCTCCTCCCACTCCCTCTGGG + Intronic
1167645803 19:50704186-50704208 TGCCTCTACCCCCTCCCTCCAGG - Exonic
1168076491 19:53983019-53983041 CTCCCCTGCCCCCTCCCTCGGGG - Exonic
1168309763 19:55454558-55454580 CGCCTCTGCCCCTTCCGGCCCGG - Intronic
925317951 2:2939670-2939692 GGGCTCTTCCTCCTCCTTCCTGG + Intergenic
925332439 2:3069162-3069184 CTCCGCTTCCCCCAGCCTCCTGG - Intergenic
927216200 2:20669068-20669090 CTCCTCTCCCTCCTCCCTCTTGG + Intronic
927709342 2:25315164-25315186 CCCCAGCTCCCCCTCCCTCCTGG + Intronic
928087142 2:28352933-28352955 CCCTTCTTCTCCCTCCCTTCTGG - Intergenic
928717092 2:34073659-34073681 CGCCTCTTCTCCCTTCTTTCAGG - Intergenic
929078096 2:38095192-38095214 CTCTTCTTCCTCCTCCTTCCTGG - Intronic
929810920 2:45188656-45188678 AGCATCTATCCCCTCCCTCCAGG + Intergenic
929922876 2:46185036-46185058 CACCTCCTCCCCCTCCCACCTGG + Exonic
930026239 2:47030708-47030730 CGCCTGTTCCCCCTCCATCCTGG + Intronic
930053911 2:47237538-47237560 CCCCTCTCCCTCCTACCTCCAGG - Intergenic
932471617 2:71962963-71962985 CTCCTCCTCACCCTTCCTCCGGG - Intergenic
932606843 2:73171183-73171205 CATCATTTCCCCCTCCCTCCTGG + Intergenic
933735114 2:85488191-85488213 TGACTCTCCCACCTCCCTCCCGG - Intergenic
933918099 2:87016969-87016991 CGCATCTTCCCCTGCCTTCCTGG + Intronic
933925585 2:87089227-87089249 CATCATTTCCCCCTCCCTCCTGG - Intergenic
934004895 2:87752945-87752967 CGCATCTTCCCCTGCCTTCCTGG - Intronic
934028048 2:88017219-88017241 CGCGGCTTCACCCTCCCTCCAGG - Intergenic
934604929 2:95687373-95687395 CCCCTCTTCCCCCTCCCAACTGG - Intergenic
934905555 2:98198677-98198699 CACCAACTCCCCCTCCCTCCTGG + Intronic
935767854 2:106386976-106386998 CGCATCTTCCCCTGCCTTCCTGG - Intergenic
936154084 2:110037039-110037061 CTCCTCTTCCCCCACCACCCAGG - Intergenic
936190600 2:110334376-110334398 CTCCTCTTCCCCCACCACCCAGG + Intergenic
936269223 2:111036186-111036208 CCACTCTTCCCCTCCCCTCCAGG - Intronic
937915929 2:127098649-127098671 AGCCTCTTCCCTCTGCTTCCCGG - Intronic
938034955 2:128027898-128027920 CGTCTCCTCCCCTTCCCTCCCGG + Intronic
938071991 2:128313609-128313631 CCCCTTCTCCTCCTCCCTCCTGG + Intronic
938088709 2:128418376-128418398 CGCCCCCCCCGCCTCCCTCCCGG + Intergenic
938310569 2:130286033-130286055 CACCCCTCCCCCCACCCTCCAGG - Intergenic
939331036 2:140761368-140761390 CCCCTCTTACCCCTACCACCTGG + Intronic
939644939 2:144685966-144685988 CGCCCCTTCCCCCCCACCCCAGG - Intergenic
941603152 2:167564002-167564024 CGACCCTCCCACCTCCCTCCCGG + Intergenic
941768552 2:169326201-169326223 CCCCTCTCCCCTCTCCCTCTCGG + Intronic
942047386 2:172107813-172107835 TTCCTCTTCCACCTGCCTCCAGG + Intergenic
943648263 2:190430797-190430819 CGCCCCCCCCACCTCCCTCCCGG + Intronic
943933691 2:193886633-193886655 CACCACTGCCCCCGCCCTCCCGG + Intergenic
944135438 2:196394145-196394167 CCCCTCTCCCCCCTCACCCCCGG - Intronic
944573705 2:201071319-201071341 CGCCTCTCCTCCCTCTCTGCTGG + Intronic
945891526 2:215436005-215436027 CCCCTCTTCCCGCTCGCGCCTGG + Exonic
946238680 2:218340927-218340949 CCCCTCTCCTCCCTCCCTGCTGG - Intronic
946432715 2:219634068-219634090 CGCCTCTTCCATCTCCCTCCAGG + Intronic
947402520 2:229743322-229743344 CCCCCCCTCCACCTCCCTCCCGG - Intergenic
947619550 2:231580807-231580829 CGCGTCCTCCCCCTTCCTCCAGG - Intergenic
947742146 2:232489571-232489593 CATCCCTTCCTCCTCCCTCCCGG + Intergenic
948077786 2:235179837-235179859 CCCGTCTTACCCCTGCCTCCAGG - Intergenic
948286461 2:236789734-236789756 CGTCTCTTCCACCTCCTCCCAGG - Intergenic
948360161 2:237414221-237414243 CTCCTCCTCCTCCTCCCTCCCGG + Exonic
948696810 2:239736915-239736937 CGCTTCTTCCCTCTCCCCTCCGG + Intergenic
948793434 2:240390730-240390752 CTCCTCTGCACCCTCCCTGCTGG + Intergenic
949058864 2:241945051-241945073 CAGCTCTGCCCCCACCCTCCTGG + Intergenic
1168820329 20:768715-768737 CCGCTCTGCCCCCTCCCTTCTGG + Intergenic
1168891377 20:1297123-1297145 TGCCTCTTCTTCCTGCCTCCAGG + Exonic
1168965300 20:1894884-1894906 GGCCGCTGCCCCCGCCCTCCCGG - Intronic
1169033428 20:2430842-2430864 CGCCTACCCCTCCTCCCTCCAGG - Intronic
1169069321 20:2713148-2713170 CTCATTTTCCCCTTCCCTCCTGG - Intronic
1169211319 20:3767631-3767653 CCCCTCTGCTCCCTGCCTCCCGG - Intronic
1170412598 20:16107369-16107391 CAGCTCTCTCCCCTCCCTCCTGG + Intergenic
1171073125 20:22094759-22094781 CCCATCTTGCCCCTCCCTCTGGG + Intergenic
1171951456 20:31426285-31426307 CTCCTCTCCCCTCTCCCTCTCGG + Intergenic
1171957674 20:31472413-31472435 CCCCTCTCCCCTCTCCCTCTCGG - Intronic
1172100903 20:32483587-32483609 TGCCCCCTCCCCCTTCCTCCGGG - Intronic
1172916379 20:38446894-38446916 CGGCTCTTCCCACTCCCCTCGGG - Intergenic
1173035706 20:39407533-39407555 CCCGATTTCCCCCTCCCTCCAGG - Intergenic
1173119411 20:40275196-40275218 CCCTTCCTCCTCCTCCCTCCAGG - Intergenic
1173852724 20:46228896-46228918 CGCCTCTCCCGCCTCCAGCCTGG + Intronic
1173856080 20:46251478-46251500 CGCCCCCTCCCCCTCCAGCCGGG - Exonic
1174421772 20:50403936-50403958 CCCTTCTTCCCCCTCCCTCTAGG + Intergenic
1174505561 20:51015388-51015410 CCCATCTCCCCCCTCTCTCCTGG - Intronic
1174554616 20:51384879-51384901 CACCTCTTGCCCTGCCCTCCTGG - Intergenic
1174606842 20:51767743-51767765 GGCCCCTTCCCCCTCCGCCCGGG - Intronic
1175459731 20:59143479-59143501 AGCCTCTCTCCCTTCCCTCCTGG + Intergenic
1175716053 20:61254329-61254351 CTCCTCTTTCTCCTCCCTCCCGG + Intronic
1175894353 20:62329514-62329536 TTCCTCTTCCCTCTCCTTCCTGG + Intronic
1176039588 20:63058186-63058208 AGTTTCTTCCCCCTCTCTCCTGG + Intergenic
1176277207 20:64279181-64279203 CACCTCCACCCCATCCCTCCTGG + Intronic
1177075062 21:16561787-16561809 AGACTCTTGCCCCTCCCTCCAGG + Intergenic
1177897219 21:26868009-26868031 GGTCTCTTCCCCTTTCCTCCGGG - Intergenic
1178521874 21:33293398-33293420 CGCTTGTTCCCCCAGCCTCCAGG - Intronic
1178524725 21:33317988-33318010 CGGCTCTTCCCCCACCCACCAGG + Intergenic
1178620067 21:34166551-34166573 CCCCTCTTTCCCATCACTCCTGG - Intergenic
1179567762 21:42259957-42259979 TTGCTCTTCCCCTTCCCTCCTGG + Intronic
1179932631 21:44580320-44580342 CGCCTCCTCCCCCTGCCAGCAGG - Exonic
1179974776 21:44858444-44858466 AGCCTCTTCCTCCTCCCGGCAGG + Intronic
1180041202 21:45281152-45281174 CGCCTTTTCCCCCTGCTCCCCGG + Intronic
1180615174 22:17121564-17121586 CGCCTCCTCCCGCTTCCTCCAGG - Intronic
1180739225 22:18041548-18041570 CGCCCCCCCCACCTCCCTCCCGG + Intergenic
1180851946 22:19026240-19026262 CGCCTCCACCCCCGCCCTGCCGG + Intergenic
1180944182 22:19680630-19680652 CGCCCTCTCCCCCTCCCTGCTGG + Intergenic
1181124037 22:20691357-20691379 CGCCTCTTCCGCTTTCGTCCCGG - Intergenic
1181166892 22:20988767-20988789 CCCCTCTTCCCTCACACTCCAGG + Exonic
1181221005 22:21364579-21364601 CGCCTCCACCCCCGCCCTGCCGG - Intergenic
1181491505 22:23263149-23263171 CGCCTCCTCCTCCTCCTCCCTGG - Intronic
1181532137 22:23522793-23522815 CGCCCCTTCCCCCACCAGCCCGG + Intergenic
1182467915 22:30529403-30529425 CCCCTCTCGCCCCACCCTCCAGG + Intronic
1182736332 22:32534164-32534186 TGCCTCTCTCCCCTCCTTCCTGG - Intronic
1183214736 22:36472272-36472294 CTCTCCTTCCTCCTCCCTCCAGG - Intronic
1183742144 22:39674691-39674713 CTCCCCTTCCCCCTCCCCTCAGG + Intronic
1184211053 22:43035751-43035773 CTCCTCCTCCGCCTCCCACCTGG - Intergenic
1184259267 22:43305441-43305463 AGCCTCTTCCCCAGCCCCCCGGG - Intronic
1184682643 22:46080303-46080325 CGCCTCTGCCCCCCCTCCCCGGG + Intronic
1185108194 22:48885927-48885949 TGCCCCTCACCCCTCCCTCCTGG + Intergenic
1185144070 22:49119966-49119988 TGCCTCCTCGCCCTCCTTCCTGG - Intergenic
949970416 3:9398254-9398276 CGCCTCTTCACCCCCTTTCCTGG + Intronic
950203254 3:11059503-11059525 CTCCTCTTCCTCCTCTCTGCAGG + Intergenic
950333793 3:12177936-12177958 AGCCGCTTCTCCTTCCCTCCTGG - Intronic
950440671 3:13008453-13008475 CTCCTCTTCCCTCTGCCACCTGG + Intronic
950493242 3:13318901-13318923 CCCCTCTGCCCCGACCCTCCTGG + Intronic
950755083 3:15164151-15164173 CCCCTCTCCCCTCTCCCTCTCGG - Intergenic
951717409 3:25664336-25664358 CGCCGCTCCCGCCTCCCTGCGGG + Exonic
951912220 3:27762983-27763005 CTCCTCTTCCCAGTCCCTCTAGG - Intergenic
953149286 3:40309766-40309788 CGCCTCTTCCTGCCTCCTCCCGG + Exonic
953879285 3:46683326-46683348 CCCATGTTCCCCCTCCCACCAGG - Exonic
954134358 3:48575299-48575321 CCCCTCTTCCCTCACTCTCCTGG + Intronic
954662123 3:52231823-52231845 CAGCTCTTCCCCCACCCTCCAGG + Intronic
955080491 3:55653967-55653989 CTCCTCTTCCTCCTCATTCCTGG + Intronic
955357347 3:58242080-58242102 CGCCTATTCTCCCTCTCGCCTGG - Intronic
957054161 3:75431499-75431521 TGTCTCCTCCCTCTCCCTCCAGG - Intergenic
957079441 3:75623762-75623784 CGCCTCAGCCACCTCACTCCTGG - Intergenic
958878005 3:99637934-99637956 CGCCCCATCCCTCTCCCTCCAGG - Intergenic
959683603 3:109123358-109123380 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
960055861 3:113275943-113275965 CGCCCCGTCCCCCTGCCTCTGGG - Intronic
960120819 3:113947744-113947766 CACCTCCTGCCCCTGCCTCCTGG + Intergenic
960419624 3:117427677-117427699 CGACTCTTCCCTGACCCTCCTGG - Intergenic
960896705 3:122514219-122514241 CGCTTCCCCCACCTCCCTCCGGG + Intronic
960954994 3:123025942-123025964 CCCCTCTTGCCCCTTCCTCAAGG + Intronic
961300678 3:125920214-125920236 TGTCTCCTCCCTCTCCCTCCAGG + Intergenic
961887822 3:130107874-130107896 TGTCTCCTCCCTCTCCCTCCAGG - Intronic
962901225 3:139763562-139763584 CCCCTCCTGCCCCTCCATCCAGG + Intergenic
963876687 3:150483723-150483745 TTCCATTTCCCCCTCCCTCCTGG - Intergenic
964309514 3:155377600-155377622 TGCCTCATCTCCCTCCCTACAGG + Intronic
964507056 3:157411079-157411101 CTCCCCTTCCCCCTTCCTGCTGG + Intronic
964638095 3:158879551-158879573 TGCCTCTTCCCCTTCCTGCCTGG + Intergenic
965519516 3:169658866-169658888 CGGCTCGGCCCCCTCTCTCCCGG - Intronic
965757336 3:172040019-172040041 CGCCTGTGCCCCCTGCCTCAGGG + Intronic
966355941 3:179079168-179079190 CGCCCCCTCCCCCTACCCCCAGG + Intergenic
967101748 3:186221537-186221559 CGCCTTTTCCCCGTCCCTCCAGG - Intronic
967952485 3:194851959-194851981 CTCCTCTTCCTCCTCCTTCTTGG + Intergenic
968092679 3:195908739-195908761 CGCCGGGTCCCTCTCCCTCCTGG + Intronic
968093077 3:195909850-195909872 CGGCTCCTCCCCCAGCCTCCGGG + Intronic
969022522 4:4147707-4147729 CGCCTCAGCCGCCTCACTCCTGG - Intergenic
969232958 4:5844406-5844428 CGCCTCTTCTCCCTCCCTCCTGG - Intronic
969390525 4:6888859-6888881 CACGTCTTCCTCCTCCCTCTAGG - Intergenic
969446026 4:7245128-7245150 CGCTTCTTCCCCCTTCCCCCTGG + Intronic
969472035 4:7394620-7394642 TTCCTCCTCCCCCTCCCTCGAGG - Intronic
969757046 4:9156874-9156896 CGTCTCCTCCCTCTCCTTCCAGG + Intergenic
969817005 4:9694449-9694471 CGTCTCCTCCCTCTCCCTCCAGG + Intergenic
970043409 4:11822240-11822262 AGCCTCTCTCACCTCCCTCCTGG - Intergenic
970422103 4:15914901-15914923 CTCCTGCTCCCCCTGCCTCCTGG - Intergenic
973593646 4:52465444-52465466 CGACTCCCCCACCTCCCTCCCGG - Intergenic
974914847 4:68167092-68167114 TGCCTGTTCCCAGTCCCTCCGGG + Intergenic
975655732 4:76639494-76639516 AGCCTCTTCCTCTTCCCTCTGGG + Intronic
975779120 4:77820156-77820178 CGCCTCTCCCCCGGCCCTCGGGG - Intergenic
976264902 4:83181462-83181484 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
976356725 4:84127206-84127228 CGCCCCTCCCCCAGCCCTCCTGG - Intergenic
976524922 4:86075978-86076000 CGCCCCTCCCCCAGCCCTCCTGG + Intronic
976818174 4:89174608-89174630 GGGCTCTTCCCCCACCCACCAGG + Intergenic
976954290 4:90876124-90876146 CCCCTTTTTCCCCTCTCTCCAGG + Intronic
979439456 4:120734113-120734135 CGCCCGTGCCCCCTTCCTCCTGG - Intronic
979733422 4:124052579-124052601 CCCCTCTTCCCCTCCCCTCAAGG - Intergenic
980056692 4:128084610-128084632 CCCCTCTCCCCTCTCCCTCTCGG - Intronic
980859861 4:138486253-138486275 CTCCTCTTTCCTCTCCCTCAGGG + Intergenic
981074002 4:140573392-140573414 CGCAACCTCCACCTCCCTCCCGG + Intergenic
982054242 4:151531634-151531656 CTCTTCTTCTCCCTCCCTCATGG - Intronic
982204076 4:152983966-152983988 CACCTCTTCCCTCTCCTCCCTGG - Intergenic
983474437 4:168196502-168196524 AGCCCCTGCCCCCTGCCTCCAGG + Intergenic
984803782 4:183735935-183735957 CGCCCCCCCCGCCTCCCTCCCGG + Intergenic
985670653 5:1204955-1204977 TCCCTCCTCCCCCTCTCTCCTGG + Intronic
985805158 5:2038480-2038502 CCCCTCTGCACCCTCCCTCCAGG + Intergenic
986074904 5:4326518-4326540 AGCCTCTTACCGATCCCTCCAGG - Intergenic
986351886 5:6887877-6887899 CCCCTCTTCCCCCTCGCCCTGGG - Intergenic
986520436 5:8611307-8611329 CCCCTTTTCTCCCTACCTCCAGG + Intergenic
989599934 5:43192040-43192062 TCCCTCTCGCCCCTCCCTCCTGG + Intergenic
990120393 5:52444164-52444186 CACCCCTTCCCCCTCCAGCCCGG + Intergenic
990581893 5:57173801-57173823 CGCCTTCTCCCCCTCCCCCCAGG + Intergenic
991048533 5:62248248-62248270 CTCCTCTTCACTCTCCCTTCTGG - Intergenic
991054376 5:62306082-62306104 GGCCTCTCCCCGCTGCCTCCAGG - Intergenic
991362976 5:65840279-65840301 CCCCTTTTCCTCCTCCTTCCAGG + Intronic
991375272 5:65958654-65958676 CTCCCCCTCCCCCTCCCTCACGG - Intronic
992009713 5:72514191-72514213 AGCCTCACCCCCCTACCTCCAGG - Intergenic
992397670 5:76382497-76382519 CTCCTGTGCCCCCTTCCTCCAGG + Intergenic
992962737 5:81972131-81972153 CGGCTCTTCCTCCGCCCTCGAGG + Exonic
993602611 5:89947141-89947163 CGCCTCCTCCCCCTCCAATCTGG + Intergenic
994003223 5:94805965-94805987 CTTCTCTTCCCCCTTCCTCTAGG + Intronic
996756961 5:126945582-126945604 CTCCTCTTCTCCCTCCCACCTGG - Intronic
998406740 5:141878491-141878513 CCTCCCTCCCCCCTCCCTCCCGG + Intronic
999300227 5:150486198-150486220 CTCCCCCTCCCGCTCCCTCCCGG - Intronic
999765145 5:154734820-154734842 TCCCTTTTCCCGCTCCCTCCAGG + Intronic
1000332842 5:160219500-160219522 CGCCTCTTCCCCTCTTCTCCTGG - Intronic
1001250627 5:170144232-170144254 CTCCTCTTCCCTCCCACTCCTGG + Intergenic
1001325303 5:170719584-170719606 CACCTGGTCACCCTCCCTCCAGG + Intronic
1001342638 5:170861965-170861987 CGCCTCTGCTCCCTCCCCTCGGG + Exonic
1001513106 5:172337363-172337385 ATCCTCTTCCCTCTTCCTCCTGG + Exonic
1001556562 5:172641238-172641260 CGCCGCCGCCGCCTCCCTCCCGG + Intergenic
1001755008 5:174161511-174161533 CTCCTCTTCCCCCTTCATCTTGG - Intronic
1002007979 5:176252216-176252238 CGCCCCCCCCACCTCCCTCCCGG + Intronic
1002079128 5:176727319-176727341 CGCCCCTACTCCCTGCCTCCGGG - Intergenic
1002081569 5:176740608-176740630 CGCCCCTACCCCCAGCCTCCAGG - Intergenic
1002183137 5:177441715-177441737 CGTGTCTTCCCCGTCCCTCCAGG + Exonic
1002204520 5:177553828-177553850 AGCCTCTTCCCTCTGCCCCCGGG - Intronic
1002784921 6:393158-393180 CGCCTCGGCCGCCGCCCTCCAGG - Exonic
1002883891 6:1276704-1276726 AGCTTCTTGCTCCTCCCTCCAGG - Intergenic
1002913763 6:1511558-1511580 CTCCTCTTCCTCCTCCTTCTCGG + Intergenic
1003306745 6:4935899-4935921 CCCCTCTGCTCCCTCCCTTCTGG - Intronic
1003324897 6:5084480-5084502 CCCCTCTCCGCCCTCCCTGCGGG + Intergenic
1003872254 6:10412535-10412557 CTCCCCTTCCCCCTCCCCCGCGG - Intronic
1004338731 6:14788289-14788311 CTCTCCTTCCCCCTCTCTCCAGG + Intergenic
1004485162 6:16059734-16059756 AGCCTCTTCCCCCTTCCCTCGGG - Intergenic
1004536591 6:16509091-16509113 TCCCCCTTCCCCCTCCCTCCTGG - Intronic
1006065268 6:31456513-31456535 CCCCTCTCCCCTCTCCCTCTCGG - Intergenic
1006136047 6:31897168-31897190 CGCATCAACCCCCTCCCTCTCGG + Intronic
1006271609 6:32970346-32970368 CTCATTTTCCCCCGCCCTCCCGG + Intronic
1007939631 6:45767943-45767965 ACCCTCTTACCTCTCCCTCCAGG + Intergenic
1010905157 6:81478172-81478194 TGCCTCTTCCCCATACCTCCTGG + Intergenic
1011148587 6:84244711-84244733 TGACTCCCCCCCCTCCCTCCCGG + Intergenic
1013179558 6:107706688-107706710 CGCCACTCCCCCCACCCACCTGG - Intronic
1013997338 6:116324092-116324114 CCCCTCTTACCCCTCACCCCAGG + Intronic
1014420288 6:121235363-121235385 CGCCTCTCCCTGCCCCCTCCTGG - Intronic
1015733331 6:136370749-136370771 CCCCATTTCCCCCTCCCCCCAGG - Intronic
1016097667 6:140058470-140058492 TGCAACCTCCCCCTCCCTCCCGG + Intergenic
1017493723 6:154966231-154966253 GGCCCCCTCCACCTCCCTCCCGG + Intronic
1018128688 6:160707117-160707139 CGCATCTTCCCCTGCCTTCCTGG - Intronic
1018449144 6:163890294-163890316 CTCCTCCTCCCTCTCTCTCCAGG - Intergenic
1018464569 6:164031914-164031936 TAGCTCTTCCCCCTCCCTCTTGG + Intergenic
1018559155 6:165083567-165083589 AGCCTCTTCCCCCACCCACTAGG + Intergenic
1018628890 6:165805357-165805379 GCCTTCTTCCGCCTCCCTCCGGG - Intronic
1018927692 6:168217726-168217748 ACCCTCTTCCCCCTACCTCGGGG - Intergenic
1019020722 6:168915356-168915378 CGCCTCCTCCCACCCCCTCATGG - Intergenic
1019331814 7:464044-464066 CTCCACTTCACGCTCCCTCCCGG - Intergenic
1019472797 7:1230198-1230220 CGCCCCCGCCCCCTCCCTCGCGG - Intergenic
1019497701 7:1348088-1348110 TCCCTCTTCTCCTTCCCTCCTGG - Intergenic
1019575994 7:1737931-1737953 CACCCCTTCCAGCTCCCTCCAGG + Intronic
1019812065 7:3172101-3172123 CCCCACTTCTCCCTGCCTCCGGG - Intronic
1019998556 7:4741055-4741077 CGCATCATCCCCCTCTCTCCTGG - Intronic
1020225107 7:6273333-6273355 AGCCTCTCCTCCTTCCCTCCTGG + Intergenic
1020309934 7:6859743-6859765 CGCCTCAGCCGCCTCACTCCTGG - Intergenic
1020321250 7:6940188-6940210 CGTCTCCTCCCTCTCCCTCCAGG - Intergenic
1020406331 7:7839630-7839652 TGACTTTTCCCCCTCTCTCCCGG - Intronic
1020621405 7:10524137-10524159 CTCCTCCTCCCTCTCCTTCCTGG - Intergenic
1021381142 7:19967918-19967940 CTCCTCTTCCCATTCCCTCTTGG + Intergenic
1022559731 7:31336170-31336192 GGCCTTTTCCCCCGCCCTCTGGG + Intergenic
1022643994 7:32214334-32214356 CATCTCTTACCCCTCTCTCCAGG + Intronic
1023229713 7:38013562-38013584 CACCTTTTCCCCACCCCTCCAGG - Intronic
1023723412 7:43118053-43118075 CAACTCTTCCCCCGCCCCCCTGG - Intronic
1023926758 7:44675080-44675102 CCCCCCCTCCCCCTCCCCCCAGG - Intronic
1024130777 7:46350568-46350590 AGTCTCTTCCCCATCCCTGCAGG + Intergenic
1025149532 7:56537956-56537978 CTCCTCCTCCGCGTCCCTCCAGG - Intergenic
1025796197 7:64739576-64739598 CCCCTCTCCCCTCTCCCTCTTGG - Intergenic
1025814923 7:64902625-64902647 TGCAACTTCCACCTCCCTCCGGG - Intronic
1026384963 7:69837538-69837560 CCCCTCCTCTCCCTGCCTCCTGG + Intronic
1026732805 7:72925729-72925751 CTCCTCTTCTCCGACCCTCCAGG + Intronic
1026930369 7:74220195-74220217 CCCTCCTTCCCCCTCCCTGCAGG + Exonic
1027111279 7:75442159-75442181 CTCCTCTTCTCCGACCCTCCGGG - Intronic
1027283521 7:76626722-76626744 CTCCTCTTCTCCGACCCTCCGGG - Exonic
1029158878 7:98537077-98537099 CTCCCTTTCCCCCTCCCTGCAGG - Intergenic
1029253327 7:99252275-99252297 GGCCTCGTCTCCCTCACTCCCGG + Intergenic
1029314055 7:99695297-99695319 AGCCTTTTTCCCCTACCTCCTGG - Intronic
1029319711 7:99747804-99747826 AGCCTTTTCCCCCTTCCTCCTGG - Intergenic
1029524601 7:101087324-101087346 CGGGTCCTCGCCCTCCCTCCTGG + Exonic
1029539033 7:101172323-101172345 CGCCCCTTCCCCATCCCGCACGG - Exonic
1029569518 7:101360420-101360442 CCCCTCTCCCCTCTCCCTCTCGG - Intergenic
1029926945 7:104328544-104328566 CGGCTCCCCTCCCTCCCTCCTGG - Intergenic
1030602565 7:111609295-111609317 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1031468771 7:122144806-122144828 TACGTTTTCCCCCTCCCTCCAGG - Intergenic
1032037500 7:128531269-128531291 CGGCGCTTCCCCCACCCCCCAGG + Intergenic
1032083865 7:128873495-128873517 AGCCGCTGGCCCCTCCCTCCAGG - Intronic
1032322336 7:130896752-130896774 CGTCTCTTCTCCCTTCCTCCTGG - Intergenic
1032424071 7:131806480-131806502 CTCCTACTGCCCCTCCCTCCTGG - Intergenic
1032819339 7:135510135-135510157 CGCCCCTCCCCCGCCCCTCCTGG - Intergenic
1033028745 7:137804201-137804223 CATCTCTTCCCCCTCTCTACTGG + Intronic
1033039470 7:137905074-137905096 CCTCTTTGCCCCCTCCCTCCTGG + Intronic
1034196937 7:149255257-149255279 CTCCTCTTCCCACCTCCTCCTGG + Exonic
1034864722 7:154631266-154631288 CGCCTCCTGCCCCTCCATCCAGG - Intronic
1035289008 7:157825249-157825271 CTCTTCTTCCCCCTTCCTGCTGG + Intronic
1035292223 7:157846512-157846534 TGCCTGTTCCCCCTCCGTTCCGG - Intronic
1035382257 7:158447590-158447612 AGCCTCTTCCCCACCTCTCCAGG + Intronic
1035389667 7:158496557-158496579 CGCCCCCTCCCCTTCCCTGCAGG + Intronic
1036569171 8:9964763-9964785 TGCCTCTCCCACCTCCCTGCGGG + Intergenic
1036849284 8:12190471-12190493 GGTCTCCTCCCTCTCCCTCCAGG - Intronic
1036870644 8:12432745-12432767 GGTCTCCTCCCTCTCCCTCCAGG - Intronic
1037904561 8:22708096-22708118 GGCCTCTTGCCTCACCCTCCTGG - Intergenic
1038406464 8:27326053-27326075 CCCCGCTCCCCGCTCCCTCCCGG + Intronic
1041689501 8:60675294-60675316 CGCCGCTGCCCCCTCCAGCCTGG + Intergenic
1042185824 8:66135349-66135371 CGCCTGGTCCCCCACCGTCCAGG - Intronic
1042530052 8:69805338-69805360 CCTCTCTTCTCTCTCCCTCCTGG - Intronic
1043180749 8:77083681-77083703 CACCTCTTCCCACTTCCTGCTGG + Intergenic
1043562431 8:81509759-81509781 CCTCTCTTCCCCCTAACTCCCGG - Intergenic
1046131900 8:109975778-109975800 CCCCGCCTCCACCTCCCTCCGGG + Exonic
1047419576 8:124695940-124695962 CCCCACTTCCCCGCCCCTCCCGG - Intronic
1048033081 8:130651412-130651434 TGCCTCTGACCCATCCCTCCAGG - Intergenic
1048072650 8:131039075-131039097 CTCCTCATTCCCCTCCCTCAGGG - Intronic
1048302924 8:133264844-133264866 GGCCTCTGTCCCCTGCCTCCTGG - Intronic
1048922293 8:139242171-139242193 TGCCTCTTCCCCTTCCCACTTGG - Intergenic
1049011179 8:139888514-139888536 CTCCTGTTCCTCCTCCCTCTCGG + Intronic
1049034184 8:140061729-140061751 AGCCTCTCCCCCTTCCGTCCAGG - Intronic
1049283606 8:141762905-141762927 CTCCTCTCTCCCCACCCTCCTGG + Intergenic
1049423047 8:142525268-142525290 CGCCTCTCCTGCCTCCCGCCTGG - Intronic
1049555354 8:143278759-143278781 CGCCCCCTCCCCGCCCCTCCAGG - Intergenic
1049584868 8:143428306-143428328 CGCCTCCTCGCCCTCTCTCCCGG + Exonic
1049682037 8:143923587-143923609 GGCCTCTTCCACCTGCCGCCGGG + Exonic
1049796158 8:144498161-144498183 CGCCTCTTCCCTCTGCCTCCAGG - Intronic
1052796924 9:32931452-32931474 CTCCTGCGCCCCCTCCCTCCTGG + Intergenic
1052859353 9:33427334-33427356 CATCTCTGCCTCCTCCCTCCTGG + Intergenic
1053014718 9:34655280-34655302 TGCCTCCTCCCCCTGCCCCCAGG + Exonic
1053451963 9:38201187-38201209 CACCTCTACCTCCTGCCTCCAGG + Intergenic
1053600468 9:39604083-39604105 CGCGGCTTCACCCTCCCTCCAGG + Intergenic
1053651924 9:40177603-40177625 CGCCTCTTCTCACGCCCACCAGG - Intergenic
1053858116 9:42357939-42357961 CGCGGCTTCACCCTCCCTCCAGG + Intergenic
1054253061 9:62738301-62738323 CGCGGCTTCACCCTCCCTCCAGG - Intergenic
1054451344 9:65404985-65405007 CTCCTCTTCCCCCTCCAGGCTGG + Intergenic
1054567177 9:66772800-66772822 CGCGGCTTCACCCTCCCTCCAGG - Intergenic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1056152323 9:83803238-83803260 CCCCTCTCCCCTCTCCCTCTCGG + Intronic
1056508705 9:87282325-87282347 CTCCTCTTCTCCCTCCCCCCTGG - Intergenic
1056595943 9:88007573-88007595 CGCCTCTTCACCTTCCCAGCAGG - Intergenic
1056907465 9:90665999-90666021 TGCATCCTCCCCCTCCCTCTGGG + Intergenic
1057178187 9:93014374-93014396 CCCACCTTCCCCCTCCCTCCCGG - Intronic
1057227272 9:93299048-93299070 CGCCTCTTCTCCCCCCGCCCAGG + Exonic
1057303433 9:93899442-93899464 CGCCTCTGCCTCTTCCCTTCAGG - Intergenic
1057793218 9:98137703-98137725 CACCTCCTCCCCAACCCTCCTGG - Intronic
1058309521 9:103483931-103483953 GGCCTCTGCCACCTCCCTGCCGG + Intergenic
1058391401 9:104499314-104499336 AGCCTCTTCCCCAACACTCCAGG + Intergenic
1058843661 9:108934452-108934474 CGCCGCCACCCCCGCCCTCCGGG - Exonic
1059937847 9:119329543-119329565 TGCCTCTTCCCACTCTCTCAAGG + Intronic
1059984379 9:119807833-119807855 CAGCTCTTCACCCTGCCTCCCGG + Intergenic
1060104618 9:120865959-120865981 CTCCCCTCCCTCCTCCCTCCTGG - Intronic
1060200643 9:121650275-121650297 CCCCTCCTGCCCCTCCCCCCTGG + Intronic
1060416790 9:123436245-123436267 CACCCCTTCCAGCTCCCTCCTGG + Intronic
1060704055 9:125781530-125781552 CCCCTCTCCCCTCTCCCTCTCGG - Intronic
1060829744 9:126706054-126706076 CACCTCATGGCCCTCCCTCCGGG - Intergenic
1061084388 9:128390646-128390668 CCCCTCCTCCCCTTCCCTTCTGG + Exonic
1061141773 9:128771773-128771795 CGTCGCGACCCCCTCCCTCCCGG - Exonic
1061406725 9:130396310-130396332 CACCCCTTCCCTCTCCCACCTGG - Intronic
1061484110 9:130911737-130911759 GGCCTCCTCCCCCTGCCTTCCGG - Intronic
1061489959 9:130939289-130939311 CGCTCCTTCCGGCTCCCTCCCGG + Intergenic
1061680666 9:132241189-132241211 CGCCTCTTCCCCGTCCCACTAGG - Intronic
1061855587 9:133440399-133440421 CACCACCTACCCCTCCCTCCTGG + Exonic
1061861958 9:133472775-133472797 TGCCTCATCTCCCGCCCTCCTGG - Intronic
1062032515 9:134368100-134368122 CTCCTCAACCCCCTCCCCCCGGG + Intronic
1062331487 9:136046764-136046786 TGCCTCTCCTCCCTCCCTCCAGG - Intronic
1062458784 9:136654208-136654230 AGCCTCTTCCACAGCCCTCCCGG - Intergenic
1062462066 9:136666237-136666259 CGCCTCTGCGCCCTCCCTCGTGG + Intronic
1062722788 9:138053306-138053328 CACCTCCTGCCCCTCCATCCGGG + Intronic
1185608408 X:1380401-1380423 CCCCTTTTCCCCCTTCCCCCGGG - Intronic
1185956724 X:4498823-4498845 GGGCTCTTCCCCCACCCGCCAGG - Intergenic
1186350258 X:8732428-8732450 CCCACCTTCCCCCTCCGTCCAGG + Intergenic
1189232047 X:39460240-39460262 AGCCCCATTCCCCTCCCTCCAGG + Intergenic
1190595374 X:52048108-52048130 CCCTGTTTCCCCCTCCCTCCAGG + Intergenic
1190613450 X:52205965-52205987 CCCTGTTTCCCCCTCCCTCCAGG - Intergenic
1190919865 X:54841144-54841166 CTGCTCTTCCCCCTCCACCCCGG - Intergenic
1192184774 X:68939625-68939647 AGCCTCCCCTCCCTCCCTCCTGG - Intergenic
1192768345 X:74165698-74165720 CCCCTCTCCCCTCTCCCTCTCGG + Intergenic
1193144138 X:78059959-78059981 CCCTTCTTCTTCCTCCCTCCAGG + Intergenic
1193765642 X:85526416-85526438 CGCCTCGTGCCACTCTCTCCTGG + Intergenic
1195615250 X:106906723-106906745 GGCCTCATCCACCTCCTTCCTGG + Intronic
1196441163 X:115721420-115721442 CTCCTCCTCCCCCCACCTCCTGG + Intergenic
1196444691 X:115839408-115839430 CTCCTCCTCCCCCCACCTCCTGG + Intergenic
1197366176 X:125567182-125567204 TGCCTCCTTCCCCTCCCTGCTGG - Intergenic
1197938414 X:131763751-131763773 AGCCTCTTCCCCCTCCCCACAGG + Intergenic
1197980774 X:132217109-132217131 GGACTCTTCCCCCTCCGTGCTGG - Exonic
1198466743 X:136910218-136910240 CTTCTCTTTCCCCTCCCTCTCGG + Intergenic
1198859888 X:141057627-141057649 CCCCTTATCCCCCTCCCTCAAGG - Intergenic
1198902805 X:141529763-141529785 CCCCTTATCCCCCTCCCTCAAGG + Intergenic
1199482957 X:148318064-148318086 CATCTCTTCCCCCTCCACCCTGG + Intergenic
1199484903 X:148337129-148337151 CCTCTATTCCCACTCCCTCCAGG - Intergenic
1199612744 X:149631800-149631822 CGCCCCCTGCCCCTCCTTCCGGG + Exonic
1199998092 X:153039505-153039527 CGCCTCCTTATCCTCCCTCCTGG + Intergenic
1200787609 Y:7273910-7273932 CGCCTCTCCCCGCCCCCACCCGG - Intergenic