ID: 1143135560

View in Genome Browser
Species Human (GRCh38)
Location 17:4710622-4710644
Sequence GCGCGCGTGCGCATTGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143135543_1143135560 30 Left 1143135543 17:4710569-4710591 CCCAAGACCAGAGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 19
4: 140
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135554_1143135560 12 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135545_1143135560 29 Left 1143135545 17:4710570-4710592 CCAAGACCAGAGCGGGGCCGGGA 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135548_1143135560 23 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143135560 Original CRISPR GCGCGCGTGCGCATTGGCGC GGG Intronic
900314468 1:2050188-2050210 GCGCGCGGTCCCATTGGCGCAGG + Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
1063122269 10:3113444-3113466 GTGCGCGTGGGCATTGCCGACGG + Exonic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1079135142 11:17772221-17772243 GTGCGTGTGCTCACTGGCGCTGG - Exonic
1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG + Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128260444 15:66229278-66229300 GCCCTGGTGCGCATTGGGGCTGG - Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1161388103 19:4007656-4007678 GCGCGGGTGCTAATTGGCCCGGG + Exonic
1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1165668586 19:37655484-37655506 GCGCGCTAGCGCATTCGCGACGG - Intronic
1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG + Exonic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930867519 2:56136559-56136581 GCGGGCGGGGGCATTGGCGTTGG - Intergenic
931869058 2:66440034-66440056 GCGCGCGTGTGTGTTGGCGAAGG - Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG + Intronic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG + Exonic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG + Exonic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1027198241 7:76046348-76046370 GCGCGCGCGCGCTTTTGAGCCGG + Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic