ID: 1143135560

View in Genome Browser
Species Human (GRCh38)
Location 17:4710622-4710644
Sequence GCGCGCGTGCGCATTGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143135554_1143135560 12 Left 1143135554 17:4710587-4710609 CCGGGAGGGAGGGGGAAGAGGCG 0: 1
1: 1
2: 10
3: 74
4: 665
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135545_1143135560 29 Left 1143135545 17:4710570-4710592 CCAAGACCAGAGCGGGGCCGGGA 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135548_1143135560 23 Left 1143135548 17:4710576-4710598 CCAGAGCGGGGCCGGGAGGGAGG 0: 1
1: 0
2: 6
3: 83
4: 587
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1143135543_1143135560 30 Left 1143135543 17:4710569-4710591 CCCAAGACCAGAGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 19
4: 140
Right 1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143135560 Original CRISPR GCGCGCGTGCGCATTGGCGC GGG Intronic