ID: 1143136733

View in Genome Browser
Species Human (GRCh38)
Location 17:4716488-4716510
Sequence CCTGGTAGGTGGCGATGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143136733_1143136756 30 Left 1143136733 17:4716488-4716510 CCTGTTCATCGCCACCTACCAGG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1143136756 17:4716541-4716563 CCCCCACCCGCCTGCAGGACCGG 0: 1
1: 0
2: 1
3: 84
4: 6049
1143136733_1143136753 25 Left 1143136733 17:4716488-4716510 CCTGTTCATCGCCACCTACCAGG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1143136753 17:4716536-4716558 CCGGCCCCCCACCCGCCTGCAGG 0: 1
1: 0
2: 3
3: 65
4: 693
1143136733_1143136743 6 Left 1143136733 17:4716488-4716510 CCTGTTCATCGCCACCTACCAGG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1143136743 17:4716517-4716539 CCCCGGTGCCCAACCCACCCCGG 0: 1
1: 0
2: 0
3: 33
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143136733 Original CRISPR CCTGGTAGGTGGCGATGAAC AGG (reversed) Exonic
900432029 1:2606990-2607012 GCTGGCCGGTGGCGATGGACAGG - Exonic
900933735 1:5752607-5752629 CCTGGTAGGAGGCCATGAATGGG + Intergenic
901813713 1:11782096-11782118 CCTGGTAGGGGGCGAAGGGCTGG + Intronic
902693997 1:18128140-18128162 CCTGGGAGGTGGTTCTGAACAGG + Intronic
915345876 1:155196573-155196595 CCTAGTTGGTGGAGATGAACAGG - Intronic
923633592 1:235672969-235672991 CCGGGTTGGTGTCGGTGAACTGG - Intronic
1063842813 10:10091050-10091072 ACTGGTAGGTGGAAATGACCTGG + Intergenic
1067848297 10:49739720-49739742 CCTGGCCGGTGCTGATGAACTGG + Exonic
1068130760 10:52892159-52892181 GTTGGTAGGTGGAGATGAAAAGG + Intergenic
1071258437 10:83896445-83896467 CCTGGCAGGGGGAGGTGAACAGG - Intergenic
1081775163 11:45671423-45671445 GCTGGCAGGTGGGGATGAGCAGG + Intergenic
1083896676 11:65623608-65623630 ACTGGCAGGAGGCGATGACCAGG - Exonic
1083939071 11:65885404-65885426 CCTGGGTGGGGGCCATGAACAGG + Intronic
1083959709 11:66007769-66007791 CCTGATGGGTGGAGATGACCAGG - Intergenic
1085510087 11:77083796-77083818 CCTGCTGGGTGACGTTGAACTGG - Intronic
1086145256 11:83544596-83544618 CCTGGGAGGTGGTGATGATAAGG + Intronic
1094405750 12:30114644-30114666 CCAGATAGGTTGCAATGAACTGG + Intergenic
1105944888 13:25180712-25180734 CCTGGTAGGTGGTTAGGATCCGG - Intergenic
1106157433 13:27171573-27171595 CATGGTAGGTGGCGGCGAGCGGG - Exonic
1107363276 13:39642580-39642602 CCTGGTAGGTGGTGATACAGGGG + Intergenic
1110429151 13:75403154-75403176 CCTGGTACCTGGCCATGGACAGG - Intronic
1110500268 13:76219379-76219401 CCAGGTCGGAGGCGATGAACAGG - Intergenic
1124940453 15:34212807-34212829 CCTGATAGGTTGCGAAGACCTGG + Intergenic
1128624792 15:69189183-69189205 ACTGGGAGGTAGGGATGAACAGG - Intronic
1133450554 16:5900549-5900571 GCAGGAAGGTTGCGATGAACGGG - Intergenic
1135324858 16:21519897-21519919 GCAGGTAGGTGGCGAAGACCAGG + Intergenic
1136336345 16:29613172-29613194 GCAGGTAGGTGGCGAAGACCAGG + Intergenic
1136466163 16:30445442-30445464 CCTGGTGGGTGGCCAGGAAGAGG - Exonic
1138108699 16:54306148-54306170 CCTGGTAGGAGTGGCTGAACTGG + Intergenic
1140943918 16:79749621-79749643 ACTGGTATGTGGAGATGCACTGG - Intergenic
1141678055 16:85527913-85527935 CCTGGTAGGTGGGGAGGAGAAGG + Intergenic
1142037063 16:87868954-87868976 GCAGGTAGGTGGCGAAGACCAGG + Exonic
1143136733 17:4716488-4716510 CCTGGTAGGTGGCGATGAACAGG - Exonic
1145899507 17:28481046-28481068 CCTAGCAGGTGCCGATAAACAGG - Intronic
1146368074 17:32245227-32245249 CCAGGTAGGTGGGCATGCACGGG - Intronic
1147401713 17:40184286-40184308 CCTGGTAGGTGTCCAAGAAATGG - Exonic
1149686332 17:58537448-58537470 CATGGTAGCTGGAAATGAACAGG + Intronic
1158390858 18:57043807-57043829 CATGGTAGGTTGAGATGAAAAGG + Intergenic
1161596731 19:5154471-5154493 CCTGGAAGGAGGCGTTGAGCTGG + Intergenic
1163947315 19:20550869-20550891 CCTGGTCTGTAGCCATGAACAGG - Intronic
1163981761 19:20907307-20907329 GTTAGTAGGTGGCAATGAACAGG - Intergenic
1165593580 19:36991843-36991865 CCAGGTGAGTGACGATGAACTGG + Intronic
928010227 2:27600563-27600585 CCTGGTAGACTGCGATGAAGAGG - Intronic
929958836 2:46480761-46480783 CCTGGTGGGTGACAAGGAACGGG + Exonic
930095400 2:47562582-47562604 CCTGGTAGGTGGCTAGGGAATGG + Intronic
931487511 2:62707245-62707267 CCTGGTAGGAGGCCACAAACTGG - Exonic
932126401 2:69149181-69149203 CCTGGTGGGTGGAAATGCACAGG - Intronic
932309221 2:70726460-70726482 CCTGTTAGGGAGTGATGAACTGG - Intronic
934604441 2:95683177-95683199 CCTGGGATGTGGCGCTGAAAAGG + Intergenic
935658245 2:105443281-105443303 GCTGGTAGCTGGGGATAAACTGG - Intergenic
936537841 2:113325408-113325430 CCTGGGATGTGGCGCTGAAAAGG + Intergenic
937720483 2:125089653-125089675 AATGTTAGGTGGCGATGAAGAGG - Intergenic
942268060 2:174248072-174248094 CCTGGGAGTTGGCCAGGAACAGG - Intronic
942642261 2:178072539-178072561 CAGGGGAGGTGGCGCTGAACTGG - Exonic
948304906 2:236939558-236939580 CCTGGGAGGTGGCCATGGAGAGG + Intergenic
948311037 2:236987136-236987158 CCTGCTTGGTGGAGATGAATTGG + Intergenic
948395023 2:237639093-237639115 CCTGGTAGGTGGCAATTAAATGG + Intronic
948938445 2:241183676-241183698 CCTGGGAGGTGACGATGCCCTGG - Intergenic
1172025074 20:31943014-31943036 CCTGGCAGCTGGGGATCAACTGG - Exonic
1172847973 20:37941342-37941364 CCAGGCAGGTGAAGATGAACAGG + Intronic
1173160116 20:40646430-40646452 CCTGGCAGGTGGAAAGGAACTGG - Intergenic
1182075141 22:27490409-27490431 GCTGCTAGGTGGCTATAAACAGG + Intergenic
1183976545 22:41515577-41515599 GGTGGTTGGTGGGGATGAACGGG + Intronic
1185408603 22:50671614-50671636 CCTGGAAGGTGGGGATTTACAGG - Intergenic
952216902 3:31287345-31287367 CCTGGAAGGAGGAGAGGAACTGG - Intergenic
952883987 3:38001818-38001840 CCTGGAAGATGGCGAGGAAGTGG - Exonic
956499486 3:69866507-69866529 TCTGGTAGGTGGCTATGACAAGG + Intronic
956809293 3:72848591-72848613 CCTGGGAGCCGGCGTTGAACCGG + Intronic
959437437 3:106333954-106333976 CCTTGTGGGAGGCGAAGAACAGG - Intergenic
962693957 3:137929315-137929337 CCTGGTGGGTGGCAGTGAAAGGG + Intergenic
966086035 3:176067949-176067971 CCTGGCAGGGGGAGGTGAACAGG + Intergenic
966423973 3:179761252-179761274 CCAGGTAGGTGGCGAGAAAATGG + Exonic
967853118 3:194097033-194097055 CCTGGTAGGTGGAGAGGACAGGG - Intergenic
971183548 4:24352499-24352521 CCTGAGATGTGGGGATGAACTGG - Intergenic
979099721 4:116599414-116599436 CCTTGAAGGAGGCGATGACCTGG - Intergenic
980464000 4:133150950-133150972 CCGGGTCGGTGGCGTTGAGCTGG - Exonic
988557288 5:32248230-32248252 CCTGGTAGGTGAAGATTAAATGG - Intronic
990618847 5:57538376-57538398 CCTGATGGTTGGAGATGAACTGG - Intergenic
992773577 5:80070772-80070794 CCTGGTACGTGGCAATTCACAGG - Intronic
993045888 5:82866281-82866303 TTTTGTAGGTGGCCATGAACAGG + Intergenic
999383566 5:151138791-151138813 CCTGGCAGGTGGGGAAGAAGAGG + Exonic
1000210687 5:159104236-159104258 CCTGGCAGGTGGCGAGGGAAGGG - Intergenic
1003176149 6:3752911-3752933 CCTGGTCTGGGGCGGTGAACAGG + Intergenic
1007699815 6:43759918-43759940 CCTGGTGGGAGGGGATGAAAGGG - Intergenic
1007984285 6:46191988-46192010 CCTGGTAGCTGGAGAAGAAATGG - Intergenic
1010995630 6:82529023-82529045 CCGGGTAGGGGGAGAGGAACAGG + Intergenic
1011712624 6:90070079-90070101 CCTTGCAGGTGGCTTTGAACTGG - Intronic
1020380239 7:7536791-7536813 CCTGGTAAGTGTCCATGAATTGG - Intergenic
1030119126 7:106089072-106089094 CCTGGCAGGTGGAGGTTAACAGG + Intergenic
1035040847 7:155925978-155926000 CCTAGTAGGTGGAGATGCCCAGG - Intergenic
1040088596 8:43371356-43371378 CCTGGTAGGTTGTGAGCAACAGG + Intergenic
1049529876 8:143148919-143148941 CCTGGTGGGTGTGGGTGAACTGG - Intergenic
1052247879 9:26359914-26359936 ACTGATATGTGGCAATGAACAGG - Intergenic
1055741756 9:79397205-79397227 TCTGGTAGCTGGCAATGAAGAGG - Intergenic
1059455292 9:114396809-114396831 CCTGGAAGGTGGGAATGATCTGG - Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic