ID: 1143137665

View in Genome Browser
Species Human (GRCh38)
Location 17:4720712-4720734
Sequence CCCCACCAAAAGCAAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143137665_1143137669 23 Left 1143137665 17:4720712-4720734 CCTCTTCCTTGCTTTTGGTGGGG 0: 1
1: 0
2: 4
3: 65
4: 414
Right 1143137669 17:4720758-4720780 CAAGATGCCTTAGCCTTGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143137665 Original CRISPR CCCCACCAAAAGCAAGGAAG AGG (reversed) Intronic
900591853 1:3463657-3463679 CCCGGCCAAAAACAAGGTAGGGG + Exonic
900697665 1:4022362-4022384 CCCCACCAAGACCAAGAATGTGG + Intergenic
900963886 1:5944247-5944269 CCTCACCAAAGACAAGGAGGAGG + Intronic
902650919 1:17837090-17837112 CCCCACCAACCCCAAGGATGGGG + Intergenic
902674001 1:17995756-17995778 CACCACTAGAAGCTAGGAAGAGG - Intergenic
903030687 1:20462272-20462294 CCCCACCCAAAGCTGGGCAGTGG - Intergenic
903473655 1:23604951-23604973 CACCACCAGAAGCTAGGAAGGGG + Intronic
903837816 1:26217216-26217238 CCCCTCCCAAAGAAAGGAGGTGG - Intergenic
904727583 1:32561442-32561464 ACCCACCAGAAGCTAGGAAGAGG - Intronic
904842732 1:33383868-33383890 AGCCACCAGAAGCTAGGAAGAGG + Intronic
905145655 1:35884886-35884908 CCAGACCAAATGTAAGGAAGTGG - Intronic
907557764 1:55359476-55359498 CACCACCAGAAGCTAGGAAGGGG + Intergenic
908382922 1:63613446-63613468 CACCACCAGAAGCTAGGAAGAGG - Intronic
908407257 1:63827399-63827421 CACCAGCAAAAGAAAGGGAGTGG - Intronic
908988972 1:70061364-70061386 CACCACCAAAAGGAGGGTAGGGG - Intronic
909453329 1:75823086-75823108 GACCACCAAAAGCTAGAAAGGGG - Intronic
909456483 1:75855497-75855519 AATCACCAAAAGCTAGGAAGAGG - Intronic
910959617 1:92747846-92747868 AACCACCCAAAGCTAGGAAGAGG - Intronic
915064728 1:153215408-153215430 TCCACCCAAAACCAAGGAAGAGG + Intergenic
915515726 1:156411370-156411392 TCCCACCAAAACCCAGGAGGTGG - Intronic
915995528 1:160558603-160558625 CTCCAGCAAAAGCAAAGAACTGG + Intronic
916175348 1:162033529-162033551 TGCCAACAAAAGCAAGGAAGGGG - Intergenic
916777084 1:167978326-167978348 TCCCACCAACAGCATGTAAGAGG + Intronic
917881777 1:179344186-179344208 CCCCAAAAACAGGAAGGAAGGGG - Intronic
918587983 1:186209746-186209768 CCACACCAGAAGCTAGGAAAAGG + Intergenic
921499777 1:215887648-215887670 CCCCACCAAAAGCAAACACTAGG - Intronic
921802337 1:219415804-219415826 CACTACCAAAATCTAGGAAGAGG - Intergenic
921868057 1:220107800-220107822 AGCCACCAAAAGCTAGAAAGAGG - Intronic
922130840 1:222775618-222775640 CACCACCAAAAACAATGAAAAGG + Intergenic
923424859 1:233858807-233858829 CCCCACCAACCTCCAGGAAGGGG - Intergenic
923535960 1:234852012-234852034 CCCCACCCAAGGCAAGGAGCTGG - Intergenic
1063136148 10:3218088-3218110 CACCACCCCGAGCAAGGAAGGGG + Intergenic
1063930153 10:11019586-11019608 CCCCACCAAAAAAAAGGAGGGGG + Intronic
1064219840 10:13431239-13431261 GCCCAGCAAGGGCAAGGAAGAGG - Intergenic
1064374060 10:14779842-14779864 CCTCACCTAAAGCACTGAAGGGG - Intergenic
1064703661 10:18048124-18048146 AACCACCAGAAGCTAGGAAGAGG + Intergenic
1065581305 10:27174607-27174629 AGCCACCAGAAGCCAGGAAGAGG - Intronic
1067179750 10:43975794-43975816 AACCACCAGAAGCCAGGAAGAGG + Intergenic
1067396625 10:45925810-45925832 AGCCACCAGAAGCTAGGAAGAGG - Intergenic
1067466628 10:46503808-46503830 CCCTACCCAAAGCCAGAAAGGGG - Intergenic
1067620560 10:47880797-47880819 CCCTACCCAAAGCCAGAAAGGGG + Intergenic
1068101243 10:52556299-52556321 CCCTGCCAAAAGAAAGAAAGAGG - Intergenic
1068471839 10:57475273-57475295 ACTCAACAAAAGCAAGCAAGAGG + Intergenic
1068612083 10:59071282-59071304 CACCACTAGAAGCTAGGAAGAGG + Intergenic
1069340362 10:67402633-67402655 CCCCACCCCAGCCAAGGAAGTGG + Intronic
1069768469 10:70881848-70881870 CCCCAGCAAAGGCCAGGAAAGGG - Intergenic
1070478806 10:76858830-76858852 CACCACCAGAAGCCAGGAAGAGG - Intergenic
1070962863 10:80511220-80511242 CCACACCAGATGCGAGGAAGGGG + Intronic
1071463915 10:85922704-85922726 CCCCTCCATTTGCAAGGAAGGGG + Intronic
1071741078 10:88358976-88358998 CCCCACATAAAGCAAGGGTGTGG + Intronic
1071804308 10:89100004-89100026 TCCTACCACAATCAAGGAAGAGG + Intergenic
1072757770 10:98031561-98031583 CCCCACCACCACCAAGGCAGCGG - Intergenic
1073304318 10:102491059-102491081 GCACACCAAAAGAAGGGAAGTGG + Intronic
1074664479 10:115704203-115704225 ACCCACCAGAAGCTAGGAAGAGG - Intronic
1075148924 10:119908622-119908644 CACCACCAGAAGCTAGGAAGAGG + Intronic
1075745441 10:124724307-124724329 TTCCACCAAAAGCTGGGAAGGGG - Intronic
1077384633 11:2263153-2263175 CCCCTCCGAAAGGAGGGAAGAGG - Intergenic
1077602795 11:3585196-3585218 TCCCAACAAAAGCAAGCAATAGG + Intergenic
1077758244 11:5059574-5059596 CCCCAGCAACAGGAAGGAGGAGG + Exonic
1077760618 11:5092707-5092729 CCCCAGCAACAGGAAGGAGGAGG - Intergenic
1078387904 11:10909146-10909168 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1078522689 11:12075972-12075994 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1078658476 11:13264361-13264383 CACCACCAGCAGCAAGAAAGGGG - Intergenic
1078718128 11:13858975-13858997 CCAGAGCAGAAGCAAGGAAGGGG + Intergenic
1078972872 11:16435527-16435549 AACCACCAGAAGCTAGGAAGAGG + Intronic
1079253844 11:18809393-18809415 CCCCATCAGAAGAAAGAAAGAGG - Intergenic
1079669483 11:23149428-23149450 CACCACCAGAAGCTAGGAAGAGG - Intergenic
1081280928 11:41208803-41208825 GCCCACTAAAACCAAGGAGGTGG - Intronic
1081483042 11:43506656-43506678 CCCCAGCACAACCTAGGAAGGGG + Intergenic
1081638305 11:44735461-44735483 AACCACCAGAAGCTAGGAAGAGG - Intronic
1081753940 11:45531427-45531449 CCACAACATAAACAAGGAAGAGG + Intergenic
1082930953 11:58604365-58604387 CACCACCAAAAGCTAGGAAGAGG + Intronic
1083085304 11:60136583-60136605 CTCCACCAGATGCAAGGATGGGG - Intergenic
1083246445 11:61431663-61431685 CCCAACCAAAAGACATGAAGTGG - Intronic
1083277824 11:61607140-61607162 CCACCCCAAAAGCAAGGGAAGGG - Intergenic
1083421584 11:62556330-62556352 CCACAGCAAAAGCAAGGAAAAGG + Intergenic
1084090302 11:66875304-66875326 CCCCATAGAAAGCAAGGTAGAGG + Intronic
1087191277 11:95257203-95257225 AACCACCAGAAGCCAGGAAGAGG + Intergenic
1087986496 11:104688186-104688208 CACTACCAGAAGCTAGGAAGAGG - Intergenic
1088092539 11:106059818-106059840 CATCATCAAAAGCAAGGAAGTGG + Intronic
1088537537 11:110877320-110877342 CCCAACCAAGATCCAGGAAGAGG - Intergenic
1088846654 11:113674014-113674036 CCCCACCACGAGCAGGCAAGTGG + Intergenic
1088885880 11:114006284-114006306 CACCATCAGAAGCTAGGAAGAGG - Intergenic
1088918552 11:114245154-114245176 CCCCATCAAACTCAAGGGAGTGG - Intronic
1090197847 11:124832222-124832244 CCCCATCAAAAGAAAGAAAGAGG - Intergenic
1091705407 12:2690088-2690110 TCCCAGCAGAAGCAAGGCAGGGG + Intronic
1093772058 12:23029721-23029743 CCCCACCAGATGCCAGGGAGAGG - Intergenic
1094305058 12:29009283-29009305 ACCCACTGAAACCAAGGAAGAGG + Intergenic
1095267204 12:40174370-40174392 ACCCACCAGAAGCTAGGAAGAGG - Intergenic
1095345679 12:41146637-41146659 ATCCACCAGAAGCTAGGAAGAGG + Intergenic
1096054366 12:48638995-48639017 AACCAGCAAAAGCTAGGAAGAGG + Intergenic
1096780252 12:53987566-53987588 CCCCACCAAAAGCAAAGTCAAGG + Intronic
1096789139 12:54034243-54034265 CCCCACCCCAAGCCAGGAAGGGG - Intronic
1097690409 12:62729298-62729320 CCACAGCAAAGGCAGGGAAGTGG + Intronic
1098191917 12:67958251-67958273 CACCACCAAAAGCTAGGAAGAGG - Intergenic
1098325944 12:69301391-69301413 AACCACCAAAAGCTGGGAAGAGG - Intergenic
1098404322 12:70108310-70108332 AAACACCAAAATCAAGGAAGAGG + Intergenic
1098437439 12:70482846-70482868 CCCCATGAAACACAAGGAAGTGG + Intergenic
1098608494 12:72424188-72424210 CACCACCAGAAGCCAGGGAGAGG - Intronic
1099475417 12:83103042-83103064 CCTTTCCAAAGGCAAGGAAGAGG + Intronic
1099626424 12:85081107-85081129 CCCAACCAAAAGTAAGGTAGGGG + Intronic
1100419360 12:94416789-94416811 CCCCACCAAGAGTAACAAAGAGG + Intronic
1100812784 12:98356316-98356338 TCCCACCCACAGCAAGGCAGTGG - Intergenic
1101425612 12:104585825-104585847 AGCCACCAGAAGCCAGGAAGAGG - Intronic
1101511288 12:105394678-105394700 AACCACCAAAAGCTAGAAAGGGG + Intronic
1102009690 12:109610651-109610673 CACCACCAGAAGCTAGGAAGAGG - Intergenic
1102031245 12:109741318-109741340 GCCCTCCAGAAGCAAGGAATGGG + Intronic
1102585788 12:113922041-113922063 AGCCACCCAAAGCAAGGAGGCGG - Intronic
1103230374 12:119325418-119325440 AAATACCAAAAGCAAGGAAGAGG - Intergenic
1103420643 12:120779548-120779570 AACCACCAAAAGAAAGGAAAAGG + Intronic
1103859082 12:123997471-123997493 AACCACCACAAGCTAGGAAGAGG - Intronic
1104221452 12:126788503-126788525 CCCAACCAAAAAGAAGGAAGCGG + Intergenic
1104431180 12:128717633-128717655 TCCCACCAAAAGCCACGTAGGGG + Intergenic
1105203521 13:18199844-18199866 CCCCACCAATAGCATTTAAGAGG + Intergenic
1106630468 13:31466933-31466955 CACCACCAGGAGCAAGGAAGAGG + Intergenic
1106955682 13:34936029-34936051 AACCACCAGAAGCGAGGAAGAGG - Intergenic
1107646625 13:42500740-42500762 CCATACCAAAGGCAAGGCAGTGG - Intergenic
1108364689 13:49698149-49698171 AACCACCAGAAGCTAGGAAGAGG + Intergenic
1108611334 13:52086912-52086934 ACGCACCAGAAGCTAGGAAGAGG + Intronic
1108786729 13:53912025-53912047 CTCTACCGATAGCAAGGAAGAGG + Intergenic
1108957700 13:56182272-56182294 ACCCACAAAGAGGAAGGAAGAGG + Intergenic
1109022219 13:57112324-57112346 ACCCAACAAAAGCAAGCAATGGG - Intergenic
1110242371 13:73283370-73283392 CACCACCACACGCTAGGAAGAGG + Intergenic
1111973399 13:94940603-94940625 CACCACCAAAAGCGAGGAAGAGG + Intergenic
1113124000 13:106956367-106956389 CATCACCAGAAGCTAGGAAGAGG - Intergenic
1113847716 13:113402106-113402128 CACCACCAAAAACAAGGGTGCGG + Intergenic
1114377058 14:22158306-22158328 GTCAACCAAAAGCAAAGAAGAGG + Intergenic
1114402220 14:22420504-22420526 AACCACCAAAATCTAGGAAGAGG + Intergenic
1114516826 14:23305886-23305908 CCCAACCAAAGGCCAGAAAGAGG - Intronic
1114615361 14:24065222-24065244 CCCCACCAAATCCAGGGAGGAGG - Exonic
1115324665 14:32126341-32126363 CACCACCAGAAGCAAGAAAGAGG - Intronic
1116047866 14:39766214-39766236 CCCCTCATAAAGCAAGGAAATGG + Intergenic
1116724873 14:48550450-48550472 TCCAAACAAAAGCAAGGAAGAGG + Intergenic
1116808023 14:49512208-49512230 AACCACCAAAAGCTAGGAAGAGG + Intergenic
1117036749 14:51738543-51738565 CACCAACAAATGGAAGGAAGTGG + Intergenic
1117299838 14:54413980-54414002 CACCACCAGAAGCTAGGAAGAGG - Intronic
1117321610 14:54629225-54629247 CACCACCAGAAGCTTGGAAGAGG + Intronic
1117352428 14:54894363-54894385 CACCACCAGAAGCTGGGAAGAGG + Intronic
1117449243 14:55835028-55835050 CCCCACCAACCTCAAGGAAAGGG - Intergenic
1117580883 14:57150630-57150652 CACCACCAGAAGCTAGGGAGGGG - Intergenic
1117884318 14:60343726-60343748 CCCCACCACAACCTAGGAAGTGG + Intergenic
1119227443 14:72955195-72955217 CTCCACCAAAAGCAGGTTAGTGG - Intronic
1119692800 14:76690346-76690368 CCCCACCAAAAAGAAGGTGGTGG - Intergenic
1120009718 14:79399879-79399901 CGCCACCAGAAGCTAGGAAAAGG - Intronic
1120521348 14:85531049-85531071 CCCCACCAACTGGAAGGAAAAGG - Intronic
1121552182 14:94811266-94811288 CGCCACCAGAAGCTAAGAAGAGG - Intergenic
1121709366 14:96026248-96026270 CACCACCGAAAGCAGGGAAGAGG - Intergenic
1122083867 14:99286009-99286031 AACCACCAGAAGCTAGGAAGAGG + Intergenic
1122635095 14:103126067-103126089 CAGCCCCAGAAGCAAGGAAGAGG - Intronic
1122792000 14:104187926-104187948 CCCCAGGAATGGCAAGGAAGTGG - Intergenic
1122887717 14:104717934-104717956 CCCCATCAAATGCACGGCAGTGG - Intronic
1124111687 15:26795898-26795920 CACCACCAGAAGCCAGGGAGAGG - Intronic
1125542179 15:40476034-40476056 CCACAGCAGAAGCAATGAAGAGG - Intergenic
1125735266 15:41920407-41920429 TCCCACGAAAAGCAAACAAGAGG + Intronic
1126672278 15:51127282-51127304 AGCCGCCAAAAGCCAGGAAGAGG - Intergenic
1128215260 15:65930271-65930293 CCCCACCATGAACAGGGAAGGGG - Intronic
1128707774 15:69850382-69850404 CCCCACCAGGGGCAAGGAGGAGG + Intergenic
1128746056 15:70114998-70115020 CCCCAGCAACAGGAAGGAAGAGG - Intergenic
1129690946 15:77713003-77713025 CCCCAGCATAATGAAGGAAGGGG - Intronic
1129958844 15:79664850-79664872 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1130310502 15:82749781-82749803 TCCCACTAGAAGCTAGGAAGAGG + Intergenic
1130716572 15:86340825-86340847 CCCAACCAGAAGCAAGGTAGAGG - Intronic
1130877283 15:88025604-88025626 CACCACCAGAAACTAGGAAGAGG + Intronic
1130981645 15:88815983-88816005 TGCCACCAGAAGCCAGGAAGGGG - Intronic
1131404676 15:92154668-92154690 ACCCACCAAGAGCAAGGAGTTGG + Intronic
1131698862 15:94910579-94910601 CCCCACCAAAAGCCTGGAGTTGG - Intergenic
1135820761 16:25683481-25683503 CACCACCAGAAGCTAGGAAGAGG + Intergenic
1136928501 16:34397025-34397047 GCCCACTAAGGGCAAGGAAGAGG + Intergenic
1136976073 16:35014779-35014801 GCCCACTAAGGGCAAGGAAGAGG - Intergenic
1137917331 16:52446340-52446362 CACCACCAAAAGCGGGGGAGGGG + Intronic
1138475428 16:57268106-57268128 CACCACCAGAAGCCAGGAGGGGG + Intronic
1139333094 16:66209383-66209405 CCCCACCAAAGGAGAGGGAGAGG - Intergenic
1140662971 16:77205744-77205766 CCCCACCAAAAACAAAAAAGCGG - Intronic
1140829190 16:78735779-78735801 CTCCACCTAAAGCAAGGCAGGGG - Intronic
1141425512 16:83942162-83942184 CCCCACCCACAGCAAGGCCGCGG + Intronic
1142483335 17:231680-231702 GCACACCAAAAGCAAGCCAGAGG + Intronic
1143137665 17:4720712-4720734 CCCCACCAAAAGCAAGGAAGAGG - Intronic
1143569149 17:7743768-7743790 CCCCACCAACAGTCAGGAAAGGG - Intronic
1145069419 17:19790556-19790578 CTTCACTAAAAGCAAGAAAGAGG + Intronic
1145968225 17:28936702-28936724 CCCCACCAAAAAAAAGGGTGGGG - Intronic
1146736382 17:35242519-35242541 CGCCAGCAAAAGAAAGGAGGCGG + Intergenic
1147709794 17:42454782-42454804 AACCACCAGAAGCCAGGAAGAGG + Intergenic
1148002876 17:44400225-44400247 GCCAAATAAAAGCAAGGAAGTGG - Exonic
1148192907 17:45692192-45692214 CCCCACCAACCACAAGGAAATGG - Intergenic
1149490103 17:57078408-57078430 AACCACCAGAAGTAAGGAAGAGG - Intergenic
1149524875 17:57347661-57347683 CCCCCCTGAAAGCAAAGAAGTGG + Intronic
1150375641 17:64679274-64679296 CACCACCAGAAGCCAGGAAGAGG + Intergenic
1151336298 17:73441607-73441629 CACCACCGGAAGCCAGGAAGGGG + Intronic
1151539457 17:74757796-74757818 CCCCAACAAGAGGATGGAAGGGG - Intronic
1153122586 18:1747695-1747717 CCCCCCCAAAAATAAGGAATGGG - Intergenic
1154350350 18:13578023-13578045 CCCCACCAAAAAGAAGTAGGAGG - Intronic
1155921003 18:31602773-31602795 CACCAACAGAAGCTAGGAAGAGG - Intergenic
1157179959 18:45488335-45488357 CCCAAACAACAGCAAAGAAGTGG + Intronic
1157194735 18:45611459-45611481 CCTCACCAAAAGGAAGGAGAAGG + Intronic
1157571353 18:48714382-48714404 CCCCACCATATGAAGGGAAGGGG + Intronic
1158048679 18:53188781-53188803 AGCCACCAGAAGCTAGGAAGAGG - Intronic
1158283622 18:55854499-55854521 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1158571775 18:58602466-58602488 AGCCACCAAAGGCTAGGAAGGGG - Intronic
1159041310 18:63325474-63325496 CACCACCAGAAGCTAGGGAGAGG - Intergenic
1160030059 18:75250084-75250106 CCCCACCAACTGCAGGGATGAGG - Intronic
1160828914 19:1093746-1093768 CATCACCCACAGCAAGGAAGGGG + Intronic
1162882767 19:13672368-13672390 AACCACCAGAAGCCAGGAAGTGG + Intergenic
1163055469 19:14714436-14714458 CGCCACCAGAAGCCAGGGAGGGG + Intronic
1164676984 19:30107507-30107529 CCCCAGCAAGGGGAAGGAAGGGG + Intergenic
1165729101 19:38133002-38133024 CGCCAGCTAAAGCCAGGAAGGGG - Intronic
1168136660 19:54356375-54356397 GCCCCCCAGAAGCAAGGACGAGG - Exonic
925801049 2:7600537-7600559 CCCCACAAAGAGCAGGGAGGAGG + Intergenic
926028252 2:9563562-9563584 CGACACCAGAAGCCAGGAAGAGG + Intergenic
928224833 2:29439796-29439818 CACCACCAGAAGCTAGGAAGTGG + Intronic
928281405 2:29949584-29949606 ACCCATCAAAACCCAGGAAGAGG + Intergenic
928309209 2:30195677-30195699 CCCCACCACAACCAGGGAGGTGG - Intergenic
929745379 2:44652353-44652375 CCCCACCAGGAACAAGGAACAGG - Intronic
929863314 2:45697494-45697516 CCCCAGCAAAAGCAAAGAATTGG + Intronic
931178144 2:59873957-59873979 TCCCAACAAAAGTAAGGAAGGGG - Intergenic
931902668 2:66806857-66806879 TACCACCAGAAGCTAGGAAGAGG + Intergenic
931932890 2:67160787-67160809 CACCACCAAAAGCTAGGAAGAGG + Intergenic
932284507 2:70520874-70520896 CCCGCCCAGAACCAAGGAAGAGG - Intronic
932735530 2:74251758-74251780 CACCACCAGAAGCCAGGAGGAGG + Intronic
934086815 2:88516817-88516839 TCCCACCAGAAGCCAGGGAGTGG + Intergenic
934759488 2:96845769-96845791 CATAACCAAAAGCAAGGAACAGG - Intronic
937678389 2:124617397-124617419 AACCATCAAAAGCTAGGAAGTGG - Intronic
938418857 2:131127270-131127292 AACCACCAGAAGCTAGGAAGAGG - Intronic
938818868 2:134933160-134933182 CCCCAACAGAAGCAAAGAAAAGG - Intronic
938957063 2:136308464-136308486 CAACCCCAAAAGCAGGGAAGCGG - Intergenic
941043052 2:160644851-160644873 CATCACCAGAAGCTAGGAAGAGG + Intergenic
941179754 2:162244781-162244803 CTCCACCAACAGCAAAGGAGAGG - Intronic
942385486 2:175438550-175438572 AACCACCAGAAGCTAGGAAGAGG - Intergenic
942486016 2:176440602-176440624 AGCCACCAAAAGCTAGGAAGAGG - Intergenic
942715311 2:178884834-178884856 CCCCACAGAAAGCAAGGACATGG + Intronic
943046619 2:182867782-182867804 GGCCACCAGAAGCAAGGAAAAGG + Intergenic
943938910 2:193964895-193964917 AACCACCAAAAGCTAAGAAGAGG + Intergenic
945459047 2:210083154-210083176 AACCACCAGAAGCTAGGAAGAGG + Intronic
945937368 2:215916570-215916592 ACCCACCAAAACCAAGAGAGAGG + Intergenic
946098815 2:217301241-217301263 CCCCAGCCAGAGCAAGGAGGTGG - Intronic
946916482 2:224528244-224528266 CCCCTAGAAAAGCAAGGAAATGG - Intronic
947195717 2:227565117-227565139 CCACACCAAGGGCAGGGAAGTGG + Intergenic
947781775 2:232772789-232772811 CCCCATTAAAAGGCAGGAAGTGG - Intronic
948098951 2:235358556-235358578 CGCCACCACAAGCGAGGAGGAGG - Intergenic
949024293 2:241758478-241758500 CCCCACCAAAAAAAAGGGTGTGG - Intronic
949053185 2:241908769-241908791 CCCCATCAAAAGCAACACAGAGG + Intergenic
1168804099 20:662714-662736 CCCCCCAACAAGTAAGGAAGGGG + Exonic
1169105031 20:2987382-2987404 CTCAAGCAGAAGCAAGGAAGGGG + Intronic
1170091799 20:12597256-12597278 CACCACCAGATGCTAGGAAGTGG - Intergenic
1172064802 20:32211669-32211691 AGCCACAGAAAGCAAGGAAGTGG - Intronic
1172932744 20:38597853-38597875 CCCCCAGAAAAGCAAAGAAGGGG + Intergenic
1173398933 20:42707037-42707059 AACCTCCAAAAGCCAGGAAGAGG + Intronic
1173680958 20:44881473-44881495 CAGCACCAGAAGCCAGGAAGAGG - Intergenic
1174152337 20:48494194-48494216 CCCCACCAAGTGCAAAGAACAGG + Intergenic
1174455953 20:50649003-50649025 CATCACCAGAAGCTAGGAAGAGG - Intronic
1175378204 20:58543787-58543809 CACCACAAAAACCAAGAAAGAGG - Intergenic
1175389422 20:58617021-58617043 AGCCACAAAAAGGAAGGAAGCGG - Intergenic
1176070363 20:63223053-63223075 CCCAACCAAAAGCACAGAAGTGG - Intergenic
1176714448 21:10338233-10338255 CCCCACCAATAGCATTTAAGAGG - Intergenic
1176943072 21:14947409-14947431 CCCCACCATTAGGAAGGAAATGG + Intergenic
1177133591 21:17286603-17286625 CCCCAACAAAAACAAGCAATGGG + Intergenic
1177882808 21:26714817-26714839 CGCCATCAGAAGCTAGGAAGAGG + Intergenic
1178122883 21:29487012-29487034 CCCCACCAAAAGCAAAGTAAGGG - Intronic
1178370307 21:32021659-32021681 CCCCACCAGTCACAAGGAAGGGG - Intronic
1178498170 21:33104330-33104352 CCACCCCAAAAGCAGGGAAGTGG + Intergenic
1178600907 21:33993492-33993514 CCCCACCCACAGCAGGGAAGGGG - Intergenic
1178750592 21:35299073-35299095 CCACACCAGGAGCTAGGAAGAGG + Intronic
1179257970 21:39733759-39733781 CACCACCAAAAACCAGGAAGAGG - Intergenic
1179287303 21:39988857-39988879 CACCACCAGAAGCGAGGAGGAGG - Intergenic
1180800672 22:18630490-18630512 CCCCAGGAAGAGCAAGGAACAGG - Intergenic
1180851904 22:19026047-19026069 CCCCAGGAAGAGCAAGGAACAGG - Intergenic
1181076138 22:20378224-20378246 CCCCTCCAAAAGCTTGAAAGAGG - Intronic
1181221047 22:21364772-21364794 CCCCAGGAAGAGCAAGGAACAGG + Intergenic
1181470474 22:23136179-23136201 CCTCACCAGAGGCAAGCAAGAGG + Intronic
1181470648 22:23137310-23137332 CCTCACCAGAGGCAAGCAAGAGG + Intronic
1181820856 22:25474453-25474475 GGCCACCAAAAGAAAGGAAAGGG - Intergenic
1181922020 22:26328018-26328040 CCCACTCAATAGCAAGGAAGGGG - Intronic
1181983938 22:26786102-26786124 CCTCACCACAAGCCACGAAGAGG + Intergenic
1182471335 22:30550130-30550152 CACCACCAGAAGCTAGGAAGAGG - Intergenic
1182756462 22:32683540-32683562 AACCACCAGAAGCTAGGAAGAGG - Intronic
1183236914 22:36625450-36625472 CACCAACCAAAGCAAAGAAGGGG - Intronic
1184381056 22:44145185-44145207 CCACACCAAGAGCGAGGCAGGGG + Intronic
949245817 3:1924574-1924596 CCCCACTATAACCAAGAAAGAGG + Intergenic
949726979 3:7060337-7060359 CCCACCCAAATGCAAGGAGGTGG - Intronic
949767354 3:7541933-7541955 CCACCCCAAAAGCTAGGAAGAGG - Intronic
949873873 3:8611504-8611526 CCCTTAAAAAAGCAAGGAAGTGG + Intergenic
950736131 3:15009848-15009870 ACCCACCAGAAGGTAGGAAGAGG - Intronic
951220698 3:20066110-20066132 CACCACCAGATGCTAGGAAGAGG - Intronic
951465451 3:22996530-22996552 CCCCACCACCAGCAATGAACAGG - Intergenic
951841129 3:27035314-27035336 CCCCCCCAAAAAAAATGAAGAGG + Intergenic
951982118 3:28576588-28576610 CCCCACACAAACCAGGGAAGGGG - Intergenic
952992843 3:38846870-38846892 CACCACCAAGAGAAAGGAAGAGG - Exonic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954288644 3:49637228-49637250 CCCCCCCAGCAGCAAGGAAAAGG - Intronic
955686682 3:61556318-61556340 AAACACCAAAAGCTAGGAAGAGG - Intergenic
956390344 3:68765673-68765695 CCCCACTAAAACCAAAGAAAAGG + Intronic
957219021 3:77358230-77358252 CACCACCAGAAGCTAGGAAAAGG - Intronic
958024726 3:88037500-88037522 AACCACCAGAAGCTAGGAAGAGG + Intergenic
958158983 3:89791915-89791937 CCACTCTAATAGCAAGGAAGAGG - Intergenic
958817632 3:98933338-98933360 CCACATCAAAAGCTAGAAAGAGG + Intergenic
959379782 3:105628191-105628213 CACCACCAGAAGCTAGGAAGAGG - Intergenic
959873457 3:111354587-111354609 CACCACCAGAAGCTAGAAAGAGG + Intronic
959968927 3:112386297-112386319 GACCACCAGAAGCTAGGAAGAGG + Intergenic
960082667 3:113557616-113557638 CACCACCAGAAGGCAGGAAGAGG + Intronic
960905973 3:122601915-122601937 GGCCACCAAATGCAAGGATGTGG - Intronic
961041031 3:123678451-123678473 CCCCAACCCAAGCAAGGACGGGG - Intronic
961081103 3:124029071-124029093 CACCACCAGAAGCTAGAAAGAGG - Intergenic
961108001 3:124258566-124258588 CCCCAGCAAAATCCAGGAAGAGG - Intronic
963334375 3:143956078-143956100 AATCACCAAAAGCTAGGAAGAGG + Intergenic
963444355 3:145384493-145384515 CCCCACCAGAAGCTAGCCAGAGG - Intergenic
963704498 3:148669239-148669261 AACCACCACAAGCTAGGAAGAGG - Intergenic
963895994 3:150685423-150685445 CACCACCACAAGCTAGGAAGAGG + Intronic
964125706 3:153231577-153231599 CCCCAAGAAAAGCAGAGAAGGGG + Intergenic
964621062 3:158720554-158720576 CACCACCTAAAACTAGGAAGAGG - Intronic
965622463 3:170655189-170655211 CACCACCAGCAGCAAGGAGGTGG - Intronic
965921720 3:173925088-173925110 CCCCACCAAAAGAAAAAAATAGG - Intronic
966278969 3:178208101-178208123 CCCCCAGAAAAGCAAAGAAGGGG - Intergenic
966279033 3:178208334-178208356 CCCCAAGAAAAGCAGAGAAGGGG - Intergenic
966279103 3:178208571-178208593 CCCCCAGAAAAGCAAAGAAGAGG - Intergenic
966811562 3:183850276-183850298 AGCCACCAGAAGCTAGGAAGAGG - Intronic
967835543 3:193959502-193959524 CACCTCCAGAAGCTAGGAAGAGG + Intergenic
968054620 3:195681847-195681869 GCCGACCCAAAGCAAGGAACAGG - Intergenic
968101271 3:195967311-195967333 GCCGACCCAAAGCAAGGAACAGG + Intergenic
968124507 3:196148581-196148603 CCTCCCCAAAAGCCGGGAAGAGG + Intergenic
968185808 3:196632941-196632963 CCCAAACAAAGGCAAGAAAGTGG - Intergenic
968867458 4:3222531-3222553 CCCCACCAAAGGCCTGCAAGCGG - Intronic
969070844 4:4537381-4537403 CCCCACCAGAATCATGGAAAAGG - Intronic
969413032 4:7042347-7042369 CCCGGCCAAAAGCCAGGAAGAGG - Exonic
970638881 4:18041289-18041311 AACCACCAGAAGCTAGGAAGAGG - Intergenic
971136332 4:23872427-23872449 CCCCAACAAATGCAGGGCAGTGG - Intronic
971526410 4:27624101-27624123 CACCACCAATAGCTAGGAAAAGG + Intergenic
971768993 4:30871828-30871850 CACCACCATCAGCAAGGATGGGG - Intronic
972229538 4:37055178-37055200 CCTCACCAAGAGCAAGGGAATGG - Intergenic
972365734 4:38372774-38372796 CACCACCACAAGTTAGGAAGAGG + Intergenic
972957607 4:44411826-44411848 CACCACCAGCAGCTAGGAAGAGG + Intronic
972976370 4:44641195-44641217 AAACACCAAAAGCTAGGAAGGGG - Intronic
973588824 4:52420000-52420022 CACCACGAAAAGCAAGCAGGTGG - Intergenic
973705795 4:53579077-53579099 TCCCACCAAAAGTAAGAGAGAGG + Intronic
973870504 4:55161287-55161309 CCCCACCAAAGGCAAGGGGTAGG + Intergenic
974383039 4:61167071-61167093 AACCACCAAAAGCAAAGAAGAGG + Intergenic
974419820 4:61659015-61659037 CACAACCAAAAGCTAAGAAGAGG - Intronic
974539194 4:63211477-63211499 CTCCGCCAGAAGCTAGGAAGAGG - Intergenic
976070327 4:81233025-81233047 CACCACCAGAAGCTAGGAATAGG - Intergenic
977110850 4:92952952-92952974 CATCACCAGAAGCTAGGAAGTGG - Intronic
977134258 4:93282798-93282820 CCTCACCAAAAGCAGGTGAGGGG - Intronic
977138683 4:93339467-93339489 AACCACCAAAAGCTAGGAAGAGG + Intronic
977658106 4:99547243-99547265 AACCACCAAAAGCCAGGAAGAGG + Exonic
978326171 4:107559294-107559316 AGCCACCAGAAGCTAGGAAGAGG + Intergenic
979597355 4:122548865-122548887 AACTACCAAAACCAAGGAAGAGG + Intergenic
980175658 4:129340969-129340991 CACCACCAGAAGGCAGGAAGAGG - Intergenic
980427112 4:132640122-132640144 CACCATCAGAAGCTAGGAAGAGG - Intergenic
981167352 4:141576988-141577010 CCACACAAAGAGCAAGGGAGAGG - Intergenic
982524269 4:156457492-156457514 CACCACCAGAATCCAGGAAGAGG + Intergenic
982641499 4:157967424-157967446 CTCCTCCAGAAGCAAGGAAGAGG - Intergenic
982735073 4:158997592-158997614 CCTCACAAAAGGCAAGGGAGAGG + Intronic
983582617 4:169324458-169324480 CCCAACTACAAGCAAGAAAGAGG + Intergenic
984896404 4:184545130-184545152 CCCCATCAGAAGCTAGGAAGAGG + Intergenic
985501681 5:251650-251672 GCCGACCCAAAGCAAGGAAAAGG - Intronic
985735196 5:1575976-1575998 GCCGACCCAAAGCAAGGAAAAGG + Intergenic
986438425 5:7757934-7757956 GGCCACCATGAGCAAGGAAGTGG - Intronic
987212674 5:15699348-15699370 CACCACTAGAAGCTAGGAAGAGG - Intronic
988091936 5:26554352-26554374 CCCCAGGAAATGCAAGGGAGAGG + Intergenic
988214841 5:28258278-28258300 CCCCACAAGAACCATGGAAGTGG + Intergenic
989105376 5:37858312-37858334 CCTAATGAAAAGCAAGGAAGTGG - Intergenic
989311287 5:40021767-40021789 CGCCACCAAAAACAAGCAACGGG - Intergenic
992263319 5:74992329-74992351 CACCACCAGAAGCTAGGAAGAGG - Intergenic
993055433 5:82974847-82974869 CCCCACAAGAAGAAAGGAAAGGG + Intergenic
993106466 5:83606120-83606142 CACCACCAGAAGCTAGGAAGAGG + Intergenic
994532755 5:100989011-100989033 CCCCAAGAAAAGCAGAGAAGGGG + Intergenic
994601222 5:101907859-101907881 CAACACCAAAAGCACTGAAGTGG + Intergenic
995269012 5:110199758-110199780 CACCACCAGAAGCTAGGAAGAGG + Intergenic
995886761 5:116903209-116903231 CTCCACCAAAAACATGGAATGGG + Intergenic
996272819 5:121628911-121628933 CACCACCAGAAGCTAGAAAGAGG - Intergenic
996816126 5:127574163-127574185 CCCCACCAAGAGGAAATAAGGGG + Intergenic
997368728 5:133342381-133342403 CCTCTGCCAAAGCAAGGAAGTGG + Intronic
1000099506 5:158001755-158001777 CACCAGCAGAAGCTAGGAAGAGG + Intergenic
1000346392 5:160317869-160317891 CACCCCCAAAAACCAGGAAGAGG - Intronic
1001135480 5:169099147-169099169 TCCCTCCAGAAACAAGGAAGGGG - Intronic
1001174954 5:169459601-169459623 CAACACTAAAAGCTAGGAAGAGG - Intergenic
1001335707 5:170795133-170795155 CCCCACCAAATGGAGGAAAGTGG - Intronic
1002409624 5:179063203-179063225 CCCCACCAAAATTGAGGAAATGG - Intronic
1002620022 5:180481598-180481620 TCCCACCAAAAGCAAAGATTTGG - Intergenic
1002993358 6:2258432-2258454 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1003236286 6:4297903-4297925 GCCCACCCCAAGGAAGGAAGCGG + Intergenic
1003708178 6:8559062-8559084 CCTTGCCAAAATCAAGGAAGAGG - Intergenic
1004326829 6:14682654-14682676 TCACACCAGAAGCCAGGAAGAGG + Intergenic
1004603603 6:17173952-17173974 GGCCACCAGAAGCTAGGAAGAGG + Intergenic
1005154721 6:22791418-22791440 CGCCATCAGAAGCTAGGAAGGGG + Intergenic
1005617125 6:27584376-27584398 AGCCACCAGAAGCTAGGAAGAGG - Intergenic
1006982038 6:38154786-38154808 CCCAACAGAAAGCAAGGAAGCGG - Intergenic
1007466895 6:42058839-42058861 AACCACCAGAAGCTAGGAAGAGG - Intronic
1007535948 6:42588732-42588754 ACCCACCAAAATCTCGGAAGAGG - Intronic
1008770693 6:54975384-54975406 CACCACCAGAAGCCAGGAAGAGG + Intergenic
1010154918 6:72781256-72781278 ACCCACCAGAAGCTAGGAAGGGG + Intronic
1010262587 6:73833354-73833376 AGCCGCCAAAAGCTAGGAAGAGG + Intergenic
1011078266 6:83461405-83461427 AATCACCAGAAGCAAGGAAGAGG + Intergenic
1012227349 6:96719286-96719308 AGCTACCAAAAGCTAGGAAGAGG + Intergenic
1012321209 6:97848641-97848663 CCACACCAAAACTCAGGAAGTGG + Intergenic
1012546546 6:100425744-100425766 CCTCACCAAATGAAAGGAAGAGG - Intronic
1013185992 6:107758715-107758737 AACCACCAGAAGCTAGGAAGAGG + Intronic
1013234850 6:108188850-108188872 ACCCACCAGAAACAAGGTAGGGG + Intergenic
1014492700 6:122082112-122082134 CCCCTTCAAAGGCAAGGAATGGG + Intergenic
1014835867 6:126159760-126159782 TGCCACCCAAAGCTAGGAAGAGG - Intergenic
1015337180 6:132053230-132053252 AGCCACCAGAAGCTAGGAAGAGG + Intergenic
1016134493 6:140522863-140522885 AACCACCAGAAGCAAGGAAAAGG - Intergenic
1016304789 6:142672356-142672378 CCCAAAGACAAGCAAGGAAGGGG - Intergenic
1016717053 6:147246040-147246062 GCTCACCAATATCAAGGAAGAGG - Intronic
1016779803 6:147944847-147944869 TGTCACCAGAAGCAAGGAAGAGG - Intergenic
1017772066 6:157651248-157651270 CCCCACCAGGTGCCAGGAAGAGG - Intronic
1017942346 6:159063972-159063994 CCCTTCCCAAAGCAAAGAAGAGG + Intergenic
1018101472 6:160444735-160444757 CTCTACCAGAAGTAAGGAAGTGG - Intronic
1018244331 6:161807587-161807609 CAACACCAGAAGCCAGGAAGAGG - Intronic
1018411540 6:163553909-163553931 CCACACATAAAGCAAGGTAGAGG - Intronic
1018629635 6:165810763-165810785 GCCCAACAAAAACAGGGAAGGGG - Intronic
1018785147 6:167102522-167102544 CCCCACCCAAAGGGAGGGAGTGG + Intergenic
1018913452 6:168117657-168117679 CCCCATCATAAGCAGGGCAGGGG + Intergenic
1019529183 7:1495162-1495184 CCCCACCCCAACCAAGGCAGAGG + Intronic
1020227394 7:6290992-6291014 GGCCACCAAAAGGAAGGAAGCGG + Intergenic
1020557477 7:9689103-9689125 CTCCAAAAAAATCAAGGAAGAGG - Intergenic
1020816976 7:12917598-12917620 ACCAACCAAAACCCAGGAAGAGG - Intergenic
1021076060 7:16305990-16306012 CATCACCAGAAGCTAGGAAGAGG - Intronic
1021233767 7:18117654-18117676 CACCAGCAGAAGCTAGGAAGAGG + Intronic
1022485055 7:30771569-30771591 CCCCTCCAAAGCCCAGGAAGTGG + Intronic
1022974655 7:35546096-35546118 CCCCATCAAAAGCCAGAAACAGG + Intergenic
1023639165 7:42240509-42240531 CACCACCAGAAGCCAGTAAGAGG - Intergenic
1023908215 7:44536848-44536870 ACCCCCCAATGGCAAGGAAGGGG + Exonic
1024206479 7:47166337-47166359 CCTAACCAAAAGAGAGGAAGAGG + Intergenic
1026033243 7:66813383-66813405 CCCCACCAACACCACAGAAGAGG - Intergenic
1029075722 7:97932391-97932413 TTCCAACAAAAGCAAGGAATAGG + Intergenic
1031076307 7:117216256-117216278 CACAACCAAAATCAAGGTAGGGG + Intronic
1032529216 7:132606198-132606220 CACCACCAGAGGCCAGGAAGAGG + Intronic
1032864931 7:135915664-135915686 CACCACCAGAAGCTAGGAAGAGG - Intergenic
1033303328 7:140205801-140205823 CGCCACCAAAAGCAATCGAGAGG - Intergenic
1033974510 7:147083238-147083260 CACCACCAAAAGCAACAAAGAGG + Intronic
1034892757 7:154855324-154855346 CCCCACAAAAAGCCATAAAGTGG + Intronic
1034980597 7:155473641-155473663 CTTCACAAAAAGCCAGGAAGAGG - Intergenic
1036241802 8:7087941-7087963 TTCCAACAAAAGCAAGGAATAGG - Intergenic
1036260031 8:7232162-7232184 TTCCAACAAAAGCAAGGAATAGG + Intergenic
1036312072 8:7690731-7690753 TTCCAACAAAAGCAAGGAATAGG + Intergenic
1036357430 8:8055348-8055370 TTCCAACAAAAGCAAGGAATAGG - Intergenic
1036721280 8:11177722-11177744 CCACCCCAGAAGCTAGGAAGGGG + Intronic
1036901070 8:12669581-12669603 TTCCAACAAAAGCAAGGAATAGG + Intergenic
1038003736 8:23412414-23412436 CACCACCACAATCAAGGAATAGG - Intronic
1038009089 8:23459620-23459642 AGCCACCAGAAGCTAGGAAGAGG - Intergenic
1040310550 8:46234572-46234594 GCCCACCAAAAGCAAAAATGGGG + Intergenic
1040561873 8:48529626-48529648 CCCCACCAAGAGCAAGCCATGGG - Intergenic
1041460173 8:58102759-58102781 CCCCTCAAAAAGAAGGGAAGTGG - Intronic
1041821035 8:62033129-62033151 CACCATCAAAAGGTAGGAAGAGG - Intergenic
1042029256 8:64456905-64456927 AACCACCAGAAGCTAGGAAGAGG - Intergenic
1042115092 8:65422670-65422692 AGCCACCAAAAGCTAGAAAGAGG + Intergenic
1042315034 8:67417216-67417238 ACCAACCAGAAGCTAGGAAGAGG + Intergenic
1042317583 8:67440189-67440211 AACCACCCAAAGCTAGGAAGAGG - Intronic
1042467300 8:69141963-69141985 ACCCAGAAAAAGCAAGGAAATGG - Intergenic
1042770752 8:72379114-72379136 CTCCACCAAAATCAACAAAGTGG + Intergenic
1043364156 8:79512271-79512293 CCCCCCCAAAAAAAAGGAGGGGG + Intergenic
1043615012 8:82114632-82114654 GCCCAGCAAAGCCAAGGAAGTGG - Intergenic
1043924802 8:86024847-86024869 AACCACCAGAAGCTAGGAAGAGG + Intronic
1044072275 8:87777723-87777745 AAACACCTAAAGCAAGGAAGTGG + Intergenic
1044610674 8:94088835-94088857 AGCCACCAGAAGCTAGGAAGAGG - Intergenic
1044773335 8:95660908-95660930 AGCCACCAGAAGCTAGGAAGAGG + Intergenic
1044959309 8:97515007-97515029 CATGACCAGAAGCAAGGAAGAGG - Intergenic
1046194317 8:110839000-110839022 CACCACCAGAAGCTAGAAAGAGG + Intergenic
1047607746 8:126491501-126491523 ATGCACCAAAAGCTAGGAAGAGG + Intergenic
1047626901 8:126665753-126665775 AGCCACCAGAAGCCAGGAAGAGG + Intergenic
1047941655 8:129832408-129832430 ATCCACCAGAAGCCAGGAAGAGG + Intergenic
1048007199 8:130428987-130429009 AACCACCACAAGCCAGGAAGAGG - Intronic
1048048351 8:130794109-130794131 CACCACCAGAAGCTGGGAAGAGG + Intronic
1048299386 8:133240058-133240080 GGCCACCAGAAGCCAGGAAGAGG + Intronic
1050557971 9:6806701-6806723 CCCCATCAAAAGCCATGAAAGGG - Intronic
1052361675 9:27567872-27567894 AACCACCAGAAGCCAGGAAGAGG + Intronic
1055710454 9:79055223-79055245 AACCACCAGAAGCTAGGAAGAGG + Intergenic
1056214402 9:84393829-84393851 CCCCACCCAAAGCAGGGAGCAGG - Intergenic
1056557242 9:87699961-87699983 GCCCACCAACAGCAGGGATGGGG + Intronic
1056562242 9:87741298-87741320 CCGCTGCAAAAGCAAGGAAGAGG + Intergenic
1056658337 9:88526848-88526870 AGCCACCAGAAGCCAGGAAGAGG + Intergenic
1058542229 9:106023653-106023675 CACCACCAAATGCTGGGAAGTGG + Intergenic
1058640040 9:107074883-107074905 AGTCACCAGAAGCAAGGAAGAGG - Intergenic
1060259436 9:122061052-122061074 ATCCACCAGAAGCCAGGAAGAGG - Intronic
1060697503 9:125721949-125721971 CCCAACCAAAAGAAGGGAACAGG - Intergenic
1187548222 X:20274387-20274409 AACCACCAGAAGCTAGGAAGTGG + Intergenic
1188927552 X:36063765-36063787 CCCCACAAAAAACAAGTAATGGG + Intronic
1190222365 X:48520656-48520678 CCCCACCACAAGGCAGGAAGGGG + Exonic
1192363620 X:70454167-70454189 CCACCCCAAAAGCAAGAAAGAGG - Intronic
1193990899 X:88305817-88305839 ACCCACCAAATGCAAGCAATTGG + Intergenic
1194376464 X:93139791-93139813 AACCACCAGAAGCTAGGAAGAGG + Intergenic
1196031233 X:111096981-111097003 CCCCACCAAAAAAAGGGGAGGGG - Intronic
1198774334 X:140163690-140163712 CATCAGCAAAAGCAAGGAACTGG - Intergenic
1199076737 X:143534186-143534208 CCCAACCAAACTCAAGGCAGAGG + Intergenic
1199726093 X:150582712-150582734 CACCACCAGAAGCTAGGGAGAGG + Intronic
1200239649 X:154486843-154486865 CCCCTCCCAAAGCAACGACGCGG + Intergenic