ID: 1143138050

View in Genome Browser
Species Human (GRCh38)
Location 17:4723113-4723135
Sequence CACGGGAGTCGGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143138050_1143138057 5 Left 1143138050 17:4723113-4723135 CCAGCATCCCTCCGACTCCCGTG No data
Right 1143138057 17:4723141-4723163 GCTCCTTGACCTCTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143138050 Original CRISPR CACGGGAGTCGGAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr