ID: 1143138050 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:4723113-4723135 |
| Sequence | CACGGGAGTCGGAGGGATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143138050_1143138057 | 5 | Left | 1143138050 | 17:4723113-4723135 | CCAGCATCCCTCCGACTCCCGTG | No data | ||
| Right | 1143138057 | 17:4723141-4723163 | GCTCCTTGACCTCTAAGCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143138050 | Original CRISPR | CACGGGAGTCGGAGGGATGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||