ID: 1143139475

View in Genome Browser
Species Human (GRCh38)
Location 17:4733178-4733200
Sequence GGAGAACTAGGCCAGGGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 413}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143139471_1143139475 -7 Left 1143139471 17:4733162-4733184 CCTGTGAGCAGATGCTGGAGAAC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 36
4: 413
1143139467_1143139475 22 Left 1143139467 17:4733133-4733155 CCGCCTCAAGCTCAGTGATGTGG 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 36
4: 413
1143139469_1143139475 19 Left 1143139469 17:4733136-4733158 CCTCAAGCTCAGTGATGTGGCTC 0: 1
1: 0
2: 0
3: 14
4: 231
Right 1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 36
4: 413
1143139466_1143139475 23 Left 1143139466 17:4733132-4733154 CCCGCCTCAAGCTCAGTGATGTG 0: 1
1: 0
2: 0
3: 34
4: 474
Right 1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 36
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143139475 Original CRISPR GGAGAACTAGGCCAGGGAGA TGG Exonic
900314408 1:2049962-2049984 GGAGAACCCGGCCAGGGTCACGG - Intergenic
901821613 1:11833889-11833911 GAAGAACAAGGCCAGAGTGACGG - Exonic
901882923 1:12204478-12204500 GGAGAACCAGGCTGGGGTGAGGG + Intronic
901916415 1:12503909-12503931 GGAGAACTAGGCCAGGGAAGGGG + Intronic
902230775 1:15026107-15026129 AGAGACCCAGGTCAGGGAGAAGG - Intronic
902775230 1:18670507-18670529 GGAGAACAAGGCCTGGGCTAGGG - Intronic
903874640 1:26465070-26465092 AGAGAATCAGGCCAGGGAGGGGG + Intronic
905309277 1:37038152-37038174 GGGGGACGAGGCCAGGGAGGGGG - Intergenic
905313491 1:37066441-37066463 GCAGAGGGAGGCCAGGGAGATGG - Intergenic
905512263 1:38530731-38530753 GGAGATCTAGGTCTGGAAGAAGG + Intergenic
905521694 1:38605352-38605374 GGAGGACTTGGCCAGGGATGTGG + Intergenic
905694223 1:39963007-39963029 GGAGAGCTTGGCCAGGATGATGG - Intronic
906126866 1:43432286-43432308 GAAGAACATGGCCAGGGAGATGG - Exonic
907040026 1:51250997-51251019 GGAGAGCTTGGCCAGGATGATGG + Intronic
907315677 1:53570081-53570103 GGAAAAAGAGGTCAGGGAGAGGG - Intronic
907424676 1:54372176-54372198 GGAGAACTGAGCCACAGAGAAGG - Intronic
908019644 1:59886650-59886672 GGAGCACTGGACCAGAGAGAAGG + Intergenic
908603094 1:65762696-65762718 TGGGAACTAGGCGGGGGAGAAGG + Intergenic
909517675 1:76530866-76530888 AGACAACAAGGCCAGGGAGCTGG + Intronic
910856855 1:91704366-91704388 GGAGAAGTGGGGCAGGAAGAGGG + Intronic
911023058 1:93408101-93408123 GAAAAAGTAGGTCAGGGAGAGGG - Intergenic
911902316 1:103522280-103522302 GGAGAACTACAATAGGGAGAAGG - Intergenic
912216833 1:107623862-107623884 AGAGAACTATGCCAGAGATAGGG - Intronic
912553662 1:110500570-110500592 AGATATCTAAGCCAGGGAGAGGG + Intergenic
912560709 1:110549472-110549494 GGAGCAGGTGGCCAGGGAGATGG + Intergenic
913454276 1:119015113-119015135 GGAAAACCAGTCCAGGCAGAGGG - Intergenic
915028891 1:152859127-152859149 GGAGAATTCAGCCAGGGATAAGG + Intergenic
915254564 1:154616452-154616474 GGAGAAATAATCCAGAGAGAGGG - Intronic
915829578 1:159114297-159114319 GGAAAACTGAGCCTGGGAGAAGG + Intronic
915938950 1:160106361-160106383 GGAGAATTAGGCCGAGTAGAGGG - Intergenic
916055572 1:161067075-161067097 GAAGAACTGGGTCAAGGAGATGG + Intronic
916102727 1:161406666-161406688 GGAGAGCTTGGCCAGGATGATGG - Intergenic
916523042 1:165582057-165582079 GGAGAGCTAGGCCAGGATGATGG - Intergenic
916607639 1:166358853-166358875 AGAAAACTACCCCAGGGAGATGG - Intergenic
917146693 1:171899918-171899940 GGACAAATGGGCAAGGGAGAAGG + Intronic
917230794 1:172835309-172835331 GGAGAACTGGGCTATGAAGAGGG - Intergenic
919113899 1:193257205-193257227 GTAGAAGCAGGCCAGGGAGTTGG + Intergenic
920080135 1:203367115-203367137 GGAGAGCTAGGCCCCTGAGAAGG - Intergenic
921619330 1:217308866-217308888 GGAGAAATAGGCCAAAAAGAAGG - Intergenic
922472048 1:225882665-225882687 GGAGAACTGGGCCAAGCACAGGG + Intergenic
922620026 1:226983507-226983529 GGGGAGTTAGCCCAGGGAGACGG - Intronic
922681336 1:227599340-227599362 GGGAAACCAGGCCAGAGAGAAGG + Intronic
922687915 1:227661866-227661888 GGACCACCAGGCTAGGGAGAAGG - Exonic
923546240 1:234925500-234925522 GGACTACTAGACCAGGGACAGGG - Intergenic
923798518 1:237183806-237183828 GGAGACAGAGGCCAGTGAGAAGG + Intronic
924257539 1:242197230-242197252 GCAGAAATAGGTCAGGGTGAGGG - Intronic
924494640 1:244575351-244575373 GCAGAGCCAGGCTAGGGAGAGGG + Intronic
1064564844 10:16629397-16629419 GCAGAACTAGGACAGGCAGGAGG + Intronic
1064768534 10:18699413-18699435 GAATATCTATGCCAGGGAGAAGG + Intergenic
1067282019 10:44880201-44880223 GGAGAACCAGGCAATGGACAGGG - Intergenic
1067320490 10:45215866-45215888 GGAAAACTAGGAAGGGGAGATGG + Intergenic
1067734092 10:48835732-48835754 GAAGAATGAAGCCAGGGAGAGGG - Intronic
1068374872 10:56165244-56165266 GGAGAACTTGGCCAGACAAAGGG - Intergenic
1068578843 10:58715499-58715521 GGGAAACCAGGCCAGAGAGATGG - Intronic
1069634563 10:69917442-69917464 GGAGAACCAGGGCAGGCAGAAGG - Intronic
1069786767 10:70993254-70993276 AGAGAACTAGACAAGGTAGAGGG - Intergenic
1070651019 10:78236470-78236492 GGGGAACGAGGGCAGGGAGGAGG + Intergenic
1071274168 10:84037766-84037788 AGAGAAGTAGGCAAGGGAGTAGG + Intergenic
1073693265 10:105835244-105835266 GGAGAACCTGTTCAGGGAGAGGG - Intergenic
1074108514 10:110406301-110406323 GCAGAACTGGGCCACGAAGAGGG - Intergenic
1075160568 10:120021087-120021109 GCAGGACTGGGGCAGGGAGAGGG + Intergenic
1075486637 10:122827885-122827907 GGGGAACTAGTCCTTGGAGATGG - Intergenic
1075546744 10:123360936-123360958 GGAGAATTAGGAGAGGCAGATGG + Intergenic
1076903458 10:133351072-133351094 GGAGTGCTAGGTCAGGGATACGG + Intronic
1077413791 11:2415199-2415221 GGAGACCTCGTGCAGGGAGAAGG + Exonic
1078663780 11:13307781-13307803 GGAGAAATAGGTTGGGGAGAGGG + Intronic
1078725819 11:13929967-13929989 AGGGAACCAGGCCATGGAGAAGG + Intergenic
1080048419 11:27834178-27834200 GGAGAAAGAGAGCAGGGAGATGG - Intergenic
1080668553 11:34356842-34356864 GGAGATCCGGGCCAGGGTGATGG - Exonic
1080873755 11:36258923-36258945 GGAGCACTAGTCCAGAAAGAAGG - Intergenic
1081579179 11:44340277-44340299 GGAGAAGAAGGTCAGGAAGAGGG - Intergenic
1081627638 11:44665031-44665053 GAAAAACAAGGCCAGGGAGAAGG - Intergenic
1083173552 11:60936298-60936320 GGAGACCGAAGCCAGGGAGGAGG + Exonic
1083923364 11:65792104-65792126 GGAGACCGGGGCCAGGGAGTGGG - Intronic
1084093924 11:66897705-66897727 GGAGAAGCAGGCCAGGAGGAGGG - Intronic
1084596703 11:70120860-70120882 GGAGAACAAGGCCAGCCAGGCGG - Intronic
1084978428 11:72815714-72815736 TGAGAACTAGGCCAGGCCCAGGG + Intronic
1085388243 11:76169315-76169337 GGAGAAATAGGACTCGGAGATGG - Intergenic
1085682181 11:78587322-78587344 GAAGAATTAGAGCAGGGAGAAGG + Intergenic
1086160385 11:83715801-83715823 AGAAAAGTAGGACAGGGAGAGGG - Intronic
1087171317 11:95052412-95052434 GGAGAACAACACCAGGGTGATGG - Intergenic
1087858829 11:103128048-103128070 GGAAGACTATTCCAGGGAGAGGG + Intronic
1088728178 11:112657744-112657766 GGAGAACAGGGACAGGGGGAGGG - Intergenic
1089643796 11:119864909-119864931 TGAGAACCAGGCAGGGGAGAAGG - Intergenic
1089961081 11:122617802-122617824 GGAGAGGTCGGCCAGGGCGAAGG - Intergenic
1090076167 11:123581316-123581338 GGAGGACCAGGCCAGAGGGAAGG - Intronic
1090450551 11:126802303-126802325 GGAAAAGCAGCCCAGGGAGATGG + Intronic
1092164826 12:6336365-6336387 GGAGACCTAGGGAGGGGAGAGGG + Intronic
1092241188 12:6837493-6837515 GGAGAAGTAGGCCTGGGTCAAGG - Exonic
1093135076 12:15439983-15440005 GGAGAGCTTGGCCAGGATGATGG - Intronic
1094687346 12:32730715-32730737 GGAAAACTAGGGCAGAGAAAAGG + Intronic
1095958905 12:47821357-47821379 GGAGAACTGGGACAAGGAAAGGG - Intronic
1096138310 12:49221102-49221124 GGAGAACTAAGTTAGGGAGAGGG + Intronic
1096406929 12:51350778-51350800 GGAGGACTAGGGAAGGGAGGTGG - Intergenic
1098304542 12:69089634-69089656 GGAGAACTAGAGAAGGGAGAGGG - Intergenic
1102408762 12:112698811-112698833 GGAGAAGTAGGAGAAGGAGAAGG - Intronic
1102737834 12:115179054-115179076 GGAGAAGAAGGACAGGGAGGAGG + Intergenic
1102757485 12:115354672-115354694 AGAGAACTGAGCCATGGAGAGGG - Intergenic
1102863085 12:116353295-116353317 GGAGAGGGTGGCCAGGGAGAAGG - Intergenic
1102947071 12:116999320-116999342 GGAGAACTGTGCCAGGGACGTGG + Intronic
1103107919 12:118246544-118246566 GGAGAGCTTGGCCAGGATGATGG - Intronic
1103578895 12:121899707-121899729 GGAGAAGCAGGCCCGGGACATGG + Exonic
1103729127 12:123014240-123014262 GCAGCACTAGGTCTGGGAGAGGG - Intronic
1104676297 12:130714538-130714560 GGCAAACTGGGTCAGGGAGAGGG - Intronic
1104908311 12:132227351-132227373 GGGGAGCTGGGCCGGGGAGAGGG - Intronic
1105836156 13:24213598-24213620 TGAGAAAAAGGACAGGGAGAAGG - Intronic
1108259433 13:48642141-48642163 GGAAAACTTTGGCAGGGAGAGGG - Intergenic
1109448942 13:62483442-62483464 AGTGAACTCGGCCAGGGAGTTGG - Intergenic
1110428984 13:75401183-75401205 GTAGAGCTGGGTCAGGGAGAAGG - Intronic
1111231744 13:85353596-85353618 GAAGAAATAGGCCAGGGTGGTGG + Intergenic
1111290724 13:86166585-86166607 GGAGAAGAAGGAGAGGGAGAGGG - Intergenic
1112631087 13:101162019-101162041 GGAGCACAACTCCAGGGAGAAGG - Intronic
1113074874 13:106458428-106458450 GCAAAACTAGCCCATGGAGAAGG - Intergenic
1113675809 13:112207140-112207162 AGGGTACGAGGCCAGGGAGAAGG + Intergenic
1114519620 14:23325060-23325082 GGAGAACTGGGGCAGGGGGAGGG - Intronic
1114533824 14:23410913-23410935 TGAGAGCCAAGCCAGGGAGAAGG - Intergenic
1115679707 14:35722949-35722971 GGAAAACCATTCCAGGGAGAGGG - Intronic
1115975188 14:38989375-38989397 GGACAACCAGGTCAGGGAGCTGG + Intergenic
1117991363 14:61436905-61436927 GGTGAATTAGAGCAGGGAGAAGG - Intronic
1118615856 14:67574118-67574140 GGAGCACTAGGGCAGGCAGAAGG + Intronic
1119403151 14:74378122-74378144 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1119769535 14:77211787-77211809 GGAGAAATGGGACAGGAAGAGGG + Intronic
1121788318 14:96679806-96679828 GGAGAAAAGGCCCAGGGAGAAGG + Intergenic
1122111061 14:99502940-99502962 GGAGAACTGGGCTGCGGAGAGGG - Exonic
1122296458 14:100708938-100708960 GGAGTACAGAGCCAGGGAGAGGG - Intergenic
1122325946 14:100880762-100880784 GGAGAGCCAGCCCAGGGAGCAGG - Exonic
1122363256 14:101179956-101179978 GCAGAGCTAGGGCAGGGAGGGGG - Intergenic
1122790546 14:104182498-104182520 GGAGAACTTGGCGAGGGGGTCGG + Intergenic
1122912208 14:104836393-104836415 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1123045026 14:105507966-105507988 GGAGAAGGAGGACTGGGAGAGGG - Intergenic
1123421469 15:20140125-20140147 GCAGGGCAAGGCCAGGGAGAAGG + Intergenic
1123443585 15:20306391-20306413 CAAGAGCAAGGCCAGGGAGAAGG - Intergenic
1123530695 15:21146665-21146687 GCAGGGCAAGGCCAGGGAGAAGG + Intergenic
1125584390 15:40809957-40809979 GGAGAACAAGCCCAGTGAGCAGG + Exonic
1125610503 15:40966242-40966264 GGAGAGCATGACCAGGGAGACGG - Intergenic
1125861382 15:43004381-43004403 GGAGACCGGGGACAGGGAGAGGG - Intronic
1126466393 15:48964904-48964926 GGAGATGTAGGGCAGGGAAAAGG - Intergenic
1126680838 15:51200765-51200787 AGACCTCTAGGCCAGGGAGAAGG + Intergenic
1128314662 15:66653109-66653131 AGAGAACCAGGCCAGAGAGGAGG + Intronic
1128559949 15:68658238-68658260 GGAGCCCTGGACCAGGGAGAGGG + Intronic
1128703274 15:69819992-69820014 GGAGAACCAGACCATGAAGAAGG + Intergenic
1129174851 15:73832576-73832598 GCAGGGCTAGGCCAGGGGGACGG + Intergenic
1129657076 15:77531446-77531468 GCAGCACTATGCCAGGGACATGG + Intergenic
1130867598 15:87945691-87945713 GGAGAATGAGGGCAGGGAGGTGG + Intronic
1131106423 15:89737763-89737785 AGAGAACTAAGTCAGGGAAATGG - Intronic
1131232706 15:90671241-90671263 GGAGAAAAAGGCCAGGAACAAGG + Intergenic
1131605364 15:93897978-93898000 GAAGAACTAGGGAAGGCAGAGGG + Intergenic
1131694070 15:94856397-94856419 GGGGAGCCAGGCCAGGGCGAGGG + Intergenic
1132087204 15:98918184-98918206 TGAAAACTAGGCCAAGGAGTTGG + Intronic
1132153373 15:99477843-99477865 GGAGAACGAAGCTGGGGAGATGG + Intergenic
1132837725 16:1962802-1962824 GGAGAGCTTGGCCAGGATGATGG + Exonic
1133015370 16:2937191-2937213 GGAGAAGGCGGCCGGGGAGAAGG + Exonic
1133558802 16:6930696-6930718 GGGGAATTAGGCCAGGCACAGGG - Intronic
1134019732 16:10913150-10913172 GGAGAAGTATTCCAGGCAGAGGG - Intronic
1135294076 16:21264302-21264324 GGGGAAATAGTCCAGTGAGAAGG - Intronic
1136840953 16:33543499-33543521 AAAGAGCAAGGCCAGGGAGAAGG + Intergenic
1138239832 16:55418476-55418498 GTTGAACCAGGCCAGGGCGATGG + Intronic
1139497225 16:67328575-67328597 GGGGAACTAGGCCTATGAGACGG - Intronic
1139693401 16:68655987-68656009 GAAGAATTAGGCAAGGGAGTTGG + Intronic
1139740890 16:69034110-69034132 GGAAAGCTTGGCCAGGGTGATGG - Intronic
1140067550 16:71624613-71624635 GGAGAAGTGGACCAGGCAGATGG - Intergenic
1141468567 16:84222955-84222977 GGAGAACCAGGCCACGCAGATGG + Exonic
1141872556 16:86798192-86798214 GCAGAACTAAGCCAAGGAGAAGG - Intergenic
1142213987 16:88821963-88821985 GTAGCCCTAGCCCAGGGAGATGG + Intronic
1203151118 16_KI270728v1_random:1843796-1843818 AAAGAGCAAGGCCAGGGAGAAGG + Intergenic
1142602230 17:1059271-1059293 GGAGAAACAGGGCAGGGAAAGGG - Intronic
1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG + Exonic
1143355009 17:6321146-6321168 GCAGAATTAGACCAGGAAGATGG + Intergenic
1143473994 17:7192671-7192693 GGAGAAATGGGGCAAGGAGAAGG + Intronic
1143499027 17:7328234-7328256 AGAGAATTAGGCCAGGGGAAAGG - Intronic
1145022940 17:19446369-19446391 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1145413839 17:22695931-22695953 GGGGAGCAAGTCCAGGGAGAAGG - Intergenic
1145414328 17:22702834-22702856 GGGGAGCAAGTCCAGGGAGAAGG + Intergenic
1145992054 17:29085250-29085272 AGAGAAATAGGCCAGGGAGGTGG + Intronic
1146400662 17:32497871-32497893 GCAGAAGTAGGACAGGGAGAGGG - Intronic
1147119180 17:38325613-38325635 TGAGAGCTAGGGCAGGAAGAGGG + Exonic
1147387264 17:40089858-40089880 GGAGACCTAGGCCAAGGAACTGG - Intronic
1147678171 17:42221359-42221381 TGGGAAGGAGGCCAGGGAGACGG + Intronic
1148507955 17:48143121-48143143 GGAGAAGCTGGCCTGGGAGAGGG - Intronic
1148945554 17:51259723-51259745 GGAGAAGCAGGCCAGGGAGCGGG + Intronic
1149166308 17:53757388-53757410 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1151679047 17:75614379-75614401 GCAGGAGCAGGCCAGGGAGAGGG - Intergenic
1153618369 18:6954228-6954250 GGAGACCAAGGCCAAGGAGATGG - Intronic
1153796393 18:8626759-8626781 GGAGAATCAGGAGAGGGAGAGGG - Intronic
1155360415 18:24994409-24994431 AGACAACTAGGCCAAAGAGATGG + Intergenic
1156509931 18:37627822-37627844 GCAGTACTGGGCCAGGGTGATGG - Intergenic
1156914698 18:42451878-42451900 GGAAGAGCAGGCCAGGGAGAAGG + Intergenic
1157732994 18:50020823-50020845 AAAGTGCTAGGCCAGGGAGATGG + Intronic
1157937703 18:51891613-51891635 GGAAAACAAGGGCAGGGAAAGGG - Intergenic
1158300489 18:56046782-56046804 GGAGAACTATGTAAGGAAGAGGG - Intergenic
1158426647 18:57346525-57346547 TGAGGTCCAGGCCAGGGAGAAGG - Intergenic
1158526797 18:58221648-58221670 GGAAGACGAGGCCAGGGAGCCGG + Intronic
1158838792 18:61360693-61360715 GTAGGAATAGTCCAGGGAGAAGG + Intronic
1160583162 18:79899083-79899105 GGAGAACCAGGCCACGCACACGG - Exonic
1160742009 19:690768-690790 GGAGAGCTTGGCCAGGATGACGG - Intronic
1161658180 19:5528925-5528947 GGAGAAGTAAGCCAGGAAGGGGG - Intergenic
1161678337 19:5665996-5666018 GGAGAGCTCTGCCAGGGTGAAGG - Intronic
1162674022 19:12284764-12284786 GGAGAGCTTGGCCAGGATGATGG - Intronic
1162831296 19:13286393-13286415 GGAGACTGAGGCCAGAGAGATGG + Intronic
1163172688 19:15543524-15543546 GGGGAACTAGTCCAGGAAGATGG - Intronic
1164147416 19:22520459-22520481 GTAGAACTGGGTCAGGGTGAAGG - Intronic
1165059895 19:33199989-33200011 GGAGGACAAGGCCAGGGGCAGGG - Intronic
1165306690 19:35007027-35007049 GGAGAGGAAGGACAGGGAGAGGG + Intronic
1165740755 19:38203891-38203913 GGAGCACCAGGCCAGGGGAAGGG - Intronic
1166566207 19:43767112-43767134 GGAGAGGCAGGCCAGGAAGAGGG + Intronic
1166849974 19:45755061-45755083 AGAGAGCTAGGCCAGAGGGAGGG + Intronic
1166854757 19:45777970-45777992 GGAGTATTAGACCAGGCAGAGGG - Intronic
1166936662 19:46337710-46337732 GGAAAAGTATGCCAGGCAGAAGG - Intronic
1167041895 19:47027508-47027530 GGAGAACAGGGGCAGAGAGATGG - Intronic
1167158767 19:47754763-47754785 GGGGAGCCAGGCCAGGGCGAGGG + Exonic
1167240036 19:48338276-48338298 GGAGACTGAGGCCAGGGAGGAGG - Intronic
1167648712 19:50718790-50718812 GGAGAACCCGGCCGGGGAGAGGG + Intronic
1167922683 19:52794765-52794787 GGATCACTGGGCCTGGGAGATGG + Intronic
1168287541 19:55342120-55342142 GGAGGACCAGGCTAAGGAGAGGG - Intronic
925507485 2:4584297-4584319 GGAGAAGTGGGGGAGGGAGAGGG - Intergenic
925953453 2:8937720-8937742 GGAGAACAAGGCAAAGGAGTCGG + Intronic
926070533 2:9885100-9885122 GGAGAACTAGGATAGTGAGAAGG + Intronic
927229931 2:20811976-20811998 GGAGAACCAGGGAAGGGAAAGGG + Intronic
927244664 2:20947777-20947799 GGAGAAATAAGCCAGGGGAATGG - Intergenic
927459608 2:23286628-23286650 GGTGAAGGAAGCCAGGGAGAAGG + Intergenic
927696824 2:25244863-25244885 TGAGAACAAGGCCAGGGAGGGGG + Intronic
928091221 2:28376225-28376247 GGAGCACTGGGCCTGGCAGAAGG - Intergenic
930034027 2:47074542-47074564 GGAGCACATCGCCAGGGAGATGG - Exonic
931049315 2:58393085-58393107 GGATAACTAAGCCAAGGGGATGG + Intergenic
932082531 2:68727948-68727970 AGAGAACTAGGCAAGGGGTAGGG + Intronic
932475635 2:72004046-72004068 GGTGCCCCAGGCCAGGGAGAGGG + Intergenic
932771134 2:74501553-74501575 GGAGAACTAGGCGGGAGAGATGG - Intronic
933659558 2:84916244-84916266 GGAGAGCTTGGCCAGGATGATGG - Intergenic
933996986 2:87677338-87677360 AGAGAACTGAGGCAGGGAGAGGG + Intergenic
934959622 2:98659415-98659437 GGACAACCAGGCCAGGGACATGG + Intronic
935731135 2:106065690-106065712 GGAGAACCGGGCGCGGGAGAGGG - Exonic
936039851 2:109141786-109141808 GGAGAAGGAGGTCAGGGTGACGG + Intronic
936296865 2:111273572-111273594 AGAGAACTGAGGCAGGGAGAGGG - Intergenic
938029685 2:127981612-127981634 GGAGGACTGGGTCAGGGTGAGGG - Intronic
938468818 2:131542114-131542136 AAAGAACGTGGCCAGGGAGAAGG - Intergenic
939721923 2:145664200-145664222 GGAAAACAAGGTCAGGGACAGGG - Intergenic
940012973 2:149073891-149073913 GGAGACCCAGACCAGGGTGACGG + Intronic
940160222 2:150704060-150704082 GAAGAAAGAGGCCTGGGAGAAGG + Intergenic
942617978 2:177814422-177814444 GGATTCCTAGGCCAGGGAGCGGG + Intronic
944853603 2:203744758-203744780 AGAGAAATAGGCAGGGGAGAAGG - Intergenic
946046636 2:216826798-216826820 GGAGAAATAAGTCAGGGTGAGGG - Intergenic
946135609 2:217644522-217644544 GGAGAAGAAGGGCAGGTAGAGGG - Intronic
946174016 2:217911773-217911795 GGAGATCATTGCCAGGGAGAGGG - Intronic
947998593 2:234548770-234548792 GGAGGCCTTGGCCAGGGCGAAGG - Intergenic
948291982 2:236832378-236832400 GGAGAAGCAGGCCTGGGAGCAGG + Intergenic
948399333 2:237671686-237671708 GGAGAAGCTGGCCAGGGACAGGG + Intronic
948653899 2:239465062-239465084 CGAGAACTGGCACAGGGAGAAGG + Intergenic
948699604 2:239751550-239751572 GGACACCCAGGCCAGGGAGGAGG + Intergenic
1169705851 20:8503964-8503986 GGAGAAATAGGACAAGGGGAAGG - Intronic
1169708272 20:8532724-8532746 GAAGAAATGGGCCAGTGAGAGGG + Intronic
1170580649 20:17697248-17697270 GGAGGAATTGTCCAGGGAGATGG + Intronic
1171059647 20:21943995-21944017 GGGGCACTATGTCAGGGAGAGGG + Intergenic
1171097275 20:22343869-22343891 GGAGACCAAGGCAAGGGCGACGG - Intergenic
1172079853 20:32331605-32331627 GGAGAAGAAGGCAAGGGGGAAGG - Exonic
1172251427 20:33482068-33482090 TGAGGAATAGGCCAGGGAGGTGG - Intergenic
1172852155 20:37974220-37974242 GGGGAACCAGGGCTGGGAGAAGG - Intergenic
1173322170 20:41998014-41998036 GGAGAAAGAGGCCAGAGAGGAGG - Intergenic
1173354287 20:42272562-42272584 GGAAGACTAAGGCAGGGAGAAGG - Intronic
1173704680 20:45101062-45101084 GGGGGACTAGGCAAGGAAGAAGG - Exonic
1173768947 20:45640888-45640910 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1173972135 20:47161245-47161267 GGAGAGCTAGCCCAGGATGATGG + Intronic
1174029988 20:47616003-47616025 GAAAAACTAGGCCAGGGTGGTGG + Intronic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175526060 20:59634510-59634532 GGAGCAGCAGGCCAGGGTGAGGG - Intronic
1175538579 20:59733512-59733534 GGAGAAATAGGGCTGGGAGGAGG - Intronic
1175977479 20:62718329-62718351 GGAGTCCTAGGCCAGGGTGGGGG + Intronic
1175985821 20:62763760-62763782 GGAGCAATAGGGGAGGGAGAAGG + Intergenic
1176242637 20:64082234-64082256 GAGGAAGGAGGCCAGGGAGAAGG - Intronic
1178664099 21:34531806-34531828 GGAGGAATAATCCAGGGAGAGGG - Intronic
1179169535 21:38962329-38962351 GGAGCAGTAGGGCAGAGAGAGGG - Intergenic
1179285717 21:39975845-39975867 GGAGGCCTGGGGCAGGGAGAGGG + Intergenic
1180057558 21:45366852-45366874 GGAGAACGGGGCCAGGTGGAGGG - Intergenic
1180071664 21:45439888-45439910 TGGGAACTAGGCCTGGGAGATGG + Intronic
1181050001 22:20233937-20233959 GGACACCTATGCCAGGGTGAAGG - Intergenic
1181273243 22:21673067-21673089 GGGGAACTTGGCCAGGGGGCTGG + Intronic
1181349567 22:22245265-22245287 GGAGAAGGAGGAGAGGGAGAGGG + Exonic
1181830693 22:25558208-25558230 AGAGATCTGGTCCAGGGAGAAGG + Intergenic
1182119918 22:27779852-27779874 GGAGAACAATGCCTGGGGGAAGG + Intronic
1182614185 22:31575337-31575359 GGAGAAACTGGCCAGGAAGATGG + Exonic
1182768498 22:32776089-32776111 AGAGGACGAGGCCAGGCAGATGG + Intronic
1183458783 22:37937096-37937118 GGAGGACCGGGCCCGGGAGAAGG + Exonic
1184171354 22:42761590-42761612 GGAGAACTGGGCCGGGCAGGAGG - Intergenic
1184864906 22:47196974-47196996 GGAGAATGAGGCCTGGGAGCAGG + Intergenic
1185214000 22:49588087-49588109 GGTGAATGAGGCCAGGGAGGTGG + Intronic
950120414 3:10478734-10478756 GAAGAACTAGGACAAGGACATGG - Intronic
952259264 3:31723954-31723976 ATAGAACTAGGCAAGTGAGAAGG + Intronic
952405873 3:33004762-33004784 GGAGAAGTGGTCCAGAGAGAAGG - Intronic
952483577 3:33787148-33787170 GGAGAAATTCGCCATGGAGAGGG + Intergenic
953374294 3:42415752-42415774 GGAGAAGGAGGGGAGGGAGAGGG + Intergenic
953374664 3:42418635-42418657 GGAGAAAAAGGAGAGGGAGAAGG + Intergenic
953844457 3:46416384-46416406 AGAGGACTAGGCCTTGGAGACGG - Intergenic
954674159 3:52306554-52306576 GGAAAAGCAGACCAGGGAGAGGG + Intergenic
954947832 3:54442195-54442217 GGGGAATGAGGCAAGGGAGAAGG - Intronic
955200879 3:56851161-56851183 GGAGAAATGGGGTAGGGAGAAGG - Intronic
955723913 3:61912312-61912334 TGAGAACTAGCCCACTGAGAAGG + Intronic
956747147 3:72319074-72319096 GGAGAACAAGTCCAGGAAGGAGG + Intergenic
956837126 3:73104467-73104489 TGAGAACTGGGCAGGGGAGAAGG - Intergenic
959584325 3:108012037-108012059 GGAGAAACAGGCTAGGAAGAGGG - Intergenic
960266241 3:115624343-115624365 GGAGAAATTGGCCATGCAGAAGG + Intronic
960484332 3:118233100-118233122 GGAGTCATAGGCCAGGCAGATGG + Intergenic
961812482 3:129529835-129529857 GGAAAACTGAGGCAGGGAGAGGG + Intronic
961862908 3:129931821-129931843 GCAGAACTAGGAGAGGGAGATGG + Intergenic
962974477 3:140434128-140434150 GGACAACTGTGGCAGGGAGAGGG - Intronic
964414073 3:156429302-156429324 GCAGATCTAGGCCTGGGAGCTGG + Intronic
964673681 3:159254712-159254734 GGAGAAGGAGGGAAGGGAGAAGG - Intronic
964685156 3:159387145-159387167 GGAGAGCTTGGCCAGGGTGATGG + Intronic
966516633 3:180828240-180828262 GGAGAAGGCGGCCGGGGAGAAGG - Intronic
967135788 3:186511647-186511669 TGAGAACAGGGCCAGGGACATGG - Intergenic
969607910 4:8211499-8211521 GGAGAAGGAGAGCAGGGAGAGGG - Intronic
980071294 4:128245148-128245170 TGAGAACTAGGGCACGGAGAGGG + Intergenic
980836168 4:138195529-138195551 GGAGCAGCATGCCAGGGAGAGGG - Intronic
981316953 4:143349674-143349696 GGAGAGCTTGGCCAGGATGATGG + Intronic
982547879 4:156758512-156758534 GGAGAACAGAGACAGGGAGAGGG + Intergenic
983903363 4:173159985-173160007 AGAGAAATAAGCCAGGGAAATGG - Intergenic
984640180 4:182156501-182156523 GGACTACTAGGGCGGGGAGAGGG - Intronic
984762046 4:183370953-183370975 GGAGAGTGAGGCCAGGGATATGG - Intergenic
985392526 4:189504982-189505004 GGAAAACTAGGCTGGGGAGAGGG + Intergenic
985851096 5:2389593-2389615 GGAGAACAAGGCCAAGGATGAGG - Intergenic
986221456 5:5772377-5772399 GCAGAAGTAGTACAGGGAGATGG + Intergenic
987226400 5:15846020-15846042 GGAGAACTGGACTAGGCAGATGG - Intronic
992686928 5:79208266-79208288 GGAGAAGAAGGACAGGAAGAAGG + Intronic
993645537 5:90456324-90456346 TGAAAACTAGGCCAGGGATGAGG - Intergenic
993858391 5:93103712-93103734 GGAGAGGTGGGGCAGGGAGAAGG - Intergenic
994285404 5:97958769-97958791 AGAGAAATAGGGCAGGGATAGGG - Intergenic
995732919 5:115265047-115265069 GGAGAGCTTGGCCAGGATGATGG + Intergenic
997294823 5:132762755-132762777 GGGGAAGGAGGCCAGAGAGATGG + Intronic
998131906 5:139655626-139655648 GGAGGAAAAGGGCAGGGAGATGG - Intronic
998186133 5:139981393-139981415 GGAGACCCAGGCCAGGGCCATGG - Intronic
999662958 5:153884581-153884603 TAAGACCTAGGCCAGGGAAAAGG + Intergenic
999757238 5:154673654-154673676 GGAGAGCAAGGTCAGGGAGATGG - Intergenic
1000813167 5:165887748-165887770 GGAGAAATCGGTCAGGGAGGAGG + Intergenic
1001476515 5:172054689-172054711 GGAGAACTGCACCAGAGAGAGGG + Exonic
1001483028 5:172101671-172101693 GAAGAAGTAGGGCAGGGAAAGGG + Intronic
1001558927 5:172656647-172656669 CAAGAAGTAGGCCAAGGAGATGG - Intronic
1001826055 5:174746009-174746031 GGGGACAGAGGCCAGGGAGAGGG - Intergenic
1001955564 5:175846137-175846159 GGAGGACTTGGCCAGGCAGGGGG - Intronic
1002571002 5:180139376-180139398 GGAGAAATAGGCCAGGGTCAGGG - Intronic
1002661026 5:180791264-180791286 GAAGAGCCAGGTCAGGGAGAAGG + Exonic
1003102035 6:3184022-3184044 GGAGGACTGACCCAGGGAGAAGG - Intergenic
1005622441 6:27632485-27632507 GAAGCAGTGGGCCAGGGAGAAGG + Intergenic
1006030098 6:31171866-31171888 GGAGGCCTGGGCCAGGGAGGTGG - Intronic
1006197449 6:32254752-32254774 AGAGACCGAGGGCAGGGAGAGGG + Intergenic
1006213837 6:32421319-32421341 TGAGAAGGAGGCCAGGGAGCTGG + Intergenic
1006436111 6:34026939-34026961 GGAAAACTGGAACAGGGAGAGGG + Intronic
1006582435 6:35084679-35084701 GGAGACCTAGGGCAGGGAGCCGG - Intronic
1006641971 6:35494380-35494402 GGAGAACCCTGCCAGGGAAAGGG - Intronic
1007111276 6:39314570-39314592 CTAGGCCTAGGCCAGGGAGAAGG + Intergenic
1007643662 6:43363875-43363897 GGAGAGCTTGGCCAGGATGATGG - Intronic
1007669403 6:43539221-43539243 GGAGAGCTTGGCCAGGATGATGG + Intronic
1008644137 6:53496013-53496035 GGGGAAAGAGGCCAGGGGGAGGG - Intergenic
1009041879 6:58190037-58190059 GGAGAAGGAGGAGAGGGAGAGGG - Intergenic
1010809397 6:80281744-80281766 AGAGAATGAGGACAGGGAGAGGG - Intronic
1011182967 6:84642130-84642152 GGAGAACAAGGCCTGGGAGAGGG + Intergenic
1011508715 6:88076709-88076731 TGAGAAAGAGGCCAGTGAGAAGG + Intergenic
1012863953 6:104595646-104595668 AGAGAAGTAGGCTTGGGAGAGGG - Intergenic
1013092442 6:106912456-106912478 GGAGACCCAGGCCAGGGAAGAGG + Intergenic
1013271576 6:108550468-108550490 TGTGAACTATGCCAGGGAGTGGG + Intergenic
1013792725 6:113855257-113855279 GGAGCACTGGGCCGGGGAGGGGG - Intergenic
1014616298 6:123604264-123604286 GGACAACTAAGCCAGGGAAAGGG + Intronic
1014813308 6:125908621-125908643 GGGGTAGTAGGTCAGGGAGAAGG - Intronic
1015351631 6:132226075-132226097 GGAGAAATTGGCCAAGAAGAAGG - Intergenic
1016510361 6:144835938-144835960 GGTGTGCTAGGCCTGGGAGAAGG + Exonic
1018034241 6:159867733-159867755 GAGGAAAGAGGCCAGGGAGATGG + Intergenic
1018280284 6:162178461-162178483 GGAGCCATAGGCCAGGGAAAGGG - Intronic
1018765782 6:166931914-166931936 GAAGAAGGAGGCCAAGGAGATGG - Intronic
1019149298 6:169993652-169993674 GGGGCACAAGGCCAGGGTGAGGG - Intergenic
1019757459 7:2783396-2783418 AGAGAAGCAGGGCAGGGAGAGGG - Intronic
1022180386 7:27913397-27913419 GGACAAGTAGGACAGCGAGAAGG + Intronic
1022763226 7:33380341-33380363 GGGGCACAAGGCCAAGGAGAGGG - Intronic
1023868230 7:44249016-44249038 CTAGATGTAGGCCAGGGAGAAGG - Intronic
1027484904 7:78749455-78749477 GGAAATCTAGGAAAGGGAGATGG + Intronic
1028509248 7:91604720-91604742 GGAGAACATGGCTAGGTAGAAGG - Intergenic
1029117202 7:98243433-98243455 GGGGAGCCAGGGCAGGGAGAGGG + Intronic
1029373002 7:100160985-100161007 AGAGAACTGGGCTGGGGAGAAGG + Intronic
1029854873 7:103505091-103505113 GGAGCTCTATCCCAGGGAGATGG - Intronic
1031328229 7:120429499-120429521 GGAGGAGTGGGGCAGGGAGAGGG + Intronic
1031980293 7:128120304-128120326 GGAGGACTATACCAGGGAAAGGG + Intergenic
1032369096 7:131328188-131328210 GGAGAGCGAGCCCAGGGAGAAGG + Intronic
1032550617 7:132780903-132780925 GCAGAGCTCGCCCAGGGAGATGG + Intergenic
1035100047 7:156389102-156389124 GAAGAAGGAGGCCAGGGAGCCGG - Intergenic
1035236456 7:157500704-157500726 GGAGAACAAGGGGAGGGAGGAGG - Intergenic
1035280644 7:157776159-157776181 GGAGAAGGAGGACAGGGAGGAGG - Intronic
1035280675 7:157776279-157776301 GGAGAAGGAGGACAGGGAGGAGG - Intronic
1035286368 7:157809853-157809875 GCAGGACTGGGCCAGTGAGACGG - Intronic
1036619560 8:10415644-10415666 GGTGGGCTAGGCCAGGGTGAGGG - Intronic
1037734007 8:21552502-21552524 TGATGACCAGGCCAGGGAGAGGG - Intergenic
1038324738 8:26564349-26564371 GGAGCACAGGGCCAGGGAGATGG + Intronic
1039204909 8:35141400-35141422 GGAGACCTACCCCAGGGTGACGG - Intergenic
1039452940 8:37690270-37690292 GGGGAGCTAGGCCGGGGAGATGG - Intergenic
1040770827 8:50973060-50973082 GGAGGAAAAGGCCATGGAGAGGG - Intergenic
1045656945 8:104397159-104397181 GGAGTTTTAGGGCAGGGAGAAGG - Intronic
1046784069 8:118247138-118247160 GGTGAAATAAGCCAGGCAGAGGG + Intronic
1047257631 8:123227614-123227636 CGAGGGCTTGGCCAGGGAGAAGG + Intronic
1048572563 8:135667703-135667725 GGAAGAGGAGGCCAGGGAGAGGG + Intergenic
1048645721 8:136417212-136417234 GAAGCCCTAGGTCAGGGAGAAGG + Intergenic
1049038719 8:140096859-140096881 GGAGGACTAGGACAGGGACGTGG + Intronic
1049252380 8:141596251-141596273 GGAAACTGAGGCCAGGGAGAGGG - Intergenic
1051291926 9:15553429-15553451 GGAGACCCAGCCCAGGGAGCTGG - Intronic
1051665527 9:19464419-19464441 CGAGCACTAGGCCAGGGGAAAGG + Intergenic
1055144474 9:72916293-72916315 AGAGAACTATGCAAGGAAGAGGG + Intronic
1055796920 9:79984621-79984643 GGGGAAGCATGCCAGGGAGAGGG + Intergenic
1056135081 9:83623216-83623238 GGGGAAGTAGGTCCGGGAGAGGG + Exonic
1056243171 9:84669239-84669261 GGAGAACGCGGGGAGGGAGAAGG + Intronic
1056951207 9:91042197-91042219 GGAGAAGGAGGCCAAGGAGAGGG - Intergenic
1057570114 9:96197952-96197974 AGAAAACTAGGCTAGGGAGTAGG - Intergenic
1057739815 9:97701368-97701390 GGAGAGGTTGGCTAGGGAGAAGG - Intergenic
1057785910 9:98087342-98087364 GGAAAGCTGGGGCAGGGAGAGGG + Exonic
1058023615 9:100117151-100117173 GGAGAGCTTGGCCAGGATGATGG + Intronic
1058618792 9:106862532-106862554 GGAGAAGGAGGCAAAGGAGAAGG - Intergenic
1058618795 9:106862547-106862569 GGAGAAGGAGGCAAAGGAGAAGG - Intergenic
1058785372 9:108381536-108381558 GGAGGAACAGTCCAGGGAGAGGG + Intergenic
1059177591 9:112181313-112181335 GGAGAAGCAGGCCAGGCAGTGGG + Intergenic
1059341457 9:113599789-113599811 GGAGAACAAAGTCAGGCAGATGG + Intergenic
1060396265 9:123319026-123319048 GCAGAACTTGGCAAGGGACAGGG + Intergenic
1060470279 9:123942731-123942753 GGAGATTCAGGCCAGGCAGAAGG + Intergenic
1060495875 9:124118243-124118265 GGAGGAGGTGGCCAGGGAGAGGG + Intergenic
1060756010 9:126214205-126214227 AGAAAAATAGGCCAGGGAGCGGG + Intergenic
1061114452 9:128600475-128600497 GGATAAAGAGGCCAGGCAGATGG - Intronic
1061505750 9:131031035-131031057 GGATGCCTTGGCCAGGGAGAGGG - Intronic
1061738186 9:132677520-132677542 GAAGAACTAGGCAAGGGAGCCGG + Intronic
1061794789 9:133080070-133080092 GGAGAACTAAGGAAGGGAAAAGG - Intronic
1062092040 9:134683367-134683389 GGAGGGCCAGGCCAGGGAGCGGG + Intronic
1062331538 9:136047047-136047069 GGAGACTGAGGCCAGGGAGGAGG + Intronic
1062469675 9:136696947-136696969 GGGGAAGGAGGCCAGGGAGGAGG - Intergenic
1062718708 9:138023719-138023741 GGAGAAGGAGACCACGGAGAAGG + Exonic
1062718712 9:138023734-138023756 GGAGAAGGAGGCCACGGAGAAGG + Exonic
1186337590 X:8607474-8607496 GAAGAGCCAGGCCAGGAAGAAGG - Intronic
1186472696 X:9833858-9833880 GGAGAACTAGGCCAGCAGGAAGG - Intronic
1187025842 X:15434446-15434468 GGAGAAGAAAGACAGGGAGAGGG + Intronic
1187275181 X:17810700-17810722 GGAAAACCAGGCCTGGGAGCTGG - Intronic
1187439656 X:19306812-19306834 AGTGAACTAGGCCAGAGAGGGGG - Intergenic
1187740400 X:22349314-22349336 GGAGCAGTAGGCCAAGGAGCGGG - Intergenic
1189429653 X:40935381-40935403 GGAGAGCTTGGCCAGGATGATGG + Intergenic
1189736469 X:44074670-44074692 GGACTACTAGAGCAGGGAGAAGG + Intergenic
1189969185 X:46400526-46400548 GGATCACTAGGCCTGGGAGGTGG + Intergenic
1190333126 X:49247928-49247950 TGAGAATCAGGCCAGGGTGAGGG + Intronic
1191820391 X:65300077-65300099 GGAGAAAGAGCACAGGGAGAAGG + Intergenic
1192447786 X:71223526-71223548 GGAGAAGCTGGCAAGGGAGATGG + Intronic
1192452401 X:71252547-71252569 GGAGAATCAGGGCTGGGAGAGGG - Intronic
1192633277 X:72793019-72793041 GAAGATCCAGGCCAGGGACACGG - Intronic
1192648432 X:72927782-72927804 GAAGATCCAGGCCAGGGACACGG + Intronic
1193183209 X:78483012-78483034 GGAGAAATAGGCCAAAAAGAAGG + Intergenic
1193682815 X:84542185-84542207 GGAGAACTTGGCCAAGAAAAGGG - Intergenic
1193981419 X:88185974-88185996 GGAGAACTTGGCCAGGATAAAGG - Intergenic
1195333216 X:103823531-103823553 AGAGACCTAGGCCAGGAAGGGGG - Exonic
1195655443 X:107327590-107327612 GGAGATCTATGATAGGGAGAAGG + Intergenic
1195962757 X:110402701-110402723 GGAGGACCAGTCCAGAGAGAAGG + Intronic
1196054153 X:111336906-111336928 GGAGAAGGAGGACAAGGAGAGGG + Intronic
1196054154 X:111336912-111336934 GGAGGACAAGGAGAGGGAGAAGG + Intronic
1196805670 X:119583375-119583397 GGAAAACTTGGCAAGGAAGATGG - Exonic
1198260268 X:134959730-134959752 GGAGACCGAGGAGAGGGAGAGGG - Intergenic
1200775234 Y:7164613-7164635 GGAAAACTAGGAGAGGGAGGAGG - Intergenic