ID: 1143140616

View in Genome Browser
Species Human (GRCh38)
Location 17:4739996-4740018
Sequence CCTCGCGGTGGAGGGTGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143140616_1143140633 29 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140633 17:4740048-4740070 CAGGTACCGGAGGAGTGGGGCGG 0: 1
1: 0
2: 1
3: 26
4: 223
1143140616_1143140627 10 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140627 17:4740029-4740051 CGAAAAGTGGTGGCGGCTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 108
1143140616_1143140630 24 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140630 17:4740043-4740065 GGCTGCAGGTACCGGAGGAGTGG 0: 1
1: 0
2: 2
3: 37
4: 267
1143140616_1143140625 3 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140625 17:4740022-4740044 TTACCTTCGAAAAGTGGTGGCGG 0: 1
1: 0
2: 2
3: 9
4: 85
1143140616_1143140623 -3 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140623 17:4740016-4740038 AGGTATTTACCTTCGAAAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 163
1143140616_1143140631 25 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140631 17:4740044-4740066 GCTGCAGGTACCGGAGGAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 178
1143140616_1143140629 19 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140629 17:4740038-4740060 GTGGCGGCTGCAGGTACCGGAGG 0: 1
1: 0
2: 1
3: 15
4: 200
1143140616_1143140628 16 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140628 17:4740035-4740057 GTGGTGGCGGCTGCAGGTACCGG 0: 1
1: 0
2: 1
3: 33
4: 340
1143140616_1143140632 26 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140632 17:4740045-4740067 CTGCAGGTACCGGAGGAGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1143140616_1143140624 0 Left 1143140616 17:4739996-4740018 CCCGCGCACCCTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1143140624 17:4740019-4740041 TATTTACCTTCGAAAAGTGGTGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143140616 Original CRISPR CCTCGCGGTGGAGGGTGCGC GGG (reversed) Exonic