ID: 1143144119

View in Genome Browser
Species Human (GRCh38)
Location 17:4762587-4762609
Sequence TATTTATTTATTTTGTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126670
Summary {0: 8, 1: 2006, 2: 3325, 3: 6446, 4: 114885}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143144119_1143144123 1 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144123 17:4762611-4762633 ATAAATAGTAAGGAGGCAGGTGG No data
1143144119_1143144127 29 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144127 17:4762639-4762661 AGCGGCACTCCTGCTCTTCTAGG No data
1143144119_1143144122 -2 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144122 17:4762608-4762630 TAAATAAATAGTAAGGAGGCAGG No data
1143144119_1143144121 -6 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144121 17:4762604-4762626 TAAATAAATAAATAGTAAGGAGG No data
1143144119_1143144120 -9 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144120 17:4762601-4762623 AAATAAATAAATAAATAGTAAGG No data
1143144119_1143144124 11 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144124 17:4762621-4762643 AGGAGGCAGGTGGCCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143144119 Original CRISPR TATTTATTTATTTTGTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr