ID: 1143144127

View in Genome Browser
Species Human (GRCh38)
Location 17:4762639-4762661
Sequence AGCGGCACTCCTGCTCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143144119_1143144127 29 Left 1143144119 17:4762587-4762609 CCGTCTCACAAAATAAATAAATA 0: 8
1: 2006
2: 3325
3: 6446
4: 114885
Right 1143144127 17:4762639-4762661 AGCGGCACTCCTGCTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143144127 Original CRISPR AGCGGCACTCCTGCTCTTCT AGG Intergenic
No off target data available for this crispr