ID: 1143145075

View in Genome Browser
Species Human (GRCh38)
Location 17:4769984-4770006
Sequence GGTCTGAGTGGGCCGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143145069_1143145075 -1 Left 1143145069 17:4769962-4769984 CCATTTTCCACATTTCTGTAGTG No data
Right 1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG No data
1143145071_1143145075 -8 Left 1143145071 17:4769969-4769991 CCACATTTCTGTAGTGGTCTGAG No data
Right 1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143145075 Original CRISPR GGTCTGAGTGGGCCGCAAGG AGG Intergenic
No off target data available for this crispr