ID: 1143150157

View in Genome Browser
Species Human (GRCh38)
Location 17:4802555-4802577
Sequence ATGGAGAAGCAGGAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143150148_1143150157 7 Left 1143150148 17:4802525-4802547 CCATTAATTTGGGGGTCCTTTCT No data
Right 1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG No data
1143150141_1143150157 21 Left 1143150141 17:4802511-4802533 CCTATTTTTATGCCCCATTAATT No data
Right 1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG No data
1143150150_1143150157 -9 Left 1143150150 17:4802541-4802563 CCTTTCTGATCCCCATGGAGAAG No data
Right 1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG No data
1143150146_1143150157 9 Left 1143150146 17:4802523-4802545 CCCCATTAATTTGGGGGTCCTTT No data
Right 1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG No data
1143150147_1143150157 8 Left 1143150147 17:4802524-4802546 CCCATTAATTTGGGGGTCCTTTC No data
Right 1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143150157 Original CRISPR ATGGAGAAGCAGGAGGTGGT TGG Intergenic
No off target data available for this crispr