ID: 1143152277

View in Genome Browser
Species Human (GRCh38)
Location 17:4815076-4815098
Sequence GAAGGATGCATGGATGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143152270_1143152277 18 Left 1143152270 17:4815035-4815057 CCTGCCATGGAGGGGGCATGTGT 0: 1
1: 0
2: 1
3: 18
4: 222
Right 1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG 0: 1
1: 0
2: 3
3: 47
4: 376
1143152272_1143152277 14 Left 1143152272 17:4815039-4815061 CCATGGAGGGGGCATGTGTGGTG 0: 1
1: 0
2: 0
3: 24
4: 301
Right 1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG 0: 1
1: 0
2: 3
3: 47
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143152277 Original CRISPR GAAGGATGCATGGATGATGC AGG Intronic
900080397 1:852726-852748 CAAGGGTGTATGGATGAGGCTGG + Intergenic
900792145 1:4687785-4687807 GATGGATGAATGGATGGAGCTGG - Intronic
900930958 1:5737210-5737232 GATGGATGGATGGATGATAGAGG + Intergenic
900989798 1:6093100-6093122 GAAGGAAGGATGGAAGATGCTGG - Intronic
900993133 1:6106987-6107009 GAAGGATGGAGGGATGATGGAGG + Intronic
900993192 1:6107195-6107217 GAGGGATGGAGGGATGATGGAGG + Intronic
900993198 1:6107214-6107236 GAGGGATGGAGGGATGATGGAGG + Intronic
900993246 1:6107412-6107434 GAGGGATGGAGGGATGATGGAGG + Intronic
900993259 1:6107461-6107483 GAGGGATGGAGGGATGATGAAGG + Intronic
900993331 1:6107787-6107809 GAAGAATGAAGGGATGATGGAGG + Intronic
900993338 1:6107817-6107839 GAGGGATGGAGGGATGATGAAGG + Intronic
900993347 1:6107854-6107876 GAGGGATGGAGGGATGATGGAGG + Intronic
900993436 1:6108161-6108183 GAAAGATGGAGGGATGATGGAGG + Intronic
900993483 1:6108372-6108394 GAAGGACGAAGGGATGATGGAGG + Intronic
901587584 1:10310968-10310990 CAGGTATGGATGGATGATGCAGG - Intronic
901700005 1:11040172-11040194 GAAGGATGGATGGATGGGGCTGG + Intronic
901763066 1:11483068-11483090 GCCGGAGGCATGGATGCTGCGGG + Intronic
902289370 1:15426602-15426624 GCAGGAAGCATGAAGGATGCAGG + Intronic
904140395 1:28348516-28348538 GAAGCATGCAGGAGTGATGCAGG - Intergenic
906400248 1:45499264-45499286 GAAGGAATAATGGATGATACGGG + Intronic
910596193 1:88983429-88983451 GGAGGACACATGGATGATGGTGG - Exonic
910814903 1:91281409-91281431 GAAGGAGGCATTGATGAGGGGGG - Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
912195437 1:107392038-107392060 GAAGGAAGAATGGGTGAGGCAGG + Intronic
912560732 1:110549575-110549597 GAAGGAGGCATGAAAGATGCAGG + Intergenic
912602590 1:110952273-110952295 GAAGGAGGCAATGATGACGCTGG + Exonic
913711792 1:121491663-121491685 TAAGGATGTATGCAAGATGCTGG + Intergenic
914351266 1:146842596-146842618 GATGGATGGGTGGATGATGATGG + Intergenic
917470632 1:175323221-175323243 GAAGGAAGCAGGGATGTCGCAGG - Exonic
918133737 1:181651384-181651406 GAAGGATCCAATGATGATGAGGG - Exonic
918463791 1:184801492-184801514 GAAGGATGAAAGGGTGTTGCAGG - Intronic
918508667 1:185285731-185285753 GATGAATGCATGAATGAAGCTGG - Intronic
920570467 1:207012887-207012909 GAAAGATGCTTGGTTGAAGCGGG + Intronic
921447727 1:215266210-215266232 GAAAGATTCATGGATGGTCCAGG - Intergenic
922519957 1:226241227-226241249 TAAGAATGCAGGGATAATGCAGG + Intronic
922792789 1:228319295-228319317 GATGGATGGATAGATGATGAAGG - Intronic
923173265 1:231437282-231437304 CAAGGAAACATGGATGAGGCTGG + Intergenic
923787728 1:237084274-237084296 GAAAGATGCATGGATGAAAGTGG - Intronic
1062943916 10:1445399-1445421 GAAGGATGGATGGATGTAGATGG - Intronic
1063161334 10:3420970-3420992 GAGGGATGCAGGTAGGATGCAGG + Intergenic
1063490673 10:6460820-6460842 GATGGATGGATGGATGGTGATGG - Intronic
1064158872 10:12926157-12926179 AAAGGATCCATGGAGGATGCTGG + Intronic
1065437944 10:25720910-25720932 GAAAGAGGCATTGATGATGGAGG - Intergenic
1065766434 10:29034521-29034543 AAATAATGCATGGATGAAGCTGG + Intergenic
1065966202 10:30772633-30772655 GAAGGAGGAAGGGATGAAGCAGG - Intergenic
1066044237 10:31582210-31582232 GAAAGATGAATGGCTGTTGCTGG + Intergenic
1068901471 10:62274063-62274085 CATGGATACATGGATGATGCCGG + Intergenic
1069161180 10:65094150-65094172 GATGGATGCATGTCTGATGATGG + Intergenic
1069611531 10:69775823-69775845 GAAGGATGCATGGAAGCTGGGGG + Intergenic
1069890694 10:71650669-71650691 TACCGATGCATGGATGATGCTGG + Intronic
1070557740 10:77542124-77542146 GAAGGCTCCATGTATGAAGCAGG + Intronic
1072524516 10:96259490-96259512 AAAGGATGCATGGATTATGGTGG - Intronic
1073467380 10:103702054-103702076 GATAGATGGATGGATGATGGTGG - Intronic
1076102910 10:127797439-127797461 GAAGGATGGATGGAGGGTGAGGG - Intergenic
1076103008 10:127797762-127797784 GGGGGATGGATGGAAGATGCGGG - Intergenic
1076676680 10:132150648-132150670 GATGGATACATGGATTATGGAGG - Intronic
1076676695 10:132150736-132150758 GACGGATACATGGATTATGGAGG - Intronic
1076676699 10:132150758-132150780 GACGGATACATGGATTATGGAGG - Intronic
1076867734 10:133176262-133176284 GATGGATGCATGGTGGATGGGGG + Intronic
1077560565 11:3257747-3257769 GTAGGATGCAGGTAGGATGCAGG - Intergenic
1077669763 11:4146604-4146626 GAAGGCAGCATAGATGATGTGGG + Intergenic
1079112420 11:17612356-17612378 TAAGGATACAGGGAGGATGCAGG - Intronic
1079225813 11:18603781-18603803 GAAGTAAGCAAGGATGATCCTGG + Intergenic
1079238851 11:18708210-18708232 GAAGGCTGCATGGATGCAGAGGG + Exonic
1079264689 11:18919980-18920002 GAAGGAAACATTGAAGATGCAGG + Intergenic
1079268989 11:18964405-18964427 GAAGGAAACATTGAAGATGCAGG + Intergenic
1080156287 11:29115193-29115215 GAAGGATGCAATAATGATCCTGG - Intergenic
1081432002 11:42986508-42986530 GAGGGATGCATGGCTCATTCTGG - Intergenic
1081487551 11:43543579-43543601 GAAAGGTGCATGGAAGATGAGGG - Intergenic
1081583037 11:44365541-44365563 CCAGGATCCATGGAAGATGCTGG - Intergenic
1081858936 11:46320946-46320968 GAAGGACGGATGGATGTTGGTGG - Exonic
1082700524 11:56424265-56424287 AAAAGATGGATGGATGAAGCTGG + Intergenic
1084585739 11:70061110-70061132 GAAGGGTGCATGTATGCTGATGG + Intergenic
1084596272 11:70118787-70118809 GATGGATGAATGGATGCTGAAGG + Intronic
1084596315 11:70118973-70118995 GATGGATGGATGGATGCTGGAGG + Intronic
1085057160 11:73411731-73411753 CAGGGCTGCATGGATGATTCTGG + Intronic
1085406835 11:76268537-76268559 GATGGATGGATGGATGGTGGAGG - Intergenic
1088080506 11:105906380-105906402 GAAGGCTGCATGGAGGAGGTGGG + Intronic
1088222511 11:107584608-107584630 GATGAATGGATGGATGATGAGGG - Intergenic
1088616147 11:111630816-111630838 TAAGGATGCATGGGTGATAAAGG + Intronic
1089227814 11:116940740-116940762 GAGAGATGCATGGATGAAGGAGG - Intronic
1089900059 11:121972614-121972636 GAAGGCTGCATTGAGAATGCAGG - Intergenic
1090415562 11:126537946-126537968 GAATGCTGCATGGGTGGTGCAGG + Intronic
1090995115 11:131859068-131859090 GATGGATGGATGGATGTTGAAGG - Intronic
1091754606 12:3043338-3043360 GATGGATGCATGAATCATCCAGG - Intergenic
1092106722 12:5926538-5926560 GAAGAATGCATGTAGGATGCTGG - Intronic
1093727572 12:22532714-22532736 GAAAGATGCTTTGATCATGCTGG - Intronic
1095170421 12:39028330-39028352 CAGGGATAAATGGATGATGCAGG + Intergenic
1095790636 12:46163527-46163549 GTAGGTTGCCTGGATGAAGCTGG + Intergenic
1097498579 12:60374195-60374217 GAAGGATGAATGAAAGATGCAGG + Intergenic
1097848842 12:64391591-64391613 GAAGAATGAATGGGTGATGCTGG + Intergenic
1100324654 12:93529593-93529615 GGAGGACACATGGATGATGGCGG - Intergenic
1100396244 12:94188691-94188713 GAAGGAGAAATGGATGATACAGG + Intronic
1102856089 12:116295407-116295429 GAGAGATGGATGGATGATGGAGG + Intergenic
1103012758 12:117469907-117469929 GATGGATGAATGGATGATGGAGG - Intronic
1103012827 12:117470379-117470401 GATGGATGGATGGATAATGAAGG - Intronic
1104416076 12:128597525-128597547 GAAGGATGGATGGATTAAGCTGG + Intronic
1104470020 12:129022357-129022379 GAAGGCTGCATGAATGAGGTGGG - Intergenic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1104926016 12:132314170-132314192 GATGGATAAATGGATGATGGTGG - Intronic
1106343917 13:28857830-28857852 GATGGATGGATAGATGATGATGG - Intronic
1106976123 13:35218090-35218112 AAAGGAAACATGGATGATGGGGG + Intronic
1110175585 13:72551786-72551808 GATGGATGGATGGATGATCTTGG + Intergenic
1111360155 13:87165556-87165578 GAAGGATGATTGGATTATGGGGG + Intergenic
1111912461 13:94327938-94327960 GAAGCATGCTTGGATGAAGAAGG - Intronic
1112154356 13:96801104-96801126 GAAGCATTCATGGAGGATGGAGG - Intronic
1112273564 13:97994717-97994739 TTAGAATGCATTGATGATGCAGG + Intronic
1113780181 13:112972316-112972338 GATGGATGGATGGATGATGATGG + Intronic
1113780215 13:112972477-112972499 GATGGATGGATGGATGATGATGG + Intronic
1113862515 13:113497860-113497882 GAAGAACTGATGGATGATGCTGG - Intronic
1115451820 14:33556806-33556828 GAAGGATGGACTGATGAAGCTGG - Intronic
1117186934 14:53249458-53249480 CAGGGAGGAATGGATGATGCTGG - Intergenic
1117412466 14:55463193-55463215 GAAGGATGGATAGATGACGAAGG - Intergenic
1117818809 14:59626839-59626861 GAATGATGAATTGATGATGGTGG + Intronic
1118408191 14:65448234-65448256 GAAGAGTGCTGGGATGATGCAGG + Intronic
1120464247 14:84835855-84835877 GAAATATGAATGGATGATGGGGG + Intergenic
1120784120 14:88515072-88515094 GAAGGATGCGCTGAGGATGCTGG + Intronic
1121335646 14:93076175-93076197 GAAGGATGGATGGAAGAAGAAGG - Intronic
1121739970 14:96244807-96244829 GATGGATGCATGGATGGAGGAGG - Intronic
1122159618 14:99773816-99773838 GAAGGAGGCATCCATTATGCAGG - Intronic
1122958314 14:105083069-105083091 GGTGGATGGATGGATGATGGAGG - Intergenic
1122958336 14:105083150-105083172 GGTGGATGGATGGATGATGGAGG - Intergenic
1123155393 14:106219599-106219621 GGTGGATGCATGGGAGATGCAGG + Intergenic
1123194617 14:106604579-106604601 GAAGGATGGATGCAGGATGTGGG + Intergenic
1202834598 14_GL000009v2_random:68492-68514 GGAGGATGGGTGGATTATGCTGG + Intergenic
1123511394 15:21003391-21003413 GGTGGATGCATGGGAGATGCAGG + Intergenic
1123578226 15:21694162-21694184 GGTGGATGCATGGGAGATGCAGG + Intergenic
1123614851 15:22136644-22136666 GGTGGATGCATGGGAGATGCAGG + Intergenic
1124056197 15:26242870-26242892 GAAGGGTGCATGGGGGAGGCCGG - Intergenic
1124353282 15:28975954-28975976 GAAGGAGGCATGGCTGAGTCAGG - Intronic
1125596854 15:40893038-40893060 GAAGGCTGCATTGAGGCTGCAGG + Intergenic
1128213938 15:65921521-65921543 GAAGGCTCCATGGACCATGCAGG - Intronic
1128681931 15:69658713-69658735 GAAGGATGCATGGATCTGGGAGG + Intergenic
1129739292 15:77982227-77982249 GGAGGGTACATGGATGAGGCAGG + Intergenic
1129846661 15:78770962-78770984 GGAGGGTACATGGATGAGGCAGG - Intronic
1129881100 15:79006447-79006469 GAAGGATGCAGAGGTGATGTGGG + Intronic
1132030882 15:98437850-98437872 GATGGATGGATGGAAGATGGAGG + Exonic
1132214165 15:100050451-100050473 GGAGGATGCAGGGCTGATGGTGG + Intronic
1202987096 15_KI270727v1_random:428407-428429 GGTGGATGCATGGGAGATGCAGG + Intergenic
1133421446 16:5650384-5650406 GCAGGATGCCAGGATGATGGAGG - Intergenic
1133857312 16:9561673-9561695 GAAGAATGAATGCATCATGCTGG - Intergenic
1134182768 16:12061121-12061143 GAAGGCTGCCTGGAAGAAGCAGG - Intronic
1134532804 16:14997791-14997813 GAAGGAGGCAGTGAAGATGCTGG + Exonic
1135618645 16:23933954-23933976 GATGGATGGATGGATGAGGTAGG - Intronic
1135979673 16:27138207-27138229 GGAGGATCCAGGGATGATGCTGG + Intergenic
1136071421 16:27789844-27789866 GATGGATGGATGGATGATGAAGG + Exonic
1137497689 16:48983430-48983452 GAAGGCTGCATGGATGAAGTAGG + Intergenic
1137738680 16:50743080-50743102 GAAGGTGGCAGGGATGATGGGGG - Intronic
1137906993 16:52333360-52333382 GATGGATGAATGGATGAGGAAGG + Intergenic
1138205793 16:55124151-55124173 CAAGGATGGCTGGGTGATGCTGG + Intergenic
1139266619 16:65645775-65645797 GAAGGTGCAATGGATGATGCTGG - Intergenic
1139863232 16:70042943-70042965 GAAGGAGGCAGTGAAGATGCTGG - Intergenic
1139982770 16:70872950-70872972 GATGGATGGGTGGATGATGATGG - Intronic
1140211625 16:72975083-72975105 GAAGGGGGCATGGATTCTGCTGG + Intronic
1140355008 16:74297742-74297764 GAATGATGCCTGGATGATGCCGG + Intronic
1140856759 16:78984856-78984878 GAAGGGTGCATGGAGCGTGCAGG + Intronic
1141028557 16:80569477-80569499 CAGGGATGGAGGGATGATGCTGG + Intergenic
1141115134 16:81302032-81302054 GATGGATGGATGGATGGAGCTGG - Intergenic
1141619791 16:85231035-85231057 GATAGATGGATGGATGATGATGG + Intergenic
1141619824 16:85231212-85231234 GATAGATGGATGGATGATGATGG + Intergenic
1141619852 16:85231369-85231391 GATAGATGGATGGATGATGATGG + Intergenic
1141762686 16:86039017-86039039 GAAGGAGGCCTGGAGGATGCTGG + Intergenic
1142128794 16:88422930-88422952 GATGGGTGGATGGATGATGATGG + Intergenic
1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG + Intronic
1143152310 17:4815242-4815264 GATGGATGGATGGATGATGAAGG + Intronic
1143314280 17:6020093-6020115 GAAGGAGGCATGAAGGATGGTGG + Intronic
1143578306 17:7808072-7808094 GCAAGATGCATGCATGAGGCTGG + Intronic
1144565962 17:16359545-16359567 GTAGGGTGCATGGGTGATACTGG + Intergenic
1145118070 17:20230443-20230465 GAAGGATACACTGATGATGATGG - Intronic
1145246689 17:21274174-21274196 GAAGGCTGCATGGAAGAGACAGG + Intergenic
1145800001 17:27676772-27676794 GAAGGGTGGGTGGAGGATGCTGG + Intergenic
1146626891 17:34441773-34441795 GATGGATGGATGGATGACCCAGG + Intergenic
1148743716 17:49907219-49907241 GAAGGGTGCAGGGAGGAGGCGGG - Intergenic
1148746632 17:49921953-49921975 GATGGATGGATGGATGATGATGG - Intergenic
1150141783 17:62736429-62736451 GCAGAATGCATGAATGATGCAGG + Exonic
1150645762 17:66976571-66976593 AAAGGAGGAATGGAAGATGCAGG - Intronic
1151345700 17:73500121-73500143 GGAGGATGGATGGAGGATGGAGG - Intronic
1151345716 17:73500185-73500207 GGAGGATGGATGGAGGATGGAGG - Intronic
1151345779 17:73500422-73500444 GGAGGATGGATGGAGGATGATGG - Intronic
1151345787 17:73500453-73500475 GGAGGATGGATGGAGGATGGAGG - Intronic
1151345854 17:73500744-73500766 GAAGGATGGATGGAGGATGGAGG - Intronic
1151345880 17:73500859-73500881 GGAGGATGGATGGAGGATGGAGG - Intronic
1151345889 17:73500890-73500912 GGAGGATGGATGGAGGATGGAGG - Intronic
1151978113 17:77493628-77493650 GAGGAAGGCATGGATGAGGCTGG - Intronic
1152042477 17:77913498-77913520 CATGGATGAATGGATGAAGCTGG + Intergenic
1153987686 18:10367976-10367998 GAAGGATGCATTGCTCAGGCTGG + Intergenic
1155539318 18:26850725-26850747 GATGGATGGATGGATGATGGAGG - Intergenic
1155550590 18:26961004-26961026 GAAGAATGTATCGATGTTGCTGG - Intronic
1156471693 18:37381104-37381126 GATGGATGGATGGATGATGGTGG - Intronic
1156826352 18:41434502-41434524 GAAGGAGGGAGGGATGATGTGGG + Intergenic
1157479245 18:48042601-48042623 GCAGCAGGCATGGAGGATGCTGG + Intronic
1157602217 18:48901324-48901346 GATGGATGGATGGATGATGTGGG + Intergenic
1157727784 18:49978182-49978204 GAGGCATGGATGGAGGATGCAGG - Intronic
1159522805 18:69547698-69547720 GAAGGGTGTATGGATGAGGGTGG - Intronic
1159636706 18:70813383-70813405 GATGGATGGATGGATGGTGGTGG - Intergenic
1160502451 18:79408903-79408925 GAATAATGGATGGATGATGATGG - Intronic
1160502474 18:79409032-79409054 GAATAATGGATGGATGATGATGG - Intronic
1160502484 18:79409091-79409113 GATGGATGGATGGATGATGATGG - Intronic
1160502531 18:79409352-79409374 GATGGATGGATGAATGATGATGG - Intronic
1160695418 19:481623-481645 GAAGGATGATTGGAGGATGATGG + Intergenic
1161329089 19:3677952-3677974 GATGGATGGATGGAGGATGGAGG + Intronic
1161449146 19:4334918-4334940 GATGGATGGATGGATTATGGAGG - Intronic
1161486271 19:4537484-4537506 GAAGCATGGATGGATGAAACGGG + Exonic
1161934663 19:7364286-7364308 GAAGGATGGACGGATAATGGAGG + Intronic
1162273841 19:9637647-9637669 TAAGGAAGCATTGATGATGGAGG + Intronic
1162287020 19:9746432-9746454 TAAGGAAGCATTGATGATGGAGG - Intergenic
1162732978 19:12730077-12730099 GATGGATGAATGGATTATGGTGG - Intergenic
1162737195 19:12753325-12753347 GAAGGAGACAGGGATGAGGCTGG - Exonic
1162902867 19:13805632-13805654 GAGGCATGGATGGATGATGGAGG + Intronic
1163429432 19:17258264-17258286 AAAGGAAGCATGGAGGCTGCTGG - Exonic
1163533941 19:17866416-17866438 GAAGGATGAATGGATGGGGTGGG - Intergenic
1164220353 19:23187714-23187736 GAAAGATGCATTAATGATGTAGG - Intergenic
1164382904 19:27750516-27750538 GCAGCTTCCATGGATGATGCAGG + Intergenic
1165404668 19:35622345-35622367 GAAGGAGGCCTGGATGGGGCTGG + Intronic
1165593174 19:36988500-36988522 GAAGGAAGCAGGGAAGGTGCGGG + Intronic
1165726078 19:38113938-38113960 ACAGGCTGCAGGGATGATGCGGG - Intronic
1166202665 19:41248619-41248641 GAAGGATGTGTGTATGCTGCCGG - Intronic
1166346679 19:42170752-42170774 GCAGGATGCATGGTGGATCCAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166892082 19:46000036-46000058 GAAGCAAGGATGGAGGATGCAGG + Intronic
1167172540 19:47842916-47842938 GAAGGATGCATGCAAGGTTCTGG + Exonic
1202638097 1_KI270706v1_random:59202-59224 GGAGGATGGGTGGATTATGCTGG - Intergenic
925083464 2:1089036-1089058 GAAGGCTGCAAGGATGAACCAGG + Intronic
926707856 2:15849340-15849362 GAAGGAGGGATGGAGGATGAGGG + Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
927368599 2:22328363-22328385 GAGAGATGCATGGATTATACTGG - Intergenic
928142711 2:28744468-28744490 CATGGATGCATGGATGGAGCTGG + Intergenic
928875322 2:36031933-36031955 GAAGGATAAATTGATGATGCAGG - Intergenic
929055138 2:37870034-37870056 GATGGCAGCAGGGATGATGCAGG + Intergenic
929442805 2:41978699-41978721 GGAGGATGGATGGATCATGGGGG - Intergenic
929683550 2:44015231-44015253 GAAGGTTTCATGGAGGAGGCAGG + Intergenic
930008675 2:46917398-46917420 GATGGATGAATGGCAGATGCAGG - Intronic
931203391 2:60123125-60123147 GAAGGATAAAATGATGATGCAGG - Intergenic
933067618 2:77818190-77818212 GAAGGAAGGAAGGAAGATGCTGG - Intergenic
933161125 2:79026291-79026313 GAAGGAAGGAGTGATGATGCAGG - Intronic
937826557 2:126373394-126373416 GAATGATGCCAGAATGATGCCGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938926346 2:136046470-136046492 GAAGGTTTCATGGAAGATGGAGG - Intergenic
940331470 2:152479693-152479715 GATGGATTCATGGATGTTGTGGG + Intronic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942135482 2:172920821-172920843 GATGGATGAATGGATGATTTGGG + Intronic
942206110 2:173621148-173621170 GATGGATGGATGGATGATGCAGG + Intergenic
943937704 2:193943363-193943385 GAAGGAGGCAGGGAGGAGGCAGG + Intergenic
946043031 2:216798703-216798725 GAAAGATGGTTGGATGATCCAGG + Intergenic
946748647 2:222870964-222870986 GAAGGATGCATTGATGGAGGAGG + Intronic
948353368 2:237358922-237358944 GAAGGCTGCCTGGAGGAAGCGGG + Intronic
1170498778 20:16953120-16953142 AAAGGAAGCTTGGATGCTGCTGG - Intergenic
1171094165 20:22315729-22315751 GAAGGAAGCATGAATGGAGCTGG - Intergenic
1172107518 20:32525513-32525535 GAAGGTTGCATGCATGAAGCAGG - Intronic
1172216492 20:33239345-33239367 AGTGGATGAATGGATGATGCAGG - Intronic
1172780844 20:37436256-37436278 GACGGATGGATGGATGATGGGGG - Intergenic
1172780862 20:37436324-37436346 GACAGATGGATGGATGATGGGGG - Intergenic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1172972997 20:38887083-38887105 GGCAGATGCATGGATGATGGTGG + Intronic
1172973002 20:38887109-38887131 GATGGATGAATGGATGCTGGTGG + Intronic
1173142949 20:40500269-40500291 GAAGGATGGATAGATGGGGCAGG - Intergenic
1173411249 20:42811295-42811317 GACGGATGGATGGATGAGGATGG + Intronic
1174172410 20:48625738-48625760 GAAGGAGGCAGGGAGGACGCTGG + Exonic
1174296445 20:49548619-49548641 GATGGATGGATGGATGCTGTTGG + Intronic
1174306812 20:49619254-49619276 GATGGATAGATGGATGATGAGGG + Intergenic
1174356022 20:49998365-49998387 GGAGGAGACAAGGATGATGCCGG + Intergenic
1174520581 20:51127239-51127261 GAAGGCAGCCAGGATGATGCAGG + Intergenic
1175181282 20:57149316-57149338 GCAGGAAGCAATGATGATGCAGG + Intergenic
1175236841 20:57519785-57519807 GAAGGATGCAGAGATGGGGCGGG - Intronic
1175385676 20:58593494-58593516 GAATGATGGATGGATGAAGAAGG + Intergenic
1175754125 20:61518593-61518615 GATGGATGAGTGGATGATGATGG - Intronic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1176129825 20:63492026-63492048 GATGGATGGATGGATGATGGAGG + Intronic
1177325477 21:19582897-19582919 AAAGGATGGATGGAGGATGGAGG - Intergenic
1177876367 21:26636804-26636826 GAAGGGGGCATTAATGATGCTGG - Intergenic
1178245170 21:30943686-30943708 GAGGGCTTCATGGATGATGTAGG - Intergenic
1180218775 21:46344639-46344661 GAAAGGTGCCTGGCTGATGCAGG + Intronic
1180363871 22:11922678-11922700 GGAGGATGGGTGGATTATGCTGG + Intergenic
1181671201 22:24426345-24426367 GATGGATGGATGGATGAAGGCGG + Intronic
1181742954 22:24935931-24935953 GATGGATGAATGGAAGATGAGGG - Intronic
1182528361 22:30936191-30936213 GAAGGATGTATGGTTAATGATGG + Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182973125 22:34596288-34596310 GAAGGATTCATGGATGAGTGGGG + Intergenic
1183426434 22:37741894-37741916 TCAGGATGCATGGAGGTTGCGGG + Intronic
1183536104 22:38402314-38402336 GAAGGCTGCCTGGAGGAGGCAGG + Intergenic
1183635305 22:39058546-39058568 TAAGGAGGCATTGATGATGGAGG + Intronic
1183792304 22:40082456-40082478 GAAGAATGGATAGATGATGTTGG + Intronic
1184460795 22:44636777-44636799 GGTGGATGGATGGATGATGGTGG + Intergenic
1184460825 22:44636904-44636926 GGTGGATGGATGGATGATGGTGG + Intergenic
1184460902 22:44637253-44637275 GGTGGATGGATGGATGATGGTGG + Intergenic
1185104342 22:48858846-48858868 GATGGTTGGATGGATGATGGAGG - Intergenic
1185104359 22:48858912-48858934 AATGGATGAATGGATGATGGAGG - Intergenic
1185104367 22:48858947-48858969 GATGGATGGATAGATGATGGAGG - Intergenic
1185104389 22:48859045-48859067 GATGGATGAATGGATGATTGGGG - Intergenic
1185104448 22:48859288-48859310 AATGGATGGATGGATGATGGAGG - Intergenic
949584870 3:5427695-5427717 GAAAGCTGCATGGAGGAGGCTGG + Intergenic
949831980 3:8224515-8224537 GAAGGATGCCAGGATAATTCTGG + Intergenic
949845202 3:8362646-8362668 GATGGATGGATGGAGGATGGAGG + Intergenic
950146230 3:10651780-10651802 GATGGATGAATGGATGAAGGTGG + Intronic
955361981 3:58283534-58283556 AGAGGATGCCTGGATAATGCAGG + Intronic
956471303 3:69570058-69570080 AAAGTGTCCATGGATGATGCTGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960963690 3:123090137-123090159 CAGGGATGCCTGGAGGATGCAGG - Intronic
963879040 3:150506765-150506787 GTAGGGTACATGGATGAAGCTGG - Intergenic
967481929 3:189982549-189982571 GTAGGATGCATGGATGTAGAGGG - Intronic
967582331 3:191173782-191173804 GTAGGATGAGTGGAGGATGCAGG - Intergenic
968029258 3:195469036-195469058 GAAAGAGTGATGGATGATGCTGG + Intergenic
968634843 4:1672544-1672566 GCAAGATGCATCCATGATGCTGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969439755 4:7210058-7210080 GAAGGATGCATGTGTGATGGGGG + Intronic
969510331 4:7614091-7614113 GATGGATGAATGGATGGTGATGG - Intronic
969523055 4:7689961-7689983 GGATGATGGATGGATGATGGTGG + Intronic
970140441 4:12976376-12976398 GAAGGATGACTGGCTAATGCTGG - Intergenic
970348062 4:15173350-15173372 GAAGGCTTCATGGCTGAGGCAGG - Intergenic
972315877 4:37925217-37925239 GCATGCTGCATGGATGGTGCAGG + Intronic
973199014 4:47478769-47478791 GTAGGGAGCATGGTTGATGCTGG - Intergenic
973368316 4:49225549-49225571 GAAGGATGGGTGGATTATGCTGG - Intergenic
976286169 4:83373354-83373376 GAAGGGTGCATGCCTGCTGCTGG - Intergenic
977507178 4:97916718-97916740 GAAGGATGCAGTGAGGAAGCTGG - Intronic
977894232 4:102345639-102345661 GAAGAGGGCATGGCTGATGCTGG - Intronic
980224965 4:129970984-129971006 GAAGCATGGATGGAGGATGGAGG - Intergenic
980714748 4:136614885-136614907 TAAGGAAGCATTGATGATGGAGG - Intergenic
1202765425 4_GL000008v2_random:145059-145081 GGAGGATGGGTGGATTATGCTGG - Intergenic
985908910 5:2863939-2863961 GAGGGAGGCCTGGATGATGTCGG - Intergenic
985965311 5:3335250-3335272 GAGGGACGTATGGAGGATGCAGG - Intergenic
989531022 5:42508347-42508369 TAAGGAAGCATGGAGGAGGCAGG + Intronic
989966106 5:50467459-50467481 TAAGGATGTATGCAAGATGCTGG - Intergenic
990474029 5:56144255-56144277 GAAGAATGCACGTAGGATGCTGG + Intronic
992424341 5:76640661-76640683 CAGAGATGTATGGATGATGCTGG - Intronic
993856949 5:93087931-93087953 GAAAGAAGCATGCATGATACTGG - Intergenic
995856237 5:116595621-116595643 GAATGATGAATGGATTCTGCAGG + Intergenic
996292353 5:121867025-121867047 GAAGGATAAATGGCTGATGGAGG - Intergenic
997197941 5:131992087-131992109 GAAGGATGGATGGGGGTTGCCGG + Intronic
997466327 5:134090398-134090420 GAAGGGTGCGTGGATGGTGAGGG + Intergenic
1001551350 5:172604279-172604301 GATGGCAGCACGGATGATGCTGG - Intergenic
1002298597 5:178245294-178245316 GATGGATGGATGGATGATGATGG - Intronic
1002298669 5:178245646-178245668 GATGGATGAATGCATAATGCAGG - Intronic
1003056353 6:2824361-2824383 TAAGATTGCATGGATGAGGCTGG - Intergenic
1003416099 6:5909767-5909789 GGAGGATCCATGGAGGAAGCAGG - Intergenic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006732695 6:36247982-36248004 GAAGGACACATGGGTGCTGCTGG + Intronic
1006947228 6:37792832-37792854 CAAGGATGCGCAGATGATGCTGG - Intergenic
1008171603 6:48214390-48214412 GGAGGACACATGGATGATGGTGG - Intergenic
1009246256 6:61242353-61242375 AAAGGATGCTTGGATTATGCAGG + Intergenic
1010275598 6:73965295-73965317 AAAGGAAACATGGAGGATGCAGG + Intergenic
1018056023 6:160053116-160053138 AAAAGAAGCATGGATGAAGCTGG + Intronic
1018095727 6:160385646-160385668 GAAGGCTGCAGGGAGGATTCTGG - Intronic
1019055224 6:169218693-169218715 GATGGATGGATGGATGAGACAGG + Intronic
1021775382 7:24049544-24049566 GTAGAAAGGATGGATGATGCGGG + Intergenic
1022567207 7:31415599-31415621 GAGGGAGGCATGCATAATGCGGG + Intergenic
1022797431 7:33743203-33743225 GCTGGATTCATGGATGATGCTGG + Intergenic
1023553044 7:41389284-41389306 GATGGATGGATGGAGGATGTGGG + Intergenic
1024710281 7:52007776-52007798 GAAGGCAGCGTGGATGAGGCTGG + Intergenic
1026513013 7:71043023-71043045 GAAGGATGAAGAGATGATTCTGG + Intergenic
1026621395 7:71952790-71952812 GAAGGATGCAGGGATCCTACAGG - Intronic
1030357023 7:108554673-108554695 GATGGATGGATGGATGATGCAGG - Intronic
1030464447 7:109882229-109882251 GAAGGAAGAGTGGATGATGTGGG + Intergenic
1032971150 7:137165378-137165400 GAAGGATGTATGGAAGTTGGTGG - Intergenic
1033417952 7:141180950-141180972 GATGGATGAATGGATGTTGATGG - Intronic
1034476738 7:151289030-151289052 GAGGGAAACATTGATGATGCTGG + Intergenic
1034553089 7:151833464-151833486 GAAGTCTGCAGGGATGGTGCGGG + Intronic
1035220837 7:157405733-157405755 GGAGGAAGAATGGATAATGCTGG + Intronic
1035278863 7:157765059-157765081 TATGGATGCATGGATGATGGAGG - Intronic
1035278923 7:157765323-157765345 GATGGGTGGATGGATGATGGAGG - Intronic
1035391650 7:158508410-158508432 GGAGGATGCATGGATCATCAGGG + Intronic
1035525118 8:306183-306205 CAAGGGTGTATGGATGAGGCTGG - Intergenic
1036602503 8:10274757-10274779 GATGGCTGAATGGATGATGGTGG - Intronic
1037754426 8:21701998-21702020 GAAGGGTGCATGCAGGAGGCTGG + Intronic
1037913263 8:22756891-22756913 GCAGGTTCCCTGGATGATGCTGG + Intronic
1038037588 8:23699648-23699670 GAAGGCTACATGGAGGATGGGGG - Intergenic
1038054943 8:23849368-23849390 AAAGGTTGCATGGAAGATTCCGG + Intronic
1039318257 8:36397628-36397650 AGAGGAGGCATGTATGATGCTGG - Intergenic
1039847647 8:41337119-41337141 CAAGGCTGCAGTGATGATGCAGG - Intergenic
1040584580 8:48727131-48727153 GAAGGATGGATGGGTGATGTGGG - Intronic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043291994 8:78613421-78613443 GAGGGATGCATAAATAATGCTGG + Intergenic
1044725703 8:95192671-95192693 GAAGGCAGCATGAATGGTGCTGG - Intergenic
1045057857 8:98384798-98384820 AAAGGATTCAAGAATGATGCTGG - Intergenic
1045329554 8:101143364-101143386 GGAGCATGCATGGAGAATGCTGG + Intergenic
1045666991 8:104498516-104498538 GCTGGATGGATGGATGAAGCTGG - Intronic
1045758636 8:105575365-105575387 GAAGGCTCCGAGGATGATGCAGG + Intronic
1047306795 8:123659154-123659176 GATGGATGAATGGATGATGATGG - Intergenic
1047306941 8:123660012-123660034 GATGAATGGATGGATGATGATGG - Intergenic
1047522239 8:125603702-125603724 GATGAATGAATGTATGATGCAGG + Intergenic
1049042195 8:140120935-140120957 GATGGTTGAATGGATGATGTTGG - Intronic
1049303739 8:141885957-141885979 GAATGATGAATGGATGAGGGAGG + Intergenic
1049348211 8:142150198-142150220 AATGGATGGATGGATGATGGTGG + Intergenic
1049375088 8:142285530-142285552 GAGGGATAGATGGATGATGGGGG + Intronic
1049831013 8:144700665-144700687 GAAGGATGCAGGGGCGAGGCCGG + Intergenic
1050662052 9:7893338-7893360 GAAGGATGAATAGAAGTTGCAGG + Intergenic
1051340364 9:16104650-16104672 AATGGATGGATGGATGATGATGG - Intergenic
1051508905 9:17856076-17856098 GAAGGATCCAAGGCTGAGGCCGG - Intergenic
1053199960 9:36145577-36145599 GATGTATGGATGAATGATGCTGG + Intronic
1053199980 9:36145694-36145716 GATGGATGGATGGAGGATGTTGG + Intronic
1053199982 9:36145716-36145738 GATGGATGTATAGATGATGTTGG + Intronic
1056084726 9:83135193-83135215 TAAAAATGCATGGATGAAGCTGG + Intergenic
1056246435 9:84700013-84700035 GGAGGATGCAAGGATAATCCAGG + Intronic
1056708647 9:88972254-88972276 GAATGCTACATGTATGATGCAGG - Intergenic
1059959464 9:119551200-119551222 CAAGGATGCATGGCTGGTGAAGG - Intergenic
1060748596 9:126154152-126154174 GAAGGATGGATGGATGAAGGAGG + Intergenic
1061417545 9:130455298-130455320 GATGGATGGATGGATAATGAAGG - Intronic
1061868659 9:133508337-133508359 GAAGGCTGCCTGGAAGAGGCAGG - Intergenic
1061980965 9:134103440-134103462 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981005 9:134103627-134103649 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981024 9:134103717-134103739 GAAGGATGGATGGATGGTGGTGG - Intergenic
1061981097 9:134104055-134104077 GATGGATGAATGGATGGTGATGG - Intergenic
1061981118 9:134104149-134104171 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981124 9:134104171-134104193 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981131 9:134104197-134104219 GATAGATGAATGGATGATGATGG - Intergenic
1061981160 9:134104341-134104363 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981189 9:134104449-134104471 GATGGATGAATGGATGATGATGG - Intergenic
1061981225 9:134104617-134104639 GATGGATGGATGGATGGTGGTGG - Intergenic
1062092443 9:134685504-134685526 GATGGATGGATGGATGGTGATGG - Intronic
1062092517 9:134685847-134685869 GGACGATGGATGGATGATGATGG - Intronic
1203546170 Un_KI270743v1:129948-129970 GGAGGATGGGTGGATTATGCTGG - Intergenic
1185624841 X:1474260-1474282 GGAGGATGAATGGATGAGGATGG + Intronic
1186075842 X:5877387-5877409 GAAGGCTGAATGGATAATGGAGG - Intronic
1186215472 X:7295784-7295806 GAAGGTTGCATGGATTAAGGAGG + Intronic
1186742273 X:12530924-12530946 GATGGATGTATGGATAATGTTGG + Intronic
1187226793 X:17380781-17380803 GAAGGGTGAATTGATGATCCTGG + Intronic
1187925407 X:24245166-24245188 GAAGGATGAATGGATGTGGGTGG - Intergenic
1189242024 X:39532677-39532699 GAAGGATGCAGGGAGGCTTCTGG + Intergenic
1192271039 X:69579675-69579697 GAAAGATGAAAGTATGATGCTGG - Intergenic
1193298331 X:79858347-79858369 GGAGGATGAATGGAAGGTGCTGG + Intergenic
1195292634 X:103443945-103443967 GATGGAAGAATGGATGAAGCAGG - Intergenic
1195745313 X:108111601-108111623 GAAGGCTTCATGGAGGAAGCAGG - Intronic
1198006367 X:132498616-132498638 GAAGGATGGCTAAATGATGCTGG + Intergenic
1200024060 X:153240232-153240254 GGAGGATGCATGGATGTAGGAGG - Intergenic