ID: 1143152632

View in Genome Browser
Species Human (GRCh38)
Location 17:4816877-4816899
Sequence CTGGACTCCTTGGGACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143152632_1143152647 29 Left 1143152632 17:4816877-4816899 CCCAAGTGTCCCAAGGAGTCCAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1143152647 17:4816929-4816951 CCCCCCAGATTTCATTGACAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1143152632_1143152640 5 Left 1143152632 17:4816877-4816899 CCCAAGTGTCCCAAGGAGTCCAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1143152640 17:4816905-4816927 ACATCTCCCCTGACTCTCCTGGG 0: 1
1: 1
2: 2
3: 23
4: 215
1143152632_1143152639 4 Left 1143152632 17:4816877-4816899 CCCAAGTGTCCCAAGGAGTCCAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1143152639 17:4816904-4816926 GACATCTCCCCTGACTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 187
1143152632_1143152645 28 Left 1143152632 17:4816877-4816899 CCCAAGTGTCCCAAGGAGTCCAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1143152645 17:4816928-4816950 ACCCCCCAGATTTCATTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143152632 Original CRISPR CTGGACTCCTTGGGACACTT GGG (reversed) Intronic
900851836 1:5149934-5149956 CTGGGCTACTTGTGACTCTTTGG - Intergenic
901450495 1:9333764-9333786 GTGGGCTCCTTGGGTCTCTTTGG - Intronic
905545256 1:38792700-38792722 CTGAACTCCCAGGGAAACTTGGG + Intergenic
906244463 1:44263251-44263273 CTGACCTCCTTGGGTCGCTTGGG - Intronic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908823446 1:68112003-68112025 GTGCCCTCCTTGGGACACTCTGG + Intronic
912017348 1:105058838-105058860 CTGGAGTCAGTGGTACACTTAGG + Intergenic
913029365 1:114883530-114883552 CTAGGCTCCTGGGGAAACTTAGG + Intronic
913067861 1:115273332-115273354 CTGGACTCCTAAGGCCACCTCGG + Intergenic
914471457 1:147982173-147982195 CTGAGCTACTTGGGACACTGAGG - Intronic
915083130 1:153365726-153365748 CTGCATTCCGTGGGACACTCAGG - Intergenic
915641564 1:157231212-157231234 CTGGCTTCCCTGGGTCACTTTGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
920458074 1:206116319-206116341 CTGGACTGCTGGGCAGACTTCGG - Exonic
921037002 1:211389831-211389853 CTGAACACTTTGGGAGACTTAGG + Intergenic
924574115 1:245263662-245263684 CTAGACCCCTTGGGAGACATGGG + Intronic
1062844658 10:695206-695228 CTGGACTCCCTGGATCACTGTGG - Intergenic
1063069936 10:2651271-2651293 CTGTTCTTCTTGGGAGACTTGGG - Intergenic
1063965094 10:11340439-11340461 CTGGAGCACTTGGGCCACTTTGG - Intergenic
1063972215 10:11389110-11389132 CTGCAGTCCTTGGGGCTCTTGGG + Intergenic
1064253182 10:13722540-13722562 CTGGCCTCATTGGGACCCTCTGG + Intronic
1067538967 10:47137938-47137960 CTGATTTCCTTGGGACACCTGGG + Intergenic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1070727944 10:78804774-78804796 CTGGCTTCCTAAGGACACTTTGG - Intergenic
1072660897 10:97362970-97362992 GTGGAGTCATTGGGACAGTTTGG - Intronic
1072661513 10:97366447-97366469 CAGGACTCGTTGGGCCACCTTGG + Exonic
1072729335 10:97834654-97834676 CTGGATTCTTAGGGACACTGGGG + Intergenic
1073445581 10:103578433-103578455 CTGGGTTCCTTGGAACACTGGGG + Intronic
1073942758 10:108716696-108716718 CCAGAATCCTTGGGACACTCTGG - Intergenic
1075123070 10:119678500-119678522 CTAGACTCCAAGGAACACTTTGG - Intergenic
1075877664 10:125821955-125821977 CTGGGCTCCTGGGGACCTTTAGG + Intronic
1076224688 10:128764707-128764729 TTGGAAGACTTGGGACACTTTGG + Intergenic
1078901855 11:15649946-15649968 CTGGACCCCTGGGGACACAGGGG - Intergenic
1081045105 11:38264393-38264415 CTGGAATCCTTTGGCCACTGAGG + Intergenic
1081681540 11:45009131-45009153 CTGCCCTCCTTGGTACATTTAGG + Intergenic
1083125790 11:60564436-60564458 CTGGACTTCCTGGGTCACATGGG + Intergenic
1084198773 11:67541537-67541559 CTGGACTCCTTGGACCACAGTGG + Intergenic
1084801348 11:71546313-71546335 CTGGACTTCTTGGGTCCCGTGGG - Intronic
1085034508 11:73292019-73292041 CTGGCCTCCCTGGGACAGTGAGG + Intronic
1086099474 11:83083793-83083815 CTGGCTTCCTTGGGCCACATTGG + Intergenic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1088218535 11:107541378-107541400 CTGGACTAGTTGGGGGACTTGGG - Intronic
1088795215 11:113261713-113261735 CTGGCCTTCATGGGACACTTAGG + Intronic
1088930545 11:114347155-114347177 CTGGACTCCTTGGGTCAATAGGG - Intergenic
1089354810 11:117842627-117842649 CTGGGCCCCTTGGGACATTAGGG - Intronic
1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG + Intronic
1091223935 11:133946602-133946624 CTGGACTCCTTGTAATTCTTGGG - Intronic
1091502339 12:1030603-1030625 CTGTACTACTTGGGAGACTGAGG + Intronic
1095662323 12:44751871-44751893 CTGGATTCCCTGGGCCACATTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1102988111 12:117294847-117294869 ATGGCCTCCTTTGCACACTTAGG - Intronic
1103705393 12:122868438-122868460 GTGGAATCCTTGGGGCGCTTTGG - Intronic
1103806077 12:123574160-123574182 TTGGCCTCCTTGGGCCAGTTTGG - Intergenic
1104633196 12:130422133-130422155 ATGGGCTCCCTGGGACACTCAGG - Intronic
1104648462 12:130513891-130513913 CTGGATCCCTGGAGACACTTGGG - Intronic
1105544355 13:21340822-21340844 CTGGGCCACTGGGGACACTTGGG - Intergenic
1105816235 13:24038835-24038857 GTGGAATCCTGGGGACTCTTAGG + Intronic
1106674812 13:31947414-31947436 CTGAGCTCCTTGGTACCCTTAGG - Intergenic
1108742371 13:53351282-53351304 CTAGTCTCCTTCTGACACTTGGG + Intergenic
1108893474 13:55293652-55293674 CTTGACTCCTAGGGAGGCTTTGG - Intergenic
1115725256 14:36207709-36207731 TTGGATTCATTGGGCCACTTTGG + Intergenic
1118161432 14:63294493-63294515 ATGGACTCCTTGGGCTATTTTGG + Intergenic
1118326178 14:64782739-64782761 TTGGCTTCCCTGGGACACTTTGG + Intronic
1118737021 14:68708474-68708496 CTGGCCTTCTTGGGACTCTCTGG + Intronic
1122299680 14:100724658-100724680 CTGGACTGCATGGAGCACTTAGG - Intergenic
1122794367 14:104198624-104198646 CTGGACTCCCTGGGCAACCTTGG - Intergenic
1124353183 15:28974494-28974516 CGAGACTACTTGGAACACTTAGG + Intronic
1128914128 15:71544156-71544178 CTGGACTCCTTGACACACCCTGG - Intronic
1132861602 16:2074470-2074492 CAGGACTCCTTGGGGAACCTGGG + Intronic
1139578731 16:67859093-67859115 CTGTAATCCCTCGGACACTTTGG - Intronic
1139582586 16:67882207-67882229 CCAGACTCCTTGAGACACCTGGG - Exonic
1141689315 16:85587508-85587530 CTGGGCTCCTGGGGACACAGCGG + Intergenic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1143205047 17:5135490-5135512 CTGGACTCCTGGTGTCACCTGGG + Intronic
1144132372 17:12259325-12259347 GTAGGGTCCTTGGGACACTTTGG - Intergenic
1144338752 17:14296273-14296295 CGGGTCTTCTGGGGACACTTAGG + Intergenic
1144876090 17:18398180-18398202 CTGGACTCCTGGTGTCACCTGGG + Intergenic
1144887385 17:18472568-18472590 CTGGACTCCTCTGGGCACTGGGG - Intergenic
1145144832 17:20471726-20471748 CTGGACTCCTCTGGGCACTGGGG + Intergenic
1145156138 17:20546240-20546262 CTGGACTCCTGGTGTCACCTGGG - Intergenic
1145760717 17:27424221-27424243 CTGGACTCCTGGTGTCACCTGGG + Intergenic
1146160772 17:30558487-30558509 CTGGACTCCTGGTGTCACCTGGG + Exonic
1146354095 17:32119656-32119678 CTGGACTCCTCTGGGCACTGGGG - Intergenic
1147067567 17:37930706-37930728 CTGGACTCCTGGTGTCACCTGGG + Intronic
1147074707 17:37982798-37982820 CTGGACTCCTGGTGTCACCTGGG - Intronic
1147079096 17:38010261-38010283 CTGGACTCCTGGTGTCACCTGGG + Intronic
1147086230 17:38062337-38062359 CTGGACTCCTGGTGTCACCTGGG - Intronic
1147095035 17:38134203-38134225 CTGGACTCCTGGTGTCACCTGGG + Intergenic
1147102176 17:38186302-38186324 CTGGACTCCTGGTGTCACCTGGG - Intergenic
1148492275 17:48030960-48030982 CTGGACTGCCTGGGGCACTAAGG - Intronic
1149846764 17:60012813-60012835 CTGGACTCCTGGTGTCACCTGGG - Intergenic
1150009032 17:61487923-61487945 CTGTACTCCTGGGGGCACTGGGG - Intergenic
1150085112 17:62269387-62269409 CTGGACTCCTGGTGTCACCTGGG - Intergenic
1157433759 18:47651689-47651711 CTGGACTGGCTGGGACACGTTGG - Intergenic
1159468500 18:68817273-68817295 CAGAACTCAGTGGGACACTTGGG + Intronic
1160007008 18:75075196-75075218 CTGCACTCCTGGGGACAGTGGGG + Intergenic
1160481511 18:79245036-79245058 CTGGGCTCCTAGGGACCCTGAGG + Intronic
1161299455 19:3535840-3535862 CTGGACCCCTTGGGTCTCCTTGG - Intronic
1162403223 19:10458441-10458463 CTGGACTGTTGGGGACACTATGG - Intronic
1163041949 19:14609235-14609257 CTGGACCCCTTGTGACAAGTTGG + Intronic
1163183851 19:15622745-15622767 CTGGACTCTATGGGACTCTATGG + Intronic
1163551685 19:17969099-17969121 CTGGAGTCCCTGGGACCCTCAGG - Intronic
1166755400 19:45187536-45187558 CTGGTCTCCTTGGGACTGTTGGG + Intronic
925655628 2:6145086-6145108 TTGCACTGCCTGGGACACTTAGG + Intergenic
926967707 2:18433334-18433356 CTGGATGCCCTGGGTCACTTAGG + Intergenic
933629528 2:84640002-84640024 CTTGACTCCTCGGGAAACTAAGG + Intronic
935545554 2:104396219-104396241 CTGGCCTCCTGGGGACACAAGGG - Intergenic
935761022 2:106320825-106320847 CTGGACTTCTTGGGTCAAGTGGG - Intergenic
940168262 2:150799156-150799178 CTGGAATCCTTGGGACTGTCAGG - Intergenic
941601167 2:167545564-167545586 CTGGACTTCCTGGGACAATAGGG - Intergenic
948145446 2:235704822-235704844 CTGGACACAGCGGGACACTTGGG - Intronic
1169701577 20:8453228-8453250 CTGGAACCCATGGGACACTTTGG - Intronic
1170860514 20:20098792-20098814 CTTGACTTCTTCGGACACTTAGG - Exonic
1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG + Intergenic
1173616148 20:44404039-44404061 CTGCACTCCTGGGGACACCTGGG + Intronic
1173987496 20:47273293-47273315 CTGGACACCTCGGGAGACTGAGG + Intronic
1175872492 20:62215111-62215133 CTGCACGCCTTGGGACCCTCGGG + Exonic
1178989025 21:37336288-37336310 CTGTAGTCCTTGGGAGACTGAGG - Intergenic
1179602103 21:42486115-42486137 CTCCACTCCCTGGGACTCTTGGG + Intronic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1183430533 22:37763002-37763024 CAGGACACCTTGGGCCACTCAGG + Intronic
1185249457 22:49792424-49792446 CTGGACTCCTGGGCACAATGGGG + Intronic
1185424135 22:50755062-50755084 CTGGATTTCTTAGGATACTTAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953559898 3:43979471-43979493 ATGGACTTCTTGGGCCACTTCGG - Intergenic
954134302 3:48575088-48575110 CTGGACTCCCTGGAACCCCTGGG - Exonic
955542884 3:59996617-59996639 CTGGAGCCCTTTGGACTCTTTGG - Intronic
957286124 3:78219546-78219568 CTGGCCTCCATGTGACAGTTGGG - Intergenic
962393100 3:134990625-134990647 CAGGACTCCTGGGGATACTGGGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974169650 4:58250210-58250232 CTGGACTCCTTGAGAGACAGGGG - Intergenic
974887270 4:67834906-67834928 GTCCACTCCATGGGACACTTGGG + Intronic
976294082 4:83452324-83452346 TTGGCTTCCTTGGGCCACTTTGG - Intronic
976590992 4:86849877-86849899 CTGGCCTCCTAGGGACATCTGGG + Intergenic
977278751 4:95011901-95011923 CTGAACTACTTGGGAAACTAGGG + Intronic
985782053 5:1876604-1876626 CCGTAGTCCTTGGGACACCTGGG + Intergenic
996400918 5:123061522-123061544 CAGGAATCCTTGGGATAATTGGG + Intergenic
998049476 5:139020045-139020067 CTGGGCTTCCTGGGAGACTTTGG + Intronic
998424371 5:142013998-142014020 CCAGACTTCTAGGGACACTTGGG + Intergenic
999418496 5:151420321-151420343 CTGAATGCCTTGGGTCACTTTGG + Intergenic
1004536245 6:16505171-16505193 CTGGACACCTAGGCACACATGGG + Intronic
1006501091 6:34459280-34459302 ATGGACTCACTGGGACCCTTGGG + Intergenic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1010104151 6:72148246-72148268 CTTGAATCATTGGGACTCTTTGG - Intronic
1010143331 6:72636946-72636968 CTTGACCCCTTGGGAAACTTTGG + Intronic
1010730682 6:79387603-79387625 CTGGACTTCTTGAGGCAATTGGG + Intergenic
1013469859 6:110453579-110453601 CTGGACTCATTGTGGGACTTGGG - Intronic
1013888263 6:114997833-114997855 CTGGACTCCCTGGGTCAATACGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018958256 6:168427825-168427847 CTGGGCTCCCTGGCACAGTTTGG - Intergenic
1022470497 7:30679167-30679189 CTGGACTTCTGGGGACAGGTTGG - Intronic
1024624006 7:51188608-51188630 CTCTACTCCTTTGGACATTTTGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026426452 7:70299242-70299264 CCAGACTCTTTGGGACATTTAGG + Intronic
1026901518 7:74040002-74040024 CTAGAATCCTTGGGGCATTTGGG + Intronic
1029090028 7:98040770-98040792 CTGTACTCCTTGGGAGAGTGGGG - Intergenic
1030397596 7:109006857-109006879 CTGGAATTCTTGAGACTCTTAGG + Intergenic
1032414583 7:131726252-131726274 CTGGACTGCTTTAGACACTGGGG + Intergenic
1032975473 7:137217808-137217830 CTGGACTGCCTGGGATACTAAGG + Intergenic
1035756039 8:2033811-2033833 CTGGCCTCCTGGGGAAACTGGGG + Intergenic
1036222315 8:6931098-6931120 ATGGGCTCTTTGTGACACTTTGG - Intergenic
1036227700 8:6973795-6973817 ATGGGCTCTTTGTGACACTTTGG - Intergenic
1036230153 8:6992950-6992972 ATGGGCTCTTTGTGACACTTTGG - Intergenic
1036232605 8:7012053-7012075 ATGGGCTCTTTGTGACACTTTGG - Intronic
1036234112 8:7023442-7023464 ATGGGCTCTTTGTGACACTTTGG - Intergenic
1036595708 8:10210150-10210172 CTTGACTCTTTGGGATACATTGG + Intronic
1037912387 8:22751379-22751401 CTGGTTGCCTTGGGAAACTTGGG + Intronic
1038867474 8:31455470-31455492 CTGCACTACTTGGGAGACTGAGG + Intergenic
1039076001 8:33690781-33690803 CTGGGCTCCTGGGGACACTGAGG - Intergenic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1045568178 8:103342755-103342777 CTGCACTCCTTGGAAAACTGTGG + Intergenic
1047700937 8:127448669-127448691 CTGCACTCCTTGTGAGACTCTGG - Intergenic
1048014457 8:130485100-130485122 CAGGACTCATTGGAATACTTAGG - Intergenic
1051272482 9:15368752-15368774 CTGGCCTCCTTGGTAGATTTTGG - Intergenic
1051929986 9:22373574-22373596 CAGGAGTCCCTGGGACAATTGGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055724402 9:79212055-79212077 CTGGACCCCTATGGACTCTTGGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057161699 9:92893803-92893825 CAGGATTTTTTGGGACACTTTGG - Intergenic
1057692969 9:97302775-97302797 CTGGACACCCTGGGAGGCTTGGG + Intergenic
1191702189 X:64054780-64054802 CTGCATTCCTTTGGACGCTTAGG - Intergenic
1194976253 X:100399559-100399581 CTGGACTCGGTGGAATACTTAGG - Intronic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic