ID: 1143152723

View in Genome Browser
Species Human (GRCh38)
Location 17:4817222-4817244
Sequence CTGCCCTCCTGGAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143152723_1143152725 -7 Left 1143152723 17:4817222-4817244 CCTTCACACTTCCAGGAGGGCAG 0: 1
1: 0
2: 3
3: 16
4: 258
Right 1143152725 17:4817238-4817260 AGGGCAGTGCACCACCGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 55
1143152723_1143152726 -2 Left 1143152723 17:4817222-4817244 CCTTCACACTTCCAGGAGGGCAG 0: 1
1: 0
2: 3
3: 16
4: 258
Right 1143152726 17:4817243-4817265 AGTGCACCACCGTACAGGTGAGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143152723 Original CRISPR CTGCCCTCCTGGAAGTGTGA AGG (reversed) Exonic
900142609 1:1144940-1144962 CTCCCCTCCTGGGGGTGGGAAGG - Intergenic
901159492 1:7164054-7164076 CTGCTATCCTGGCATTGTGATGG - Intronic
901778373 1:11576208-11576230 CAGCCCTCTGGGCAGTGTGATGG - Intergenic
902609199 1:17587445-17587467 CTGATCTCCTGGAAGAGAGAAGG - Exonic
904130924 1:28274562-28274584 CTGCCCTCGTGGAATCTTGAGGG - Intronic
904281790 1:29425723-29425745 CTGCTCCCCAGGAAGTGAGAGGG + Intergenic
904377316 1:30090068-30090090 CTGACCTCCTGGAAGAGCTAGGG - Intergenic
905338202 1:37259936-37259958 CTGCCCACCGGGAAGTCGGATGG + Intergenic
906366673 1:45216019-45216041 TTGCCCTCCTGGATGTGGGTGGG + Intronic
906533880 1:46540708-46540730 CTCCTTGCCTGGAAGTGTGATGG + Intergenic
907104999 1:51874723-51874745 CTTCCCTTCTGGAAGGGTTAAGG - Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
912665577 1:111576623-111576645 CTGCTCCTCTGGAAGGGTGAGGG + Intronic
912710849 1:111948715-111948737 CAGCCCTCCTGGCAGTGAGGAGG - Intronic
914916554 1:151822695-151822717 CTACCCTCCTGGAGCAGTGAAGG - Intronic
915459680 1:156062413-156062435 CTGCCCTAAAGGAAGTATGAAGG - Intronic
915597173 1:156902348-156902370 TCGCCCTGCGGGAAGTGTGATGG + Intronic
917539971 1:175902547-175902569 CTACCCTGCAGGACGTGTGATGG - Intergenic
917620860 1:176794301-176794323 CTGCTCACCTGCAAGGGTGAGGG + Intronic
918089456 1:181276369-181276391 CAGGCCTCCTTGAACTGTGATGG - Intergenic
918204795 1:182299265-182299287 CTGCCCTCATATAAGGGTGATGG - Intergenic
919080752 1:192863143-192863165 CTGACCCCATGTAAGTGTGAAGG + Intergenic
920200303 1:204256148-204256170 CTGGCCTCCTGGTACTGTTATGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922970233 1:229729790-229729812 ATCCCCTCATGGAAGGGTGAGGG - Intergenic
1065453675 10:25884090-25884112 CTACCCATCTGGAACTGTGATGG - Intergenic
1066316330 10:34250871-34250893 CTTTCCTCCTGGAAGTGTGGAGG - Intronic
1067448597 10:46367853-46367875 CTGCTCTCCTGGATGTGTCAGGG - Intergenic
1067588774 10:47492912-47492934 CTGCTCTCCTGGATGTGTCGGGG + Intergenic
1067635900 10:48001003-48001025 CTGCTCTCCTGGATGTGTCGGGG + Intergenic
1068090440 10:52426496-52426518 CTGCTTTCCTGGGAGTGTCAAGG + Intergenic
1069921839 10:71820212-71820234 CTGTCCTCCTGGCAGAGGGAGGG - Intronic
1072619964 10:97073397-97073419 CTGCCGTCCTGGAAGCGGGCGGG + Intronic
1074684678 10:115949688-115949710 CTGGCCTCTTGGAGGTGCGACGG - Intergenic
1075145077 10:119875759-119875781 CTGTCCTCCAGGAAGAGGGAGGG + Intronic
1075200791 10:120402222-120402244 CTGCCCTCCTGAGGGTGTAAAGG + Intergenic
1078815885 11:14822470-14822492 CTGCCCACCTGGGAGTGACACGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083144462 11:60748444-60748466 CTGCCCCCCTGGAAGGGCGGAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1083767163 11:64847155-64847177 CTGGTCTCCTGGAAGGGGGAGGG + Intergenic
1083947326 11:65931439-65931461 CTGTCATCCAGGAAGTGGGAGGG - Intergenic
1084402115 11:68950613-68950635 CTGGCCTCCTGCAGGGGTGAGGG + Intergenic
1084779061 11:71396889-71396911 CAGCCCTCCTGGATGTGGGTGGG + Intergenic
1084972574 11:72779992-72780014 CTATCCTCCTGGAAATGTGGAGG - Intronic
1085071932 11:73554785-73554807 GTGACCTCCTGGGAGTCTGATGG - Intronic
1085253518 11:75159322-75159344 CTGCCCACCTGGGAGAGAGAGGG + Intronic
1085308845 11:75504117-75504139 CTGCCCTCATGGATGGGTGCAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1088887815 11:114021328-114021350 CTGTCCACCTGGAAGTCTGGAGG - Intergenic
1089678355 11:120105582-120105604 CTGCCCCCCAGGAAGTCTGATGG - Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091113992 11:132996797-132996819 CTTCCCTACTGGAAGTGGAATGG - Intronic
1091921233 12:4306544-4306566 CTGGCCTCCTGGGAGTTTCAAGG + Intergenic
1092274214 12:7046996-7047018 CTGTCCTCCTGGGTCTGTGAGGG + Intronic
1094382552 12:29858727-29858749 CTGCAAGCCTGGAAGTGAGAGGG - Intergenic
1096454008 12:51770412-51770434 CTGTCCTCCTGGCTGTGTGGTGG + Intronic
1098292309 12:68968381-68968403 CTGCCTTCCTGGGAGGGTAAAGG - Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1100626167 12:96334789-96334811 CTGACTTCCTCGGAGTGTGAGGG + Exonic
1100655135 12:96635983-96636005 CTCCCCTCCAGGAGGTGGGAGGG + Intronic
1100985593 12:100199545-100199567 CTGCGCACCTGGAAGTGCGCAGG + Intronic
1101298931 12:103457767-103457789 CTGCCCTCCTGGCAGGGGGTGGG + Intronic
1102218873 12:111180782-111180804 CTCCCCTCCTCAAAGTGAGAAGG + Intronic
1102978045 12:117220635-117220657 CTGCACACCTGGAAATGTGCAGG - Intronic
1104856360 12:131904181-131904203 CTGCACTCCAGGATGGGTGACGG - Intronic
1105612413 13:21980558-21980580 TTACCCACCAGGAAGTGTGATGG - Intergenic
1107189313 13:37560472-37560494 CTGCCCTCATTGAAGTGTCCGGG - Intergenic
1107886688 13:44879557-44879579 CTGCCTTCCTGGAGGAGAGAGGG - Intergenic
1111474226 13:88725051-88725073 CTGCCCTCTTCCAAGTTTGAGGG + Intergenic
1111888750 13:94055199-94055221 CAGCCCTGGTGAAAGTGTGAGGG + Intronic
1112234516 13:97623603-97623625 CTGCCCTTGTGGAGGTGTGATGG - Intergenic
1112487576 13:99834040-99834062 CTGCCTCCTTGGAAGTGGGAGGG + Intronic
1113296442 13:108964148-108964170 CAGCCCTCCTGCAACAGTGATGG + Intronic
1113528324 13:111000280-111000302 GTGCCTTCCTGGCTGTGTGAGGG + Intergenic
1113810654 13:113140664-113140686 CGGCCATCCCGGAGGTGTGAGGG + Intronic
1115101767 14:29709783-29709805 TTGCCCTCCTTGATGTGTGTGGG - Intronic
1116221806 14:42096667-42096689 CTGCCAACTTGGAAGTGTGTGGG + Intergenic
1117794153 14:59374621-59374643 CTCCCATCCTGGAAGAGTCAGGG - Intergenic
1118200390 14:63666140-63666162 CTGCCCTCTTGGAAGTTTGAAGG - Intergenic
1118616474 14:67577540-67577562 CTGCCATCCAGGAAGTGATAGGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121317707 14:92971935-92971957 CTGCCCTCCTGGGACACTGATGG + Intronic
1122865220 14:104600864-104600886 CTGCCCTCCTGCCAGTGTGAGGG - Intronic
1123123163 14:105927368-105927390 CTGACATCCTGGGGGTGTGAGGG - Intronic
1123405819 15:20018874-20018896 CTGACATCCTGGGGGTGTGAGGG - Intergenic
1123515149 15:21025522-21025544 CTGACATCCTGGGGGTGTGAGGG - Intergenic
1125361976 15:38873900-38873922 CTGTCCCCCGGGAAGAGTGAGGG - Intergenic
1125674103 15:41493616-41493638 CTGCCCTCGGGGAGGTGGGAGGG - Intronic
1126803554 15:52322371-52322393 CTGCCCTCCTGGCAAAGGGATGG + Intronic
1127755320 15:62086289-62086311 CTGTGCTCCTGGAAGTCTCAGGG - Intergenic
1127755569 15:62088663-62088685 CACCCCTCTTGCAAGTGTGAAGG - Intergenic
1130892455 15:88144799-88144821 CTGCCCTACTGGAAAAGTCATGG + Intronic
1131070598 15:89463311-89463333 CTGCCTGCCTGGAAGGGGGAAGG + Intergenic
1131802384 15:96084466-96084488 CTGACATCCTGGAAGTCTAAGGG - Intergenic
1133451728 16:5909664-5909686 CTGCCCTCCAGCAACTGAGAAGG - Intergenic
1136500194 16:30666277-30666299 CTGCCCTGCTGGAAGGCTGCGGG - Intronic
1137379772 16:47986575-47986597 CTGCCCTTCTGGAAGTGGAGTGG + Intergenic
1137673994 16:50294828-50294850 GTGCCCTGCTGGAATTGGGATGG + Intronic
1138340516 16:56286097-56286119 CTGCCCTGCTGGGAGTGTAGTGG + Intronic
1141994598 16:87628398-87628420 CTGCCCTCCTGAGTGAGTGAGGG + Intronic
1142157491 16:88539269-88539291 GTGCCCTCCTGGAAGAAGGAGGG - Intergenic
1142295772 16:89221112-89221134 CTGCCATCCTGGGAGGCTGACGG - Exonic
1143038932 17:4017963-4017985 CTGCCCTTCTGCAGGTTTGATGG - Exonic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1144629116 17:16861426-16861448 CTCACCTCCCCGAAGTGTGATGG + Intergenic
1145113590 17:20187493-20187515 CTGCCCTCATGGCTATGTGATGG - Intronic
1147166823 17:38597993-38598015 CCTCTCTCCTGGAAGTGGGAGGG - Intronic
1150668478 17:67168716-67168738 GTGCACACATGGAAGTGTGAGGG - Intronic
1151331372 17:73411172-73411194 CTGCCTTCCTGGGATTGAGAGGG + Intronic
1151670251 17:75568320-75568342 CTGCCCTCCTGGAGATGGAAAGG + Intronic
1152470296 17:80487438-80487460 CTGCACACCTGCAAGTGTGTGGG + Intergenic
1153429918 18:5004643-5004665 CTGGCCTCCTTGAACTGTGGTGG - Intergenic
1154300031 18:13184686-13184708 CTGTCATCTTGGCAGTGTGAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154389685 18:13925608-13925630 CTCACCTCATGGTAGTGTGATGG + Intergenic
1155550964 18:26964652-26964674 CTGCTCTGCTGGAGGTGGGAAGG - Intronic
1157281947 18:46352045-46352067 CTGCCATCCTGGGAGTGACAGGG - Intronic
1157710154 18:49844463-49844485 CTGCCCACCTGCAGGTGGGAGGG - Intronic
1158539701 18:58341784-58341806 CTGCCCCGCTGGAGGTGAGACGG + Exonic
1160340908 18:78087908-78087930 GTGCCCTCCTGGCCGTGTGAAGG + Intergenic
1160806166 19:993102-993124 CTGGCCTCCTTGCAGTCTGAGGG - Intronic
1161801760 19:6420230-6420252 CTGCCCTCCTGAACGTCAGAGGG - Intronic
1161862131 19:6805890-6805912 CTGCCCTGATGGAAGTGTCTTGG + Intronic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164500992 19:28820275-28820297 CTCCCCTCCTTTGAGTGTGATGG + Intergenic
1166333053 19:42089822-42089844 CTGCCCTCCTGCTATTGTGGAGG - Exonic
1166364847 19:42273104-42273126 CTCCCCTCCTGGCAGGGCGAGGG - Intronic
1168284850 19:55325943-55325965 CTGCCCTCGTGCAATTGTGAGGG + Intronic
1168352828 19:55686380-55686402 CTGCTCTCCAGGAAGAGTGGAGG + Intronic
1168717411 19:58537626-58537648 CTGCCTTCCTGCAAGTGTTTGGG + Intronic
925144449 2:1571577-1571599 CTCCTCTCCTGGGAGTGGGAAGG - Intergenic
925643359 2:6008874-6008896 CTTACCTCCTGGAATTGTCATGG + Intergenic
926261576 2:11268369-11268391 TAACCCTCTTGGAAGTGTGAGGG - Intronic
926450763 2:13000988-13001010 CTGGCCTCCTGGAAGTCATATGG + Intergenic
929810453 2:45185093-45185115 CTTCCTTCCTGGAAGTTTTAAGG + Intergenic
933051567 2:77609356-77609378 CTGCCCACCAGGGAGTGTCACGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934040443 2:88123874-88123896 CTGCTCTCCTGGGAATGTGCTGG + Intronic
935625194 2:105166624-105166646 CTGCTCTGCTGGGTGTGTGAAGG - Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937059554 2:118971153-118971175 CTTCCTTCCTTGAAATGTGAAGG + Intronic
937252326 2:120532861-120532883 CCGCGCTCCCAGAAGTGTGAGGG + Intergenic
937276962 2:120691067-120691089 CTGGCCTCCTGGAGGTGGGTGGG - Intergenic
939215295 2:139229186-139229208 CTGACCTCCTCCAAGTGAGAGGG + Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
942492727 2:176506135-176506157 CTCCCCTCTTGGAAGTTGGAAGG - Intergenic
942659549 2:178249888-178249910 CTCTCCTACTGGAAGTGGGAAGG - Intronic
943397203 2:187354449-187354471 CTGCTCACATGGAAATGTGATGG + Intronic
944890130 2:204108919-204108941 CTGACCTAGTGGAAGTGGGAGGG + Intergenic
945369612 2:209000789-209000811 CATCCCTTCTGGAAGTTTGAGGG + Intergenic
946864857 2:224033779-224033801 CTGCCCTCCTTGAGGTCTGTTGG - Intronic
947665676 2:231904104-231904126 CTTCCCTCCTGGATGCTTGAAGG - Intergenic
948722703 2:239911546-239911568 CTGCCGTACTGAAACTGTGAAGG - Intronic
1170375034 20:15690903-15690925 CAGCCATCCTTGAAGTGGGAAGG + Intronic
1170753512 20:19174299-19174321 CTGGCCACCAGGAACTGTGATGG - Intergenic
1170890471 20:20371102-20371124 CTGCCCTTCTGGCAGCCTGAGGG + Intergenic
1172101334 20:32485027-32485049 CTGCCCTCGTGGAATTCTGTGGG + Intronic
1174360037 20:50023245-50023267 CTGCCATCCAGGAAGTGAGCAGG - Intergenic
1175902200 20:62364407-62364429 CTGACCTCCTGGAAGAGTAGAGG - Intronic
1179118902 21:38524172-38524194 CTGCCCACCTGGAAGGGGTATGG + Intronic
1182424877 22:30266665-30266687 CTGCCCTCCGGGAACTGGGGAGG - Intronic
1183064197 22:35352448-35352470 CTGCCCTAGTGGGAGTTTGAGGG + Intergenic
1184065465 22:42116856-42116878 CTGCCCTGGTGGAGGTGGGAGGG + Intergenic
1184956132 22:47887535-47887557 CAGACTTCCTGGAAGTGTCAGGG + Intergenic
1185140834 22:49100458-49100480 CTGCTCTCAGGGCAGTGTGAGGG - Intergenic
950279421 3:11693693-11693715 CTGCCCTCTTGTGTGTGTGATGG - Intronic
950622937 3:14221711-14221733 CTGCCCTGCAAGAAGTGTAAAGG - Intergenic
953370162 3:42380784-42380806 CTTCCCCCATGGAAGTGTGGTGG - Intergenic
955648489 3:61166847-61166869 TTTCCATCCTGGAAGTGTGAGGG + Intronic
956065993 3:65397875-65397897 CTGCCCTCATGGAAATGGGGAGG - Intronic
958147838 3:89649679-89649701 CTGTCCTCCCGGAAGGGTAAAGG - Intergenic
959263103 3:104104696-104104718 TTGCCCACCTGGTAGTGGGATGG - Intergenic
960338998 3:116452462-116452484 CTGCCCTTCTGCAAGTCTAATGG + Intronic
960875041 3:122287572-122287594 AAGCCCTCCTGGAAGGGAGAAGG - Intergenic
963036145 3:141030580-141030602 CCTCCCTCCCGGACGTGTGAAGG + Intergenic
963917599 3:150873360-150873382 CTGCCCACCTGGAAAGGGGAAGG + Exonic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965508886 3:169546610-169546632 CAGCTCTCCTGGTAGTGTGTTGG + Intronic
965597358 3:170421992-170422014 CTGCCCTCCAGGAACCCTGAGGG + Intronic
968312226 3:197693542-197693564 CTTCCCTACTGAAACTGTGAAGG + Intronic
969659098 4:8515979-8516001 CTGCATTCCTGGGAGTGAGATGG + Intergenic
971028713 4:22613565-22613587 CTGCTCTGCTGGAGGTGGGAGGG - Intergenic
971196761 4:24477521-24477543 TGACCCTCCTGGAAGTGTGAGGG + Intergenic
971279748 4:25233645-25233667 CTGCCCTCCTGGACGTCTACTGG + Intronic
971476769 4:27080069-27080091 CTTCCCTCCTAGAACTCTGAAGG - Intergenic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
971939575 4:33198040-33198062 TTGCCCTCCTGAAAGTGAGTAGG - Intergenic
972618391 4:40722451-40722473 CTGTGCTCCTGGAACAGTGAAGG + Intergenic
973866593 4:55120264-55120286 TTACCCTCCTGGAAGAGTGCTGG - Intronic
975712518 4:77174653-77174675 CTGCCCTCCTGGTGGTGGAATGG + Intronic
978341731 4:107726685-107726707 CTCCCTGCCTGGAAGGGTGAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
981606746 4:146547568-146547590 CTGCCCACCTGGGAGTGACACGG - Intergenic
982049930 4:151490262-151490284 CTGCTCTGGTGGAAGTGGGAGGG - Intronic
983634693 4:169885281-169885303 TTGCCCTCTTGCAAGTGTGCAGG - Intergenic
983965877 4:173809152-173809174 CTGCCCTGCTGGGAGTGGTAGGG - Intergenic
984764126 4:183386474-183386496 ATGCCCTCCTGGCACTATGAGGG + Intergenic
986483117 5:8209453-8209475 CTGCCTTCCTTGAGGTGGGAAGG - Intergenic
989261372 5:39423390-39423412 CTCCCCTCTTGGAAGGGAGATGG - Intronic
990081128 5:51915055-51915077 CTCCCCTCCTGGGAGCTTGAGGG - Intergenic
991196191 5:63935222-63935244 CTTCCCTCTTGTAACTGTGAAGG - Intergenic
991950571 5:71943489-71943511 CTTCCCTCCTGGGAATGGGAGGG - Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
998814652 5:146000831-146000853 CTGCTCTCCTGGCAGAGTAATGG + Intronic
999722000 5:154405327-154405349 CTGAGCTCCGGGAAGTGTCAGGG + Intronic
1001759424 5:174194987-174195009 CTGCCCTACTGGGGGTGTGAAGG + Intronic
1002882993 6:1269280-1269302 GTGCCCACCAAGAAGTGTGATGG + Intergenic
1003211143 6:4067925-4067947 CTGCACTGCTGGAAGTCTTAAGG - Intronic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1006788857 6:36685817-36685839 CTGCAGTCCTGGAAGCGCGAGGG + Exonic
1006977587 6:38117849-38117871 CTGCCCTATTGGAAATGGGAAGG + Intronic
1007230192 6:40342870-40342892 AGGCCTTCCTGGCAGTGTGAGGG - Intergenic
1008946654 6:57104833-57104855 CTGTTTTCCTGGAAGTGTAAAGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012430494 6:99159074-99159096 CTGTGCTCCTTGGAGTGTGAGGG + Intergenic
1012465507 6:99512980-99513002 CTGCCCTGCTGTAAGGGTCATGG - Intronic
1014486292 6:122003309-122003331 CTGAACTCCAGGAAGTGTGTAGG + Intergenic
1014545922 6:122735161-122735183 CTGCTTTCCTGGAAGGCTGAAGG - Intergenic
1016086695 6:139923533-139923555 CTTTCCTCCTGGAAGTTAGAGGG + Intergenic
1018040291 6:159915854-159915876 CTGCCCTCCTGGAAGGGCGAAGG + Exonic
1018197423 6:161367375-161367397 CTGACCTCCTGGGACTGTCAAGG + Intronic
1019188798 6:170238168-170238190 CTGCCCTTCTGGAAGCCTGGAGG - Intergenic
1024057956 7:45677710-45677732 CTGCCCTGCTGGTGGTGAGATGG - Intronic
1027180987 7:75939137-75939159 CTGCACTCCAGGAACTGTGTGGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027733255 7:81902633-81902655 CTGCTCTGGTGGAAGTGGGAGGG + Intergenic
1027978224 7:85185689-85185711 CTTCCCTCCTTGCACTGTGACGG + Intronic
1028406614 7:90482102-90482124 CTGCCCTCCCAGAAGTTGGAAGG + Intronic
1028845005 7:95470607-95470629 CCGACCTCCTGGAGGTGTGGGGG - Intergenic
1029997693 7:105024419-105024441 CTCCCATCCTGGACGTGTAAAGG + Intronic
1030313082 7:108087253-108087275 CTGCCCTCATTGTAGTGGGAAGG - Intronic
1031584827 7:123521608-123521630 CTGCCCTCCAGCCAGAGTGATGG + Intronic
1032999199 7:137484414-137484436 CTCCCCACATGGAAGTATGAAGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035663800 8:1365501-1365523 CTGCCATCCTGGACCTGGGAGGG - Intergenic
1037297226 8:17413639-17413661 GTGGCCTCCTGGAAGAGAGATGG + Intergenic
1038742035 8:30224684-30224706 CAGCCCTGCTGGAAGTAAGAGGG - Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040099022 8:43480569-43480591 CTGGCCTCCTTGAGCTGTGATGG - Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041717601 8:60946115-60946137 CTATCCTCATGGAATTGTGAGGG + Intergenic
1044668345 8:94653737-94653759 CTGCCCTGCTGTAAAGGTGAAGG + Intronic
1044743672 8:95352237-95352259 CTGTCCTCCTGGAAGTCAGAAGG - Intergenic
1046986712 8:120397038-120397060 CTGCCCACCTGGGAGTGGCATGG + Intronic
1048394085 8:133996784-133996806 CTCCTCTACTGGAAGCGTGAAGG + Intergenic
1048545882 8:135386824-135386846 CTTCCCTCCTGTATGTCTGAGGG - Intergenic
1048985869 8:139734552-139734574 CTGCCCTCCAGGAAGGCTGGAGG + Intronic
1049852163 8:144838552-144838574 CTGCCCTGCTGCAGGAGTGACGG - Intronic
1050565707 9:6880552-6880574 GTGCCCTTAGGGAAGTGTGAAGG + Intronic
1053025772 9:34727030-34727052 CTGCCTTCTTGGAAGAGTGTGGG + Intronic
1055160940 9:73127312-73127334 CTGCACTCCAGCATGTGTGACGG + Intergenic
1055451819 9:76437745-76437767 CTGGCTTCTTGGAAGGGTGAGGG + Intronic
1056204902 9:84310377-84310399 CTGCCATCCTGGAAATAGGATGG - Intronic
1057910758 9:99018392-99018414 CTGTGCTCATGGGAGTGTGAGGG + Intronic
1059234852 9:112752191-112752213 CTGCCCTCCTTGCAGTCAGAAGG + Intronic
1061114888 9:128603819-128603841 CTGCCCTACTGGAAATCAGAGGG - Intronic
1061151639 9:128831914-128831936 CTGCCTCCATGGAGGTGTGAGGG - Intergenic
1062043728 9:134415706-134415728 GTGCCCTCCTGCCAGTGTGCTGG - Intronic
1062493860 9:136822356-136822378 CTCCCCTCCTGGAAACGTGGAGG + Intronic
1185694268 X:2183566-2183588 CTCCCGTCCTGGAGGTGGGAAGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1189850618 X:45172989-45173011 CTGCTCTCAGGCAAGTGTGAGGG - Intronic
1190548585 X:51555984-51556006 CTGGCCTCCTTGAGGTGTGGTGG + Intergenic
1190627139 X:52346808-52346830 CTGCCTTCCTGGAAGTGCTCAGG + Intergenic
1190700889 X:52989322-52989344 CTGCCTTCCTGGAAGTGCTCAGG - Intronic
1191625530 X:63266693-63266715 CTGGCCTCCTTGAACTGTGGTGG + Intergenic
1192234997 X:69289956-69289978 CTGCTCTCCTGGCAGGGCGAGGG + Intergenic
1192495180 X:71611711-71611733 CTGCCCTCCAGGAACAGAGATGG - Intronic
1195147495 X:102031948-102031970 CAGCCCTCCTTGAACTGTGGTGG - Intergenic
1195291730 X:103436631-103436653 CTCCTCTCCTGGAAGAGTAATGG + Intergenic
1199141353 X:144317365-144317387 CAGCCATCCTAGTAGTGTGACGG - Intergenic