ID: 1143155291

View in Genome Browser
Species Human (GRCh38)
Location 17:4832876-4832898
Sequence TGTTGCCATAGCAATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143155285_1143155291 -7 Left 1143155285 17:4832860-4832882 CCCTCAGCGGCTCCACTGTTGCC No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155278_1143155291 21 Left 1143155278 17:4832832-4832854 CCAGCCAAGTTCTCACGGAGTGG No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155282_1143155291 -2 Left 1143155282 17:4832855-4832877 CCCCTCCCTCAGCGGCTCCACTG No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155280_1143155291 17 Left 1143155280 17:4832836-4832858 CCAAGTTCTCACGGAGTGGCCCC No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155283_1143155291 -3 Left 1143155283 17:4832856-4832878 CCCTCCCTCAGCGGCTCCACTGT No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155286_1143155291 -8 Left 1143155286 17:4832861-4832883 CCTCAGCGGCTCCACTGTTGCCA No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data
1143155284_1143155291 -4 Left 1143155284 17:4832857-4832879 CCTCCCTCAGCGGCTCCACTGTT No data
Right 1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143155291 Original CRISPR TGTTGCCATAGCAATTGGGT GGG Intergenic
No off target data available for this crispr