ID: 1143155428

View in Genome Browser
Species Human (GRCh38)
Location 17:4833453-4833475
Sequence CCGCGCCTCCCCCGGAGACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143155428_1143155445 17 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155445 17:4833493-4833515 GTTCTCCGATGGGGGAGAAGCGG 0: 1
1: 0
2: 1
3: 7
4: 165
1143155428_1143155447 23 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155447 17:4833499-4833521 CGATGGGGGAGAAGCGGCGACGG 0: 1
1: 0
2: 0
3: 8
4: 152
1143155428_1143155439 8 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155439 17:4833484-4833506 GCCCCCGGGGTTCTCCGATGGGG 0: 1
1: 0
2: 2
3: 3
4: 55
1143155428_1143155441 9 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155441 17:4833485-4833507 CCCCCGGGGTTCTCCGATGGGGG 0: 1
1: 0
2: 2
3: 3
4: 48
1143155428_1143155448 26 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155448 17:4833502-4833524 TGGGGGAGAAGCGGCGACGGCGG 0: 1
1: 0
2: 2
3: 30
4: 332
1143155428_1143155435 -5 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155435 17:4833471-4833493 CGCGGTGGAGTCCGCCCCCGGGG 0: 1
1: 0
2: 1
3: 11
4: 65
1143155428_1143155437 6 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155437 17:4833482-4833504 CCGCCCCCGGGGTTCTCCGATGG 0: 1
1: 0
2: 0
3: 7
4: 61
1143155428_1143155433 -7 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155433 17:4833469-4833491 GGCGCGGTGGAGTCCGCCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 123
1143155428_1143155438 7 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155438 17:4833483-4833505 CGCCCCCGGGGTTCTCCGATGGG 0: 1
1: 0
2: 0
3: 3
4: 28
1143155428_1143155434 -6 Left 1143155428 17:4833453-4833475 CCCGGTCTCCGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1143155434 17:4833470-4833492 GCGCGGTGGAGTCCGCCCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143155428 Original CRISPR CCGCGCCTCCCCCGGAGACC GGG (reversed) Exonic
900191771 1:1355147-1355169 CCGCGCCCCCTCCGCAGCCCCGG - Exonic
900223771 1:1523350-1523372 CCCTGCCCCGCCCGGAGACCAGG - Intronic
900313460 1:2045886-2045908 CAGCCTCTCCCCCGGGGACCTGG + Intergenic
901007929 1:6180554-6180576 CCTCGCCTCCCCCTGCGCCCGGG - Intergenic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901775875 1:11560185-11560207 CCTCACCTCCCCCAGGGACCTGG + Intergenic
902823110 1:18955637-18955659 CCGCCCCTCCCCCGCCGCCCTGG - Intronic
903855751 1:26336810-26336832 CCGCCCCGCTCCCGGAGCCCGGG + Intronic
904541981 1:31239544-31239566 CCGCGCAGCCCCCGGAGCCATGG - Exonic
905627575 1:39498788-39498810 CAGCGGCTCCCCCAGAGCCCCGG - Intronic
905647193 1:39633013-39633035 CCGCCCCGCCCCCGGGGATCGGG - Intronic
905668849 1:39778320-39778342 CAGCGGCTCCCCCAGAGCCCCGG + Intronic
906653749 1:47533231-47533253 GCGCGCCTCCCCCCGAGTCCCGG - Intergenic
910251455 1:85201784-85201806 ACGCGCATGCCCCGGAGCCCCGG + Intergenic
915495881 1:156282502-156282524 CCGCACCTCACCCCGACACCCGG + Intronic
917654937 1:177116904-177116926 CCACTCCTCCCCAGGGGACCCGG + Intronic
921007917 1:211112304-211112326 CCACCCCTCCCCCGGGGCCCGGG + Intronic
924551689 1:245084060-245084082 CCGCCCCCCCCCCGGCGCCCCGG + Intronic
1063418339 10:5890595-5890617 CCGCGCTGCCCCCCGAGGCCAGG + Intronic
1065110749 10:22437490-22437512 GCGCGCCTCCCGCGGAAAGCGGG - Intronic
1066653540 10:37680581-37680603 CCGAGCCACACCGGGAGACCAGG - Intergenic
1069569123 10:69483902-69483924 CCGGGACTCCCCAGGAGAGCTGG + Intronic
1070951457 10:80434747-80434769 CCTAGCCTCCCACAGAGACCAGG + Exonic
1073196456 10:101695190-101695212 CCGCGCCGCCCCATGTGACCCGG - Exonic
1077058246 11:606306-606328 CTGCGCCTCCCCCACAGCCCTGG - Intronic
1077147919 11:1054115-1054137 CTGCCCCTCCCCCGGGGATCCGG + Intergenic
1077307458 11:1874521-1874543 CCTGGCCTCCCCTGGAGCCCTGG - Intronic
1080642550 11:34166211-34166233 CCGCCCTTCCCCTGGATACCAGG + Intronic
1081636882 11:44727325-44727347 CCGCCGCGCCCCCGGGGACCTGG + Intronic
1083441403 11:62678934-62678956 CCGCGGCTTCCGCGGGGACCTGG + Exonic
1083922062 11:65786579-65786601 TCGCGCCTCCCCAGGAGCCTCGG + Intergenic
1084375339 11:68773115-68773137 CCACCCGGCCCCCGGAGACCGGG + Intronic
1084403240 11:68956714-68956736 CCCAGCCTCCCCCGGTCACCCGG + Intergenic
1084556169 11:69877431-69877453 CCGCACCCACCCCGGAGAACAGG + Intergenic
1084973038 11:72781717-72781739 CCGCAGCTGCCCGGGAGACCCGG + Intronic
1088480999 11:110296456-110296478 CCGCGCCTTACCCGGAGAGCGGG + Exonic
1091108438 11:132943806-132943828 CCCCGCCTCCTCCGGGGACGCGG + Intronic
1091653161 12:2324542-2324564 CCCCGCCTCCCCAGGAGAAAAGG + Intronic
1093339785 12:17959396-17959418 CAGTGCCTTCCCCGGAGACAAGG - Intergenic
1093958851 12:25251115-25251137 CCGCTCCTCCCCCGCCGGCCCGG - Intergenic
1096495441 12:52037126-52037148 GCGCGCCTCCCCCGGCGGGCGGG - Intronic
1096788427 12:54030933-54030955 ACTCGCCTTCCCCGGAGCCCAGG + Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1100611400 12:96194356-96194378 CCGCGCCTCCCCCGCCGCCCCGG - Intergenic
1102519224 12:113468549-113468571 CAGCCCCTCCCCCAGGGACCCGG + Intronic
1103562511 12:121800065-121800087 CCGCCCCTCCCCCAGCGGCCCGG + Intronic
1104031014 12:125065737-125065759 CCGCCCATCCCCCGCAGGCCCGG - Intronic
1104759678 12:131289429-131289451 ACCCGCCTCCCCTGGAGAGCAGG - Intergenic
1104821035 12:131677784-131677806 ACCCGCCTCCCCTGGAGAGCAGG + Intergenic
1104854922 12:131896994-131897016 CCGCACGACCCCCGCAGACCCGG + Intronic
1112208190 13:97346720-97346742 CCGCTCCTCCCGCGGTGGCCGGG + Intronic
1113462727 13:110493216-110493238 CCGCGGATCCCACGGAGTCCCGG - Exonic
1113882929 13:113637931-113637953 CTGGGCCTCCCCCGGGGTCCAGG + Intronic
1114519084 14:23321700-23321722 CCGCGCCCCCCCGGGAGCTCCGG + Exonic
1115147330 14:30240348-30240370 CCCCGCCTCCCCCTGAGGGCAGG - Intergenic
1117508931 14:56429420-56429442 CTGCCCCTCTCCTGGAGACCTGG + Intergenic
1118339349 14:64880719-64880741 CCCCCACTCGCCCGGAGACCCGG - Intergenic
1118776830 14:68978747-68978769 GCGCCCCTGCCCCGGAGCCCGGG - Intronic
1121803796 14:96797239-96797261 CCGCGCCTCCCCGGGAATGCCGG - Intergenic
1122066037 14:99175086-99175108 CCGCGCCGCCCCCCGCGCCCGGG + Exonic
1122202865 14:100133052-100133074 CCTCGCCTTCCCAGGAGCCCCGG + Intronic
1122978557 14:105181083-105181105 CCGCGCCCCCGCCGGCGGCCCGG - Intronic
1124014556 15:25864096-25864118 CCTCGCCTCCCCCGCCGTCCGGG - Intronic
1124188243 15:27548621-27548643 CTGCGGGTCCCCCAGAGACCAGG - Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1125592637 15:40864366-40864388 CCTCGCCTCCCCCGGCAAGCAGG - Intergenic
1127142709 15:55993688-55993710 CAGCGCCTCCCGCGGCGAGCGGG + Intronic
1133784240 16:8963018-8963040 CCGCCCCTCGCCCGCGGACCCGG + Intronic
1135479921 16:22814073-22814095 CCGCGCCGCGCCCAGGGACCTGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136220300 16:28823796-28823818 CCCCGCCTCCCCTGAAGGCCGGG - Intronic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1139437990 16:66947944-66947966 CCTCACCTCCCGCGGAGACCAGG - Intergenic
1139548215 16:67659701-67659723 CCGCGCCGCCCTCAGCGACCTGG + Exonic
1141657156 16:85422410-85422432 CGGTTCCTCCCCCGGAGGCCTGG + Intergenic
1142374963 16:89701968-89701990 CCGCTCCTCCCCACGAGACAGGG + Intergenic
1142493490 17:293471-293493 CTGCCCCACCCCCGGAGCCCCGG - Intronic
1142623694 17:1179849-1179871 CCGCGCTCCTCCCGGGGACCTGG - Exonic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1143451905 17:7041754-7041776 CCACGCCTCCCCCAGAGACGGGG - Exonic
1143974454 17:10819890-10819912 CCCCACCTCCCATGGAGACCAGG + Intergenic
1144642230 17:16943885-16943907 CTGCACCTGCCCCGGAGCCCGGG + Intronic
1146788844 17:35740266-35740288 CCGACCATCCCCAGGAGACCAGG - Intronic
1146936239 17:36814202-36814224 CTGCCCCTCCCCCGGCGGCCAGG + Intergenic
1147158575 17:38558147-38558169 CTGCGCCTCCCAGGGAAACCAGG + Intronic
1147645014 17:42028163-42028185 CGGCACCTCCCCTGGACACCGGG + Exonic
1152606614 17:81294771-81294793 CCTCGCCTCCCCCGCAGAGGGGG - Intronic
1152761037 17:82107184-82107206 CCTCTTCTCCCCTGGAGACCAGG + Intronic
1152781381 17:82228753-82228775 CCTCGCCTCCCCCGGAGTCCAGG - Intronic
1154151456 18:11909113-11909135 CCTCTCCTCCCCCGGAGCCTTGG + Exonic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157780104 18:50430778-50430800 GCACACATCCCCCGGAGACCTGG - Intergenic
1160719191 19:590067-590089 CCGCGCCCCCCCCGGGCCCCGGG + Exonic
1161203704 19:3029379-3029401 CCGCGCCCCCCCCGGCCCCCGGG + Intronic
1161316214 19:3618835-3618857 CCGCAGCTCCCCTGGAGCCCAGG + Intronic
1161851188 19:6738952-6738974 CCGCCCCTCCCCCAGACATCTGG - Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1167279693 19:48559710-48559732 CCTCGCCTTGCCCGGAGGCCTGG + Intronic
1167586554 19:50378673-50378695 CCTCGCCTTCCCCGGAGCCCTGG - Exonic
1168161287 19:54511960-54511982 CAGCCCCTGCCCCTGAGACCTGG - Intergenic
925928267 2:8685647-8685669 CTGCGCCTCTCCCGGAGGCGAGG - Intergenic
927156468 2:20224235-20224257 CCGCGCCCCCCACGCAGCCCTGG + Intronic
928366576 2:30707589-30707611 CTGTGCCTCCCCCAGAGATCTGG + Intergenic
931602610 2:64019265-64019287 CGGCGGCTCCCCTGGAGGCCGGG - Intergenic
933977138 2:87520682-87520704 CTGAGCCTCCCCGGGAGACATGG - Intergenic
934105512 2:88691640-88691662 CCCCGGCTCCCCCGGAAATCTGG - Exonic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
945225935 2:207530620-207530642 CGGCGGCTGCCCCGGAGGCCCGG - Intronic
1172126316 20:32627133-32627155 CCACCCCTTCCCCGGAGGCCGGG - Intergenic
1172952111 20:38728861-38728883 CCCCGCCTCCCCCCAAAACCAGG - Exonic
1176117932 20:63441181-63441203 CCTCACCTCCCCCGCAGGCCAGG - Intronic
1178947876 21:36962962-36962984 CTGCTCCTCTCCCGGAGATCTGG + Intronic
1179775388 21:43658788-43658810 GCGCCCCTACCCCGGAGCCCTGG - Intronic
1179893630 21:44350015-44350037 CCCGCCCTCCCCCAGAGACCTGG - Intergenic
1180225264 21:46388372-46388394 CCGCCCCTCCCCTGGAGCACAGG - Intronic
1180285448 22:10741518-10741540 CCGGGGCTCCCTCGGAGCCCGGG - Intergenic
1180676605 22:17590803-17590825 CAGCCCCTCCCCCAGAGCCCAGG + Exonic
1182351464 22:29702408-29702430 CAGCGCCTCCCCAGGAACCCTGG + Intergenic
1183282187 22:36937809-36937831 CAGGGCCTCCCCCGGACTCCAGG - Exonic
1183423726 22:37726320-37726342 CAGCGCCTCCCGGGGAGACCAGG + Exonic
1184782964 22:46658311-46658333 CCGCGCCTTCCTCGGGGCCCTGG + Intronic
1184861915 22:47177126-47177148 CCGAGCCTCTCCCTGGGACCGGG - Intergenic
1185297861 22:50063020-50063042 CCGCGTCCCCACCAGAGACCAGG + Intronic
950123410 3:10496681-10496703 CCGCCCCTTCCCCCGTGACCTGG + Intronic
950374296 3:12557343-12557365 CCACGCATCCCCCGGATCCCCGG - Intronic
950902809 3:16512983-16513005 CCGCGCGCACCCCGGAAACCTGG + Intronic
951543521 3:23805728-23805750 CAGCGCCTCCTCCGGACGCCCGG - Intergenic
952901585 3:38114992-38115014 CTGTGTCTCCTCCGGAGACCTGG - Exonic
954138978 3:48595330-48595352 CCGCTCCGCCCCCCGAGATCAGG - Intergenic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
959530739 3:107431552-107431574 CCGCGCTTCCGCCCGAGCCCCGG - Intergenic
960702341 3:120450908-120450930 CCCCGCGCCCCCAGGAGACCTGG - Exonic
962613718 3:137103584-137103606 CCTCACCTCCCCCAGAGGCCTGG - Intergenic
963228775 3:142889065-142889087 CCGCGTATCCCCCGGCTACCTGG - Exonic
965590742 3:170358044-170358066 CCGCGGGGACCCCGGAGACCCGG + Intronic
966794130 3:183697964-183697986 CCGCGCTGCAGCCGGAGACCCGG + Exonic
968196758 3:196712829-196712851 GCCCGACTCTCCCGGAGACCCGG - Intronic
968377368 4:54387-54409 CCGCGCCTCCCGCAGACACCAGG - Intronic
968384706 4:125584-125606 CCGCGCCTCCTGCGGACACCAGG - Intronic
968401735 4:304375-304397 CCGCGCCTCCCGCAGACACCAGG + Intronic
968495381 4:912399-912421 CCTCAGCTCCTCCGGAGACCTGG - Intronic
968674483 4:1870585-1870607 CCGCGCCACCCCCTGAAGCCCGG + Intergenic
968804645 4:2764236-2764258 CCGCGCCGCCCGCGGAGGCTGGG - Intergenic
969552696 4:7881490-7881512 CCGCGCCTGGCCCAGAGTCCGGG - Intronic
969688123 4:8688308-8688330 CCGTCCCTTCCCCGGAGGCCTGG + Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
972766001 4:42152489-42152511 CCGCGCCTCCGACGGGGAGCGGG + Intronic
973867209 4:55125692-55125714 CCGCCCCTCACCCGGGTACCCGG + Intergenic
978384473 4:108166945-108166967 CCGCACCGCCCCCGCAGCCCGGG + Intronic
979674755 4:123398616-123398638 CCCCTCCTCTCCCGGAGTCCTGG - Intronic
985579369 5:688925-688947 CAGCCCCTCCCCCTGAGCCCAGG - Intronic
985594215 5:780984-781006 CAGCCCCTCCCCCTGAGCCCAGG - Intergenic
992716065 5:79513210-79513232 TCGCTCCACCCCCGGAGACCTGG - Exonic
995650403 5:114362352-114362374 CTGCGCCTCCTCCGGTGCCCCGG + Exonic
997302054 5:132813559-132813581 CCGCGCGTCCCGCGGCGACGCGG + Intergenic
997980380 5:138464769-138464791 CCGCTCCTCCCCCGCACTCCCGG + Intergenic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
999285308 5:150391072-150391094 AAGCGCTTCCCCCGAAGACCTGG - Intronic
1001399651 5:171438887-171438909 CAGCCCCTCCCCCTGAGACAAGG - Intronic
1002541310 5:179907994-179908016 CCGCGCCGCCCCCTCAGCCCCGG + Intergenic
1002926230 6:1607100-1607122 CCGCCCCTCCCCAGCAGGCCGGG - Intergenic
1006682172 6:35805272-35805294 CCGCCCCTCGCCCGGAACCCCGG + Exonic
1007614412 6:43171782-43171804 CCGCGCCATTCCCGGGGACCCGG - Exonic
1009853733 6:69232639-69232661 CCACCCCTCCCCTGGATACCAGG + Intronic
1014137575 6:117907325-117907347 CCGCGCGCCCCGAGGAGACCCGG + Intergenic
1017324329 6:153129898-153129920 CTGCGCCTCGCCCGGAGCCCGGG - Intronic
1019184346 6:170212455-170212477 CCGCCTCTGCCCCGGAGCCCAGG + Intergenic
1019343726 7:519923-519945 CCCCGCCTCCCCCGGATTCCGGG + Intronic
1019576989 7:1742378-1742400 ACGCGCCTCTGCCTGAGACCTGG + Intronic
1020389247 7:7640978-7641000 CCGCGCCTCCCACGCAGAACTGG - Exonic
1022388822 7:29926313-29926335 CCGGGCTTCTCCCAGAGACCAGG - Intronic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1025207520 7:57002201-57002223 CCGCCCCTGCCCTGGGGACCGGG - Intergenic
1026014793 7:66664655-66664677 CCCCGCCTCCCCCTGAGCCAGGG + Intronic
1029302739 7:99598162-99598184 CCGCGTCTCCTCCGCAGAGCTGG + Intronic
1029440863 7:100586003-100586025 CTGCGTCTCCCCGGCAGACCTGG + Exonic
1032693833 7:134316556-134316578 CCCCGCCGCCCACGGAGCCCGGG - Intronic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1033033165 7:137846601-137846623 CCGCGCCGCCCTCGGCGCCCAGG + Exonic
1037759113 8:21730112-21730134 CCGCGCCTGGCCGGGTGACCTGG - Intronic
1041739102 8:61139646-61139668 CCGTGCCTCCCCCTGAGGCCGGG - Intronic
1043502818 8:80873880-80873902 CGGCGCCCGCCCCGGAGAGCTGG - Intronic
1057052353 9:91935451-91935473 CACAGCCTCCCCAGGAGACCAGG + Intronic
1060296536 9:122347161-122347183 CCGCGCTTCCCCCGGCCGCCCGG - Intergenic
1061682643 9:132250541-132250563 CAGCGCTAACCCCGGAGACCAGG + Intergenic
1061801431 9:133115283-133115305 CGGCCCCTCCCAAGGAGACCTGG + Intronic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1062162453 9:135087793-135087815 CCGCGCCTTCCCCGGGCGCCAGG - Exonic
1062472684 9:136713211-136713233 CCGGGCCTCCCCTGCGGACCCGG - Intronic
1203571868 Un_KI270744v1:139859-139881 CCGCGCCTCCCGCAGACACCAGG + Intergenic
1185464422 X:346308-346330 CCTCGCCCCGCACGGAGACCGGG + Intronic
1186475391 X:9853202-9853224 ACACGCCTCTCCCGGAGTCCTGG - Intronic
1186669885 X:11758012-11758034 CCGCACCCCTCCCGGAGCCCCGG + Intergenic
1195625171 X:106999805-106999827 CCGCGCGCCCCCCGCAGCCCAGG + Intronic
1195923230 X:110002808-110002830 CCGCGCCTCCCGCCCAGCCCCGG - Intronic
1199772578 X:150983990-150984012 CCGCGCCCCCCCGGGCCACCGGG - Intronic