ID: 1143164113

View in Genome Browser
Species Human (GRCh38)
Location 17:4889472-4889494
Sequence GCCCAGCCCCGCGGGCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143164106_1143164113 11 Left 1143164106 17:4889438-4889460 CCTCTCTCGTCACAGCTACCGGC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1143164113 17:4889472-4889494 GCCCAGCCCCGCGGGCCCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 205
1143164107_1143164113 -7 Left 1143164107 17:4889456-4889478 CCGGCTGTTTACCCGAGCCCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1143164113 17:4889472-4889494 GCCCAGCCCCGCGGGCCCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143164113 Original CRISPR GCCCAGCCCCGCGGGCCCTT GGG Intronic