ID: 1143164113 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:4889472-4889494 |
| Sequence | GCCCAGCCCCGCGGGCCCTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 224 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 18, 4: 205} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143164106_1143164113 | 11 | Left | 1143164106 | 17:4889438-4889460 | CCTCTCTCGTCACAGCTACCGGC | 0: 1 1: 0 2: 0 3: 3 4: 91 |
||
| Right | 1143164113 | 17:4889472-4889494 | GCCCAGCCCCGCGGGCCCTTGGG | 0: 1 1: 0 2: 0 3: 18 4: 205 |
||||
| 1143164107_1143164113 | -7 | Left | 1143164107 | 17:4889456-4889478 | CCGGCTGTTTACCCGAGCCCAGC | 0: 1 1: 0 2: 1 3: 10 4: 113 |
||
| Right | 1143164113 | 17:4889472-4889494 | GCCCAGCCCCGCGGGCCCTTGGG | 0: 1 1: 0 2: 0 3: 18 4: 205 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143164113 | Original CRISPR | GCCCAGCCCCGCGGGCCCTT GGG | Intronic | ||