ID: 1143164338

View in Genome Browser
Species Human (GRCh38)
Location 17:4890351-4890373
Sequence GCTTCTTTGCTGGAACGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143164332_1143164338 10 Left 1143164332 17:4890318-4890340 CCCTCAGCGTCCTCTGGGAAGAT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 112
1143164328_1143164338 30 Left 1143164328 17:4890298-4890320 CCCTGCTGCTGGTAACGGGTCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 112
1143164333_1143164338 9 Left 1143164333 17:4890319-4890341 CCTCAGCGTCCTCTGGGAAGATG 0: 1
1: 0
2: 1
3: 29
4: 219
Right 1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 112
1143164334_1143164338 0 Left 1143164334 17:4890328-4890350 CCTCTGGGAAGATGCTTTTCAGA 0: 1
1: 0
2: 1
3: 20
4: 250
Right 1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 112
1143164329_1143164338 29 Left 1143164329 17:4890299-4890321 CCTGCTGCTGGTAACGGGTCCCT 0: 1
1: 0
2: 1
3: 7
4: 76
Right 1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143164338 Original CRISPR GCTTCTTTGCTGGAACGGGA TGG Intronic
901640857 1:10692379-10692401 GCTTCTTGGCTGGGATGGGTGGG + Intronic
902601278 1:17541157-17541179 GGCTCTTTGGTGGAAGGGGAAGG - Intronic
906537186 1:46557850-46557872 TCATCTTTGCTGGAACAGCATGG + Exonic
907529421 1:55079089-55079111 GCGGCTCTGCTGGAAGGGGAAGG + Intronic
908339634 1:63163363-63163385 GCTTCTTTGTTAGGAAGGGATGG - Intergenic
909257164 1:73438934-73438956 GCTTCTGGCCTGTAACGGGAGGG - Intergenic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
911626923 1:100134114-100134136 GCAACTTTGCTGGAATGGGAAGG + Intronic
917508216 1:175648323-175648345 GCTGCTTTGCTGGAATGGGAAGG + Intronic
919271883 1:195359129-195359151 TCTTCTTAGGTGGAACAGGATGG - Intergenic
919669703 1:200327619-200327641 GCCTGTTTGCTGGAAGGTGAGGG - Intergenic
920019961 1:202948268-202948290 GCTTCTGTCCTGGAAGGGGAAGG - Intronic
920302934 1:205000492-205000514 ACTTCTATGCTTGAAGGGGAAGG + Intronic
1063454274 10:6172266-6172288 GCTCCTTTGCAGGAAGGAGAGGG + Intronic
1064295233 10:14073335-14073357 GCTTCTTTGGTGGGAAGGGAGGG + Intronic
1064559012 10:16577297-16577319 GTTTCATTGCTGGAAAGAGATGG + Intergenic
1066586565 10:36943045-36943067 CCATCTTTGCTGGAACAGCATGG + Intergenic
1072163240 10:92787651-92787673 GGTTCCTTGCTGCAACGGGAAGG - Intergenic
1079063114 11:17266931-17266953 GCTTGTTTGCTGGAGCTGGTGGG + Intronic
1081014175 11:37855633-37855655 GTTTTTTTGGTGGAAGGGGATGG - Intergenic
1082901527 11:58258611-58258633 GCAACTTTGATGGAACTGGAGGG - Intergenic
1083416472 11:62528994-62529016 GCTTCTGTGCCAGAACTGGAAGG - Exonic
1084514574 11:69629527-69629549 TCAGCTTTGCTGGAAAGGGAAGG - Intergenic
1087977530 11:104568069-104568091 GTTTCTTTGCTGAAATGGCAAGG - Intergenic
1088863244 11:113821644-113821666 CCTTCTTTTCTGGGAAGGGAGGG + Intronic
1090351209 11:126109795-126109817 TCCTCTTTGCTGGAACGGTGGGG - Intergenic
1090622145 11:128569752-128569774 GCTTCTTTGCTTGCTCTGGAAGG + Intronic
1091243540 11:134070852-134070874 GCTTTTTTGCTGGTAGGGGCTGG + Intronic
1092852605 12:12644331-12644353 GCTCCTTCACTGGAAAGGGAAGG - Exonic
1098332735 12:69371819-69371841 GCATCTTTGGTGGGACGAGATGG + Intronic
1101711338 12:107269492-107269514 CCTTCTTTGATGGCAGGGGAAGG + Intergenic
1104190607 12:126479149-126479171 GCTTCTTTCCTGGCCAGGGAAGG + Intergenic
1106605570 13:31225533-31225555 GGTTCTTTTCTGGAATGGGTTGG + Intronic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1109536404 13:63726925-63726947 TCTTCATTGCTTGAACGGAATGG + Intergenic
1110504286 13:76267482-76267504 GCTTCTTTCCTAGAAGGAGAAGG + Intergenic
1114722850 14:24900778-24900800 GCTTCTGTCCTGGATGGGGAGGG - Intronic
1120381715 14:83789202-83789224 GCTTCTTTTCTGGAGGGAGAAGG + Intergenic
1129164368 15:73767969-73767991 GCTTCTATGGAGGAACCGGAGGG - Intergenic
1130285960 15:82554706-82554728 GCCTCTTTGCTGAAAGAGGAGGG - Intronic
1134829918 16:17314614-17314636 CTTTCTTTCCTGGAATGGGAGGG - Intronic
1135066111 16:19311464-19311486 GCTTCCTTGTTGGTACTGGAGGG - Intronic
1135913714 16:26584080-26584102 GCTTCTCTGCTGGAAAGAGAAGG + Intergenic
1138152349 16:54670327-54670349 GGTTCTTTGTAGGCACGGGATGG + Intergenic
1140038208 16:71387437-71387459 GCACCTGTGCTGGAACGGAAGGG + Intronic
1140949930 16:79807234-79807256 GCTTCTTTTCTGGGACGTGGTGG - Intergenic
1141314480 16:82948553-82948575 GAATCTTTGCTGGAAAGTGAAGG + Intronic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG + Intronic
1143562073 17:7702330-7702352 GCTTTTTTGCTAGAGAGGGAAGG - Exonic
1146354853 17:32125408-32125430 GCTCCTTTGCTGGAACACAAGGG + Intergenic
1146636387 17:34508734-34508756 GCTTCTTTGTTAGAAAGGAAAGG - Intergenic
1148687049 17:49506847-49506869 GGTTCTTTGCTGAGACAGGATGG - Intronic
1148916713 17:50987229-50987251 GAGTCATTGCTGGAAAGGGAGGG + Exonic
1151076870 17:71283743-71283765 ACTTCTTTGCTGAAACGGCTTGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153428001 18:4987635-4987657 GACTCTTTGGTGGAAAGGGATGG - Intergenic
1156019704 18:32585985-32586007 GCCTATTTGCAGGAACTGGAGGG - Intergenic
1161099682 19:2415535-2415557 GCTTCTTGTGTGGAACGGGAGGG + Intronic
1162668896 19:12237996-12238018 GCTACTGGGCTGGAACAGGAGGG + Intronic
1164661188 19:29970149-29970171 TTTTTTTTGCTGGGACGGGATGG + Intronic
926342994 2:11920242-11920264 GCTGCTCTGCTGGTATGGGATGG + Intergenic
937138726 2:119578761-119578783 GCTTCTTTTCTGGAAAAAGAAGG - Intronic
940040073 2:149350940-149350962 GCTTATTTCCAGGAACTGGACGG + Intronic
1169347209 20:4838265-4838287 GCATCTTTGGTGGAGAGGGACGG + Intergenic
1170847572 20:19975118-19975140 GCTTCTTTTCTGGAAGCAGAGGG + Exonic
1172846395 20:37931983-37932005 GCTTATTTGGGGGAACGGGCAGG + Intronic
1175014337 20:55772714-55772736 GCATTTTTGCTGGAACAGAATGG + Intergenic
1175168236 20:57061513-57061535 GATTCTTTGCTGAAAGGGAACGG + Intergenic
1179614282 21:42571724-42571746 GTTTCTTGGCTGGAAAGTGAAGG - Intronic
1180998163 22:19975749-19975771 CCTTCTTTCCTGGAAGGGAAAGG + Exonic
1181287734 22:21766398-21766420 GGTTCTTTGCTGGTTGGGGAGGG - Intronic
1181982684 22:26776890-26776912 GGTTCTTTGCTGCAAGAGGATGG + Intergenic
1184722109 22:46320912-46320934 GCTTCCATGGTGGCACGGGAAGG - Intronic
1184733385 22:46383475-46383497 GTTTTTTTGCGGGAAGGGGAAGG + Intronic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
955713811 3:61807834-61807856 GCTGCTTTGCAGGAACAAGAGGG - Intronic
959733620 3:109632206-109632228 GCATCTCTGCTGGAAGGAGAAGG + Intergenic
960049870 3:113229057-113229079 GCTTCATTCCTGGACTGGGAGGG + Intronic
960950869 3:122997666-122997688 GCATCTTTGCTGCAGAGGGAGGG - Intronic
961555770 3:127695956-127695978 GGTTCTGTGCTGGAAAGCGAGGG + Intronic
964016208 3:151950224-151950246 TGTTCTTTGCAGGAACAGGATGG + Intergenic
973105012 4:46324717-46324739 GCTTATTTGATGGAGAGGGAGGG - Intronic
974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG + Intergenic
986742139 5:10713545-10713567 GCTTCTTAGCTGGAAAGTGGGGG - Intronic
991111025 5:62899603-62899625 GCTTCTTTGTTGCACCGTGAGGG - Intergenic
992425916 5:76657337-76657359 GCATCTTTGCTGGAAATAGAAGG + Intronic
992493931 5:77272828-77272850 GTTTCTGTGCTGGGAAGGGAGGG + Intronic
996494760 5:124141061-124141083 GGTCCTTTGCTGGAATGGAAGGG - Intergenic
997460765 5:134050872-134050894 GCTTTTTTGCTGGGAAGGGGTGG - Intergenic
997719379 5:136065668-136065690 CCTTCTTTGGTGGGAGGGGAAGG - Intergenic
997787819 5:136729513-136729535 GCTCCTTTTCTGGACCAGGATGG + Intergenic
1002643279 5:180640634-180640656 GCTTCTTTCCTGAAAACGGAGGG + Intronic
1002864064 6:1105743-1105765 CCTTCTTTGCTGGCATGGGCTGG - Intergenic
1003178394 6:3771409-3771431 GCATGTTTGCTGGCAGGGGAAGG - Intergenic
1006298290 6:33179687-33179709 GCTGCTTCCCTGGAAAGGGAAGG - Intronic
1011411163 6:87067909-87067931 GCTTCTCTGCTGGGAGGAGAGGG - Intergenic
1011873559 6:91927131-91927153 GAGTCTTTGCAGGCACGGGATGG + Intergenic
1012928544 6:105292860-105292882 GCTTCTTTCCTGAAACCGTATGG + Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1029034974 7:97509814-97509836 GATTCTTTGCTGGATTGTGAAGG + Intergenic
1031951794 7:127900347-127900369 GCCTGTTTGTTGGCACGGGAGGG + Intronic
1032192378 7:129772360-129772382 CCTTTCTTGCTGGAGCGGGAGGG - Intergenic
1032736344 7:134695949-134695971 ACTTATATGCTGGAAAGGGAGGG - Intergenic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1033474740 7:141681025-141681047 GCTTTGTTGCTGGAAGGGGAGGG + Intronic
1035045139 7:155960586-155960608 GCTTCTTCCGGGGAACGGGAAGG - Intergenic
1036708557 8:11062525-11062547 GGGTCTTTGCTGGATCGGGCAGG - Intronic
1037485782 8:19345416-19345438 GCTTATTCGCTGAAACGGTATGG - Intronic
1037692289 8:21192233-21192255 GCAGCTTTGCTGGGACTGGATGG - Intergenic
1044766580 8:95582102-95582124 GCTGCTTTTCTGGAATGTGAAGG + Intergenic
1045917945 8:107495617-107495639 GATTCTTTGAGGGAACGGGAAGG - Intronic
1049093186 8:140532333-140532355 GCTGCTTTTCTGGAAGGGGAAGG - Intronic
1050173288 9:2844323-2844345 GCTTCCGTGCTGGAAAGAGAGGG + Intergenic
1053749856 9:41241816-41241838 GCTTCTTCCCTGGAATGGAAGGG - Intergenic
1054335950 9:63809454-63809476 GCTTCTTCCCTGGAATGGAAGGG + Intergenic
1057607972 9:96515219-96515241 GCTTCTTTGCTAGACTGGGAAGG + Intronic
1058458509 9:105160637-105160659 GCTGCTGTCCTGGAACAGGAGGG - Intergenic
1062393441 9:136343079-136343101 GCTTCTCTGCTGGCTGGGGAGGG - Intronic
1062661011 9:137633110-137633132 GGTTCTCTGCTTGAACGGAAGGG + Intronic
1203577268 Un_KI270745v1:19210-19232 GCTTTTTTCCTGCAACTGGATGG - Intergenic
1185986745 X:4843407-4843429 GCTTCAGTGCTGGATGGGGAGGG - Intergenic
1191714361 X:64184184-64184206 GCTTCTTTGCTGGCCTGGGAAGG + Intergenic
1201957264 Y:19639128-19639150 GCTTCATGGCTGAAACAGGAGGG - Intergenic