ID: 1143164740

View in Genome Browser
Species Human (GRCh38)
Location 17:4892253-4892275
Sequence AACGCCTGGGTGAGGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143164734_1143164740 -1 Left 1143164734 17:4892231-4892253 CCAGGTAATGCCTGGGTAGGGCA 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164731_1143164740 4 Left 1143164731 17:4892226-4892248 CCGTGCCAGGTAATGCCTGGGTA 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164728_1143164740 13 Left 1143164728 17:4892217-4892239 CCAGGCAGTCCGTGCCAGGTAAT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164723_1143164740 23 Left 1143164723 17:4892207-4892229 CCCGGCCAGCCCAGGCAGTCCGT 0: 1
1: 0
2: 1
3: 17
4: 225
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164725_1143164740 18 Left 1143164725 17:4892212-4892234 CCAGCCCAGGCAGTCCGTGCCAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164724_1143164740 22 Left 1143164724 17:4892208-4892230 CCGGCCAGCCCAGGCAGTCCGTG 0: 1
1: 0
2: 7
3: 29
4: 255
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128
1143164727_1143164740 14 Left 1143164727 17:4892216-4892238 CCCAGGCAGTCCGTGCCAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143164740 Original CRISPR AACGCCTGGGTGAGGTCTGA GGG Intronic
900742314 1:4338238-4338260 AACCCATGGGTGAGTTCTGCAGG + Intergenic
900770897 1:4543254-4543276 AAAGCCTGGGTGATTTCTTAAGG - Intergenic
900786154 1:4652007-4652029 TAAGCCTGGGTGAGGGCAGAGGG + Intergenic
900989252 1:6090504-6090526 TAGGCCTGGGCGGGGTCTGAAGG + Intronic
901290853 1:8123231-8123253 AACACTTGGGTGGGGTCTGAGGG - Intergenic
901433445 1:9232399-9232421 AACGTTGGGGTGGGGTCTGAGGG - Intergenic
902229218 1:15016824-15016846 AAGACCTGTGTGAGGCCTGAAGG - Intronic
902721089 1:18304434-18304456 TTGGCCTGGGTGATGTCTGAAGG - Intronic
912387257 1:109277701-109277723 CACACCTGGGTGAGGCCAGAAGG - Intergenic
913560678 1:120015740-120015762 ACCTCCTGGCTGAGGTCTGATGG + Intronic
913637448 1:120777858-120777880 ACCTCCTGGCTGAGGTCTGATGG - Intergenic
914281261 1:146175155-146175177 ACCTCCTGGCTGAGGTCTGATGG + Intronic
914542306 1:148626090-148626112 ACCTCCTGGCTGAGGTCTGATGG + Intronic
914624328 1:149445152-149445174 ACCTCCTGGCTGAGGTCTGATGG - Intergenic
915488917 1:156240903-156240925 AGAGCCTTGGTGAGGTCTGCTGG + Intronic
916563630 1:165954566-165954588 AACCCCTGGGTGAGGGCTGATGG + Intergenic
916585311 1:166144835-166144857 AACCCCTGGGTGAGGTGCCATGG - Intronic
916888840 1:169097027-169097049 TAGGCCTGTGTGAGGACTGAGGG + Intergenic
918081833 1:181213803-181213825 AAAGCCTGAGTGAGAACTGAGGG - Intergenic
919686949 1:200492630-200492652 AATGCGTGGGTGAGGTTTCAAGG - Intergenic
919936587 1:202254959-202254981 AAAGCCTGAGTGAAGTGTGAAGG + Intronic
920811288 1:209288211-209288233 AAGGCCAGGGTGAGGACAGAGGG + Intergenic
920971631 1:210748195-210748217 CACGCCCTGGGGAGGTCTGAAGG - Intronic
922850597 1:228730371-228730393 AGGGGCTGGGTGAGGGCTGAAGG + Intergenic
924514906 1:244757862-244757884 AAGGCCTGGGGCAGTTCTGAGGG - Intergenic
1064052922 10:12073583-12073605 AAAGCCTGGTTGAGGGCAGATGG - Intronic
1066368777 10:34801594-34801616 AACTCCTGGGTGAAGTCTTCAGG + Intronic
1067830037 10:49606317-49606339 AGTGCCTGGGTGAGGTCTAGGGG - Intergenic
1069372998 10:67766865-67766887 AATGCATGTGTAAGGTCTGAAGG - Intergenic
1069873448 10:71547255-71547277 CAGGCCTGGGTGAGATGTGAAGG + Intronic
1070849362 10:79551175-79551197 GAGGCCTGGGTGAGGTTTGCAGG + Intergenic
1073182915 10:101596594-101596616 AAGGCCTGAGTGTGGACTGATGG + Intronic
1075474743 10:122724460-122724482 AGAGCCTGGGTGGGGTCTGTGGG - Intergenic
1083297498 11:61722962-61722984 TACGTCTGGGTGAGGCCTGCTGG + Intronic
1083804710 11:65066899-65066921 AAAGCCTGGCTGAGGTGGGAGGG - Intronic
1084965155 11:72740845-72740867 AGGGCCAGGGTGGGGTCTGATGG - Intronic
1089365887 11:117920774-117920796 ATCGGCTGGGTGTGGTCTGGTGG - Intronic
1094524801 12:31224537-31224559 TGCGCCTGGGTCAGGTCTGCAGG - Intergenic
1094830936 12:34299943-34299965 AGCCCCTGCGTGGGGTCTGAGGG + Intergenic
1094838986 12:34335121-34335143 CACGCATGTGTGGGGTCTGAGGG + Intergenic
1097404979 12:59177997-59178019 AACTCCTGGGTGTTGTGTGAGGG - Intergenic
1100213381 12:92421694-92421716 AACTCCTGGTTTAAGTCTGAAGG - Intronic
1101523064 12:105502813-105502835 TACACCTGGGTGAGGTGTGAAGG + Intergenic
1112870597 13:103965957-103965979 AAAGTCTGTGTGAGCTCTGAAGG + Intergenic
1121425410 14:93847220-93847242 AATGCCTGGGTGATGGCTGCTGG - Intergenic
1122795823 14:104205710-104205732 GGGGGCTGGGTGAGGTCTGAGGG + Intergenic
1122811069 14:104288248-104288270 AGCTCAGGGGTGAGGTCTGAGGG - Intergenic
1131047170 15:89323634-89323656 AAAGCCTGGGTGAGACCTCATGG - Intronic
1133570487 16:7035276-7035298 CAAGCCTGGGTGAGGAATGAAGG - Intronic
1138058417 16:53861182-53861204 AATGCCTTGGTGAGGTATTATGG + Intronic
1138445623 16:57061404-57061426 AGAGCCTGGGTGAGGCCTGTGGG - Intronic
1138532134 16:57640134-57640156 GTCACCTGGGTGAGTTCTGATGG + Intronic
1141241990 16:82273212-82273234 AACTCCTGGCTGGTGTCTGATGG - Intergenic
1141753507 16:85975593-85975615 AACCCCAGGGTGAGGGGTGAGGG + Intergenic
1142020716 16:87780457-87780479 AACACCTTGGTGGGGTCTCAGGG - Intergenic
1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG + Intronic
1143253386 17:5538453-5538475 GACGTCAGGCTGAGGTCTGAAGG - Intronic
1144635842 17:16908494-16908516 TTGGCCTGGCTGAGGTCTGAGGG - Intergenic
1145121925 17:20267837-20267859 CTGGCCTGGCTGAGGTCTGAGGG - Intronic
1146306917 17:31737102-31737124 ACCCCCTTGGTGAGGTCAGAAGG + Intergenic
1146401570 17:32504154-32504176 CAGGCTTGGGTGAGGTCTCAGGG - Intronic
1147255340 17:39177869-39177891 AACACCTGGGTCAGGCCTGTGGG - Intronic
1147556873 17:41485382-41485404 ATGGCCTGGGAGAGGTCTGAGGG - Intergenic
1151451928 17:74203382-74203404 AAAGCCAGGCTGGGGTCTGAGGG + Intergenic
1152595847 17:81237241-81237263 CAGGCATGGGTGGGGTCTGAAGG - Intronic
1160592675 18:79952660-79952682 GGCGCCTGGGTGAGGGGTGAGGG + Intergenic
1160716649 19:579807-579829 AACCCCAGGGAGGGGTCTGAGGG + Intronic
1162151040 19:8645805-8645827 AGAGCCTTGGTGAGGTCTGGTGG + Intergenic
1162698358 19:12495185-12495207 AACGCCAGTGTCCGGTCTGAGGG + Intronic
1165282272 19:34807517-34807539 GAGGGCTGGGTCAGGTCTGAGGG - Intergenic
1168348083 19:55660498-55660520 AACGACTGGGGGAGGTGGGAGGG - Exonic
924978078 2:196104-196126 AACACCTGGGTGAGGCATGGAGG + Intergenic
925146038 2:1584208-1584230 CAGGCCTGGGTGAGTTCTCAGGG - Intergenic
926329407 2:11812402-11812424 AGTGCCTGGGTGAGGAGTGAGGG + Intronic
926404584 2:12538131-12538153 ACAGCCTGGGTGAGGATTGAGGG + Intergenic
927558737 2:24053962-24053984 AAGGACTGGGTGGGGGCTGAGGG - Intronic
931719543 2:65056911-65056933 CACGCCCGGGAGAGGCCTGAGGG - Intronic
931990605 2:67786245-67786267 ATCCCCTTGGTGAGGTATGATGG + Intergenic
934771209 2:96908615-96908637 AACGCCTGGCAGGGGCCTGATGG + Intronic
939166985 2:138650762-138650784 AACCCGAGGGTGAGCTCTGATGG + Intergenic
947977315 2:234378005-234378027 AACTCCTGGGTAAGTTTTGATGG + Intergenic
1173674056 20:44818448-44818470 AACCACTGAGTGAGGTCTGCGGG - Intergenic
1174447267 20:50598406-50598428 AAGGCCTGGGTGGGGTGTGCTGG - Intronic
1176021195 20:62963266-62963288 AAGGCCAGGATGAGATCTGAGGG - Exonic
1176098717 20:63355537-63355559 AAGGCCAGGATGGGGTCTGATGG + Intronic
1178568917 21:33716453-33716475 AACTGCTGGGTGGGGTGTGAAGG - Intronic
1179627079 21:42654604-42654626 AACGCCCAGCTGAGGTTTGAGGG - Intronic
1182058622 22:27380738-27380760 AGCTCCAGGGTGGGGTCTGAGGG - Intergenic
1183653876 22:39174116-39174138 AACACCTCTGTGAGGTGTGAAGG + Intergenic
1184279612 22:43429520-43429542 GACACCTGGGTGAGATCTGAAGG - Intronic
1184644209 22:45887679-45887701 AAGGCCTGGCCGAGGTCTGCAGG - Intergenic
950837680 3:15936278-15936300 AAGGCCTGGGTAGGGGCTGAGGG - Intergenic
951350013 3:21595155-21595177 AAATACTGGGTGGGGTCTGATGG - Intronic
961706650 3:128791983-128792005 AACACCTGTGTGAGGGTTGATGG - Intronic
964917019 3:161851568-161851590 AACACTTTGGTGAGGCCTGATGG + Intergenic
968839285 4:2990174-2990196 AAGGACTGGGAGAGATCTGAGGG - Intronic
969446252 4:7246352-7246374 AAGCCCTGGGTGAGATCTGTGGG - Intronic
971877780 4:32326919-32326941 AACGGCTGCCTGAGGTCTCAAGG - Intergenic
972286590 4:37655069-37655091 AACCCCTTTGTGAGGTCTGATGG + Intronic
974396456 4:61342459-61342481 AACTTCTGGGTGATCTCTGAGGG + Intronic
978346922 4:107780635-107780657 AAGTCCTAGCTGAGGTCTGAGGG + Intergenic
981573260 4:146176030-146176052 AATGGCTGGGAGAGGTCTGATGG + Exonic
983437101 4:167730088-167730110 TAGGCCTGGCTGAGATCTGATGG + Intergenic
985043311 4:185914932-185914954 AAAGCCTGGGTTATGTCTAATGG + Intronic
990325889 5:54674950-54674972 AACAGCCGGGTGAGGCCTGAAGG + Intergenic
991343562 5:65638790-65638812 TACGCCTGGCTGAGATCTGATGG - Intronic
992052766 5:72956256-72956278 CCCGCCTGGGTGAGGTCCGGCGG + Intronic
997204163 5:132031835-132031857 GAAGCCTGGGTGAGGAATGAGGG + Intergenic
998565253 5:143210868-143210890 AAGGCCCAGCTGAGGTCTGAAGG + Intronic
1000426759 5:161100200-161100222 AAGGCCAGAGTGATGTCTGAAGG - Intergenic
1002406119 5:179033339-179033361 AACGCCTGAGTGGGAACTGAAGG - Exonic
1004127551 6:12888094-12888116 AATGGCTGGGTGAGGTCTTTGGG + Intronic
1005365283 6:25070196-25070218 AATGCCTGGGTGAGATAGGAAGG + Intergenic
1005367119 6:25089710-25089732 AAGGCATGGGTGGGGTCTGGAGG + Intergenic
1007514975 6:42403924-42403946 AAGGCCTGGGGGGGGTCTCATGG - Intronic
1010926902 6:81754212-81754234 AACACATGGGTGTGCTCTGAAGG - Intergenic
1013394389 6:109719970-109719992 AAACTCTGGGTGAGGGCTGAAGG + Intronic
1017254361 6:152316247-152316269 CAGGCCTGGGTGAGGGCTGAGGG + Intronic
1018820046 6:167367343-167367365 AGCCCCTGACTGAGGTCTGACGG + Intronic
1019512692 7:1425967-1425989 AAAGGCTGGGAGAGGTCAGAGGG - Intergenic
1024667747 7:51563412-51563434 AACTCCTTTGTGAGGTCTAAGGG - Intergenic
1026612516 7:71872934-71872956 AATGACTGGGTAAGGTTTGAAGG + Intronic
1029295018 7:99533599-99533621 GACTCCTGGGTGAGGTGAGATGG - Exonic
1029682634 7:102122497-102122519 GATGCCTGGGTGAGCCCTGAAGG + Intronic
1034164609 7:149015833-149015855 GACCCCTGGGTGTGGTCTGGGGG - Intronic
1034539393 7:151746664-151746686 AAAGCCTGGGTGAGGACTGAAGG + Intronic
1034952820 7:155312624-155312646 GACCCTTTGGTGAGGTCTGAGGG - Intergenic
1035546881 8:488391-488413 AATGGCAGGGTGAGGGCTGATGG + Intergenic
1035555310 8:563146-563168 CACCCCTAGGTGATGTCTGATGG - Intergenic
1036283025 8:7417552-7417574 CAGGCCTGGGTGAACTCTGAGGG - Intergenic
1036338444 8:7893967-7893989 CAGGCCTGGGTGAACTCTGAGGG + Intergenic
1039416156 8:37395833-37395855 ATCAGCTGGGTGAGGGCTGAGGG + Intergenic
1041334086 8:56760286-56760308 AACTTCTGGCTGACGTCTGAGGG - Intergenic
1045847742 8:106657880-106657902 CTCCCCTGGGTCAGGTCTGATGG + Intronic
1052712611 9:32075190-32075212 CATGCCTGGCTGAGATCTGATGG - Intergenic
1053073832 9:35116248-35116270 ACCGCCCGGGTGAGGCGTGAGGG - Intronic
1053358393 9:37465837-37465859 AACGACTGCGTGATGTCTGAGGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG + Intergenic
1061217778 9:129231657-129231679 AACCCCAAGGTGAGGTCTCATGG + Intergenic
1062023888 9:134331725-134331747 GAACCCTGGGTGAGGTCTGTGGG + Intronic
1062171005 9:135134565-135134587 ATCCTCTGGGTGAGCTCTGACGG - Intergenic
1189479323 X:41380862-41380884 TGGGCCTGGGTGAGGTTTGAGGG + Intergenic
1190597057 X:52061124-52061146 AAGGGCTGGGTGATGTCTGGAGG - Intergenic
1190611767 X:52192949-52192971 AAGGGCTGGGTGATGTCTGGAGG + Intergenic