ID: 1143167185

View in Genome Browser
Species Human (GRCh38)
Location 17:4902639-4902661
Sequence CAGGGTGACCTTGAGGCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143167181_1143167185 -4 Left 1143167181 17:4902620-4902642 CCAGTGAGATGAGATTCGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG 0: 1
1: 0
2: 4
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143167185 Original CRISPR CAGGGTGACCTTGAGGCTGA TGG Exonic
900799683 1:4729452-4729474 CAGGGTGACCTCGAGACTCACGG + Intronic
901231975 1:7646483-7646505 CATGGTGACTGTGAGGGTGAGGG + Intronic
901821659 1:11834319-11834341 CAGGATGACCGTGAGGCTGATGG - Exonic
904493288 1:30873171-30873193 CAGGGTGGTGTTGAGGCTGCAGG + Exonic
905425746 1:37882899-37882921 CAGTGTGATCTTGTGGCTGGGGG - Exonic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
912431430 1:109630348-109630370 CAGGGAGACCATGAGGCCGCGGG - Exonic
913148987 1:116021596-116021618 CAGGTTGACCGTGTGACTGATGG + Intronic
914932311 1:151946049-151946071 CAGAGACACCTTGGGGCTGAGGG + Intergenic
915119149 1:153617670-153617692 CAGAGGAACCTTTAGGCTGAGGG - Intergenic
917794398 1:178522161-178522183 CAGGCAGAACTCGAGGCTGAGGG - Intronic
920281819 1:204849302-204849324 GATGGTGACCTTGATGGTGATGG - Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920674243 1:208028312-208028334 CATGCTGAGGTTGAGGCTGAAGG + Intronic
920848592 1:209613248-209613270 CAGGGAGACCTGGAAGCTGGTGG - Exonic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
922852674 1:228747333-228747355 CAGGATGACCTTGAGGCTGGAGG - Intergenic
923510679 1:234649702-234649724 CAGGGTGTCCTGGAGTCTAAAGG + Intergenic
924330161 1:242933624-242933646 CAATGTGACCTTGAGCATGAAGG + Intergenic
1063262732 10:4408521-4408543 CAGGGAGACCCTGAGGGTCAGGG + Intergenic
1063754770 10:8995159-8995181 CTGGGTGAACTGGTGGCTGAGGG - Intergenic
1067065589 10:43102363-43102385 CAGGAAGACCTTGAGGTAGACGG - Exonic
1067447095 10:46357804-46357826 CAGGTTGAGCTTGGGGCTGGTGG - Intergenic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1069355901 10:67584779-67584801 CAAGGTGACAGTGAGGCTCAGGG - Intronic
1069883457 10:71608662-71608684 CAGCGTGGCCTTGAGGATAAGGG - Intronic
1070195736 10:74154871-74154893 TAGGCAGAACTTGAGGCTGAAGG - Intronic
1070303684 10:75224743-75224765 CAAGGTGGCTTTGAGGCTGGTGG - Intronic
1071510864 10:86261795-86261817 CAGGATGACCTGGATGCTGGTGG - Intronic
1071607705 10:87008947-87008969 CAGGTTGAGCTTGGGGCTGGTGG - Intergenic
1073119489 10:101112926-101112948 CAGGGCGACGTGGGGGCTGAGGG - Intronic
1074472611 10:113741162-113741184 CAGGATGACCTCAAGGCTTATGG + Intergenic
1075602606 10:123781421-123781443 CTGGGGGACCTCGAGGCAGATGG - Intronic
1075967465 10:126625174-126625196 CAGCGTGGGCTTGAGGCTGACGG - Intronic
1076963701 10:133787280-133787302 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1076963711 10:133787310-133787332 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1077296866 11:1830451-1830473 CAGGGTCTCCATGAGGCTGCTGG + Intronic
1078279887 11:9890795-9890817 CAGGGTGACCCTGAGGTGCATGG + Intronic
1079104058 11:17559185-17559207 CAGGGAGGCCTTCAGGCTGTGGG + Intronic
1081598339 11:44474682-44474704 CAGGGTCACCTTGCTGATGAGGG - Intergenic
1081678568 11:44985880-44985902 CAGGGAGAACTTGGGGCTGGAGG + Intergenic
1081753268 11:45527310-45527332 GTGGGAGACCTTGTGGCTGAGGG + Intergenic
1082652412 11:55809560-55809582 CAAAGTCACCTTGATGCTGAGGG + Intergenic
1083354620 11:62056978-62057000 CAGGCTGGTCTTGAGGCTCAAGG + Intergenic
1084545025 11:69810906-69810928 GAAGGTGACCTTTAGGCAGAAGG - Intronic
1084957243 11:72697868-72697890 TAGGGTGCCCTGGAGGCTGGGGG + Intronic
1089085661 11:115815026-115815048 CAGGGGGAACTGGAGGCTCAAGG + Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1090279696 11:125445322-125445344 CACGGGGACCTGGAGGCTCAGGG - Intergenic
1090603456 11:128396251-128396273 CAGGGTGGCAATGAGGCTGGGGG - Intergenic
1090666469 11:128918122-128918144 CAGGCTGAACTTGATGGTGAAGG - Exonic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091883458 12:3998621-3998643 CAAGGTGAACCTGAGGCTCAGGG - Intergenic
1092171071 12:6374424-6374446 GAGGTTGATGTTGAGGCTGACGG + Exonic
1095961783 12:47839463-47839485 CAGGGAGCCCGTGAGGCTGATGG - Intergenic
1096110921 12:49028797-49028819 TAGGGGTACCTCGAGGCTGAGGG - Intronic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1096599053 12:52716491-52716513 CAGGATGACCCAGAGGCTGTGGG - Intergenic
1098188782 12:67926158-67926180 CAGGCAGACCCTGTGGCTGAGGG - Intergenic
1098708768 12:73726721-73726743 CAGAGGGACCTTCAGCCTGAAGG - Intergenic
1099480612 12:83161018-83161040 CAGCTTCAACTTGAGGCTGAAGG + Intergenic
1099512455 12:83554820-83554842 CAAGGTGGCATTGAGGCTGGGGG - Intergenic
1100684146 12:96967271-96967293 CAGGGTGAACTAGAGGTAGAAGG - Intergenic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1102830246 12:115991615-115991637 CAGGGTAACATAGAGGCTGTGGG + Exonic
1103546189 12:121703253-121703275 CAGAGGCAACTTGAGGCTGAAGG + Intergenic
1103988454 12:124782570-124782592 CCAGGTGAAGTTGAGGCTGAAGG + Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104925116 12:132309951-132309973 CCGGGTGACCTCGCCGCTGAGGG + Intronic
1105210204 13:18253001-18253023 CAGGGTGAGCTGGAGGCCTACGG + Intergenic
1106180300 13:27363904-27363926 CAGGGTGGCTTTGAGCCTGTAGG + Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1107328763 13:39274201-39274223 TGGGGTGGACTTGAGGCTGACGG - Intergenic
1107870980 13:44746318-44746340 CAGGGTTTCCTTTAGGCAGAGGG + Intergenic
1110461537 13:75750771-75750793 CCAGGTGACCCTGATGCTGATGG + Intronic
1110965083 13:81684652-81684674 CGGGGTGACCTTGTGTGTGATGG - Intergenic
1117319361 14:54606494-54606516 CAGGCTGCACTTGAGGCTGCAGG + Intronic
1117952593 14:61097978-61098000 CAAGGTGACAGTGAGGCTGGGGG - Intergenic
1118938500 14:70310787-70310809 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1119508952 14:75196369-75196391 CAGGGTCACCTGGGGGCTGTGGG - Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120606411 14:86583882-86583904 CAGGCTGACCTTTAGGGTGGAGG + Intergenic
1120670811 14:87360433-87360455 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1122069581 14:99196917-99196939 CATGGTGATGTTGAGGCTCAGGG + Intronic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122946671 14:105014161-105014183 CAGGGAGATCTTGGGGGTGAGGG + Intronic
1125406726 15:39359940-39359962 TAGTGTCACATTGAGGCTGATGG + Intergenic
1125520953 15:40347593-40347615 AAGGGTGACTAGGAGGCTGAGGG + Intergenic
1126968680 15:54084848-54084870 AATTGTGATCTTGAGGCTGAGGG - Intronic
1128131063 15:65227504-65227526 CAAGGTGACCTTGACCCTGTGGG - Intergenic
1129703784 15:77783063-77783085 AGAGGTGACTTTGAGGCTGAAGG - Intronic
1132710312 16:1263417-1263439 CAGGGTGACCATGAGGATAGGGG + Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1132722568 16:1323964-1323986 CAGTGTGACCCTGAGGATGGGGG - Intronic
1133143638 16:3767283-3767305 CAGGGTGACTTGGAGGCAGAAGG - Intronic
1133997993 16:10762407-10762429 CTGAGTGGCCCTGAGGCTGAAGG + Intronic
1134005190 16:10814429-10814451 CAGGGTGACACTCAGGCTGGTGG - Intronic
1135941098 16:26822559-26822581 CAGGGTGACCCTGAGGCTGCAGG + Intergenic
1136428003 16:30182191-30182213 AGGGGTGACCTGTAGGCTGAGGG - Intergenic
1136932538 16:34432209-34432231 CAGGTAGCCCTTGAGGCTGCCGG - Intergenic
1136972034 16:34979605-34979627 CAGGTAGCCCTTGAGGCTGCCGG + Intergenic
1137604640 16:49779416-49779438 CAGGGTGATGTTGATGCTGCTGG - Intronic
1139347606 16:66314319-66314341 CTGGGGGAACTGGAGGCTGATGG - Intergenic
1140041826 16:71413238-71413260 CCAGGTGACCTTGATGCTGGTGG - Intergenic
1141168790 16:81678192-81678214 CAGGGAGGCCTTTAGTCTGATGG + Intronic
1141646294 16:85369867-85369889 CAGAATGACCGTGAGGCTGAGGG - Intergenic
1141993575 16:87623354-87623376 CAGGGTGGGCGTGAGGCTCATGG + Intronic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1144578410 17:16444116-16444138 CAGGACAGCCTTGAGGCTGAAGG + Exonic
1145231676 17:21177704-21177726 CAGGGAGTGCTTGAGGCAGAGGG - Intronic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1149911576 17:60571755-60571777 CAGGGTAACCCTCAGGCAGAGGG + Intronic
1150561581 17:66300036-66300058 CAGGGGGACCCAGAGGCTGGAGG - Intergenic
1150578092 17:66447713-66447735 CAGGGGGCCCTGGAGGCTGTTGG - Intronic
1150893177 17:69178401-69178423 CCGGGTGACGTTGATGCTGCTGG - Intronic
1152076139 17:78161129-78161151 GAGTGTGACGTTGAGGTTGAAGG - Exonic
1152400459 17:80063468-80063490 CATGGTGCCCCTGAGGCTGCCGG - Intronic
1152504764 17:80741528-80741550 CAGGAGGACCATGAGGCTGGAGG + Intronic
1152590892 17:81211467-81211489 CTTGGTGACCTGGAGGCTGCTGG + Intronic
1152640544 17:81447500-81447522 CCGGGTGCCCTTGAGGACGAGGG + Exonic
1152796297 17:82309251-82309273 CTGGGTGCCCTTGAGGCTCATGG - Intergenic
1155873886 18:31061137-31061159 CAGGGTGATTCTGATGCTGATGG + Exonic
1156334134 18:36153022-36153044 GTGGGTGACTTTGAGGCTGGTGG + Intronic
1156362850 18:36399594-36399616 CAGGCTGCCCTTGGGGCTCAGGG + Intronic
1156473101 18:37389693-37389715 CAGTGTGACAGTGAGGCTGCAGG - Intronic
1157555341 18:48609884-48609906 CTGGGTGACCTTGAGGGTGTGGG + Intronic
1158505728 18:58044568-58044590 CGGGGGGACCTGGAGGCAGAGGG + Exonic
1159694701 18:71541119-71541141 CAGGGTCACTGTGATGCTGATGG - Intergenic
1161259390 19:3328417-3328439 CAGGGTGACTTTGTGGGTGGTGG - Intergenic
1161288568 19:3480747-3480769 AGGGGTGGCCCTGAGGCTGATGG - Intergenic
1162554913 19:11380922-11380944 CAGGATGACCACGAGGATGAGGG + Exonic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1163698087 19:18774109-18774131 CAGTGTGACCTTGTGGCTGCTGG - Intronic
1166219844 19:41357308-41357330 CAGGGAGACATTGAGGATCAAGG - Intronic
1166277119 19:41761761-41761783 CAGGATGTCCTTAAGGCTCAGGG + Intronic
1166813486 19:45527913-45527935 CAGGGGGACCTCTGGGCTGAGGG + Exonic
1166835447 19:45664890-45664912 CAGTGTGACCGTGGGGGTGAGGG + Intergenic
1166912726 19:46171756-46171778 CAGGGTGAGCTTCATACTGATGG - Intergenic
1168326616 19:55541818-55541840 CAGGTTGAGGTTGAGGATGATGG - Intronic
1168557678 19:57356813-57356835 AAGTGTGTCCTTGCGGCTGAAGG - Exonic
1168720007 19:58549647-58549669 CAGGGTGAGTGTGAGGCTGGTGG + Exonic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
926105315 2:10146153-10146175 GATGGCGACCTTGAGGCTCAGGG + Intronic
927483039 2:23469264-23469286 CATGGTGACCTGGAGGGTGTTGG + Intronic
927627515 2:24737585-24737607 CAGAGTTAACTTGAGGCAGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
929488837 2:42378677-42378699 CAGTGTGGCCTTGAAGGTGAAGG - Intronic
932035677 2:68244410-68244432 GAGGTTGACATTGAGCCTGAGGG - Intronic
932743853 2:74314800-74314822 CAGTGTCTCCTTGAGGCTGGTGG - Intronic
934951410 2:98578258-98578280 CAGTGTGACCCTGGTGCTGAGGG + Intronic
935189434 2:100764647-100764669 CAGTGTGAGTTTGAGTCTGAAGG - Intergenic
935330550 2:101974473-101974495 CAGAGTGACCTTGAGCCTTGAGG + Intergenic
935727548 2:106037112-106037134 CAGGGTGACGTTGATGCTTTCGG - Intergenic
936400419 2:112160373-112160395 AGGGGTGACATTGAGGCTGAGGG - Intronic
937330707 2:121026516-121026538 CTGGGTGACTGTGTGGCTGAAGG - Intergenic
937874132 2:126808134-126808156 CAGGGTGACATTTAGGGTTATGG + Intergenic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938103633 2:128514764-128514786 CAGGGAGAGGTCGAGGCTGAAGG - Intergenic
938141545 2:128798743-128798765 AAGGGTGGGCTTGGGGCTGAGGG + Intergenic
938314406 2:130316021-130316043 CAGGGTGTGCTTGGAGCTGAGGG + Intergenic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
940337663 2:152546108-152546130 CTGGGTGCCCTTGTGCCTGATGG + Intronic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
942088069 2:172462061-172462083 CAGCTTTACCTTGAGGATGAAGG + Intronic
944191680 2:197010287-197010309 CTCGGTGACCGTGGGGCTGAGGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944919472 2:204396312-204396334 CCGGGTGACCTTGAGTATGAAGG + Intergenic
945687570 2:212990881-212990903 CAGTGTGACCTTGAGCATCATGG + Intergenic
946312840 2:218892476-218892498 CAGGGGGCCCTTGGGGCTGGAGG - Intronic
946419776 2:219558188-219558210 CAGGATGACATTGAAGGTGATGG + Exonic
946440278 2:219689282-219689304 CAGGGAGCCCTGGAGCCTGAGGG - Intergenic
948499181 2:238379159-238379181 CAAGGTTACCTGGAGGCTGCTGG + Intronic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
1169507673 20:6230275-6230297 CCAGGTGACTTTGAGGCTGCTGG - Intergenic
1170206993 20:13809211-13809233 AAGGGTGCACTTGAGGATGATGG + Intronic
1171772131 20:29330900-29330922 CAAGGTGACAGTGAGGCTGGGGG + Intergenic
1171786651 20:29471860-29471882 CAAGGTGACAGTGAGGCTGGGGG - Intergenic
1172435493 20:34926243-34926265 CTCGGTGAGCTTGGGGCTGAAGG - Exonic
1172526357 20:35602316-35602338 CAGGGTGGCCGTGAGGCTATCGG + Intergenic
1172991981 20:39043240-39043262 CAGGGCGATGTAGAGGCTGATGG - Intergenic
1174078887 20:47957168-47957190 CAGGGGCACCTGGAGGCTGCTGG - Intergenic
1175936680 20:62517460-62517482 CTGGGTGACCTTCAGCCTGTGGG + Intergenic
1176244897 20:64092860-64092882 GATGGTGACCTTGAGCCCGAGGG - Exonic
1176278372 20:64286996-64287018 CAGGGTGAGGGTGAGGGTGAGGG + Intronic
1176385839 21:6138215-6138237 CAGGGTGGCCTTGGGCCTGGGGG + Intergenic
1179251057 21:39671855-39671877 CAGATTGGCCTTGAAGCTGAAGG + Exonic
1179737634 21:43400037-43400059 CAGGGTGGCCTTGGGCCTGGGGG - Intergenic
1179878685 21:44284501-44284523 CAGGGGGACCCTGGGCCTGAAGG + Intergenic
1180083902 21:45498882-45498904 CAGGATGAACCTGGGGCTGAAGG + Intronic
1180184867 21:46134491-46134513 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180184907 21:46134623-46134645 CAGGGTGAGGGTGAGGGTGAGGG + Intergenic
1180337793 22:11594734-11594756 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1180723530 22:17927518-17927540 CAGGCTAACCTTGGGGCTGCAGG + Intronic
1181734600 22:24871763-24871785 GAAGTTGACCTTGAGACTGAAGG - Intronic
1183508388 22:38221661-38221683 CATGGTCTCCTTGAGGCTGCTGG + Exonic
1183770579 22:39922257-39922279 CAGGGTACCCTTGGGGCAGAAGG + Intronic
1184741303 22:46430460-46430482 AAGGGTGATCTTGAGGGTGGTGG - Intronic
1184878808 22:47292092-47292114 CTGGGTGAACTCGAGGCTGGTGG + Intergenic
1185001677 22:48250238-48250260 CAGGGTGGCTTTGAGGCTCAGGG - Intergenic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
950693710 3:14681550-14681572 CAGGGAGACTTAGATGCTGATGG - Intronic
951540775 3:23779963-23779985 CAGGGGGACATTGAGGCTAAGGG - Intergenic
952710646 3:36428969-36428991 TAGGGAGACCTTGAGGATGGCGG + Intronic
952749281 3:36812329-36812351 CAGGCTGATCATGAGGCAGAGGG + Intergenic
954368461 3:50158084-50158106 CAGGTGCACCTTGAGGGTGACGG + Intronic
954377286 3:50201895-50201917 CAGGGGCACCTTGAGGTTGCAGG - Intergenic
954398069 3:50303457-50303479 CCTGCTGACCTTGGGGCTGAAGG + Exonic
956144974 3:66183152-66183174 CAGGGTCAGCTTCAGGCTGAGGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956146692 3:66198036-66198058 CAGGGTCAGCGTCAGGCTGACGG + Intronic
956162810 3:66372782-66372804 CAGAGATACCTTCAGGCTGAGGG - Intronic
956459672 3:69458820-69458842 CAGTCTAACCTTGAAGCTGATGG + Intronic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
957597242 3:82283200-82283222 CAGTGTGACCTTACTGCTGAAGG + Intergenic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
959151195 3:102610313-102610335 CAGGGTGATATTGAGAGTGAGGG - Intergenic
959992515 3:112644732-112644754 CTGGGTGACCCTGAGGTTGCAGG + Intronic
961577989 3:127854136-127854158 GATGGTGACCTGGAGGCTGCAGG + Intergenic
962630729 3:137272814-137272836 CAGGGTCACCTCTAGGGTGAGGG + Intergenic
965651521 3:170938642-170938664 CAAGGTGACAGTGAGGCTGGGGG - Intergenic
966926152 3:184645857-184645879 CAGGAGGCCCCTGAGGCTGAGGG + Intronic
967759557 3:193208011-193208033 CAGAGTGACCTTGATTCTGAAGG - Intergenic
969038396 4:4274495-4274517 GAGGCTGACCTTGAGGCTGGTGG - Exonic
969224035 4:5782736-5782758 CTGGGTGATCTTGAGTGTGAGGG + Intronic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
976602565 4:86951284-86951306 CTGGCTGACCTTTAGGCTGGGGG - Intronic
976665692 4:87588437-87588459 CAGGGTGGCCTCGAAGCTGCAGG + Intergenic
978773310 4:112480282-112480304 CAAGGTGACAGTGAGGCTGGGGG - Intergenic
979592188 4:122493326-122493348 CAAGGTGGCAGTGAGGCTGAGGG + Intergenic
982105300 4:152006701-152006723 TGAGGTGACCTTGAGGATGAAGG + Intergenic
982226272 4:153170402-153170424 CCTGGTGAGCTTCAGGCTGATGG + Intronic
982234328 4:153238148-153238170 AAGGGTGAGCTTGAAGGTGATGG + Intronic
983426808 4:167595155-167595177 TAGAGTGATCTTGAGGCTGGTGG - Intergenic
985430116 4:189871104-189871126 CTGGGTGGCTTTGAGGCTGGTGG + Intergenic
985766300 5:1781496-1781518 GAGGGTGAGGGTGAGGCTGAGGG - Intergenic
985766305 5:1781514-1781536 GAGGGTGAGGGTGAGGCTGAGGG - Intergenic
985766310 5:1781532-1781554 GAGGGTGAGGCTGAGGCTGAGGG - Intergenic
985766320 5:1781574-1781596 GAGGGTGAGGCTGAGGCTGAGGG - Intergenic
985766332 5:1781628-1781650 GAGGGTGAGGCTGAGGCTGAGGG - Intergenic
985766341 5:1781664-1781686 GAGGGTGAGGGTGAGGCTGAGGG - Intergenic
985766349 5:1781694-1781716 GAGGGTGAGGGTGAGGCTGAGGG - Intergenic
985766362 5:1781748-1781770 GAGGGTGAGGGTGAGGCTGAGGG - Intergenic
990944911 5:61239290-61239312 CAAGGTGACAGTGAGGCTGAGGG + Intergenic
992001852 5:72443931-72443953 AAGGGTGACCTTGGGGCAGAGGG - Exonic
992041288 5:72836007-72836029 CAGGGTGACCTGGAGACTTGGGG - Intronic
992071823 5:73155610-73155632 CTTGGTGGCATTGAGGCTGAGGG + Intergenic
994616106 5:102106892-102106914 CAGGGTCTCCCTGAGGCTTAAGG - Intergenic
995905462 5:117117496-117117518 CAAGGTGACAGTGAGGCTGGGGG - Intergenic
999397352 5:151238492-151238514 CAGGGTGAGCTGGAGGCAGCAGG - Intronic
1000052064 5:157572043-157572065 CAGGGTTGCCTTGAGCATGAAGG - Intronic
1001182106 5:169530096-169530118 CAGGGAGAACATGAGGCTGTTGG - Intergenic
1001848709 5:174943902-174943924 CATGGGGAGCTTGAGGCAGAGGG + Intergenic
1002022417 5:176372263-176372285 CTGGGAGACCTTGAGGCTCTAGG - Exonic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1002895962 6:1380370-1380392 CAGGGTGGCGTTGGGGGTGAGGG + Intergenic
1003006728 6:2389498-2389520 CTGGGTGTGCTGGAGGCTGAAGG + Intergenic
1003035816 6:2639401-2639423 CAGGCTGCCCCTGAGGCTGCGGG - Intergenic
1003304848 6:4916907-4916929 CAGGTGGGCCCTGAGGCTGATGG + Intronic
1003492164 6:6632474-6632496 CCGAGGGACCTTGAGGCAGAGGG + Intronic
1004249995 6:14015948-14015970 GAAGGTGACCCTGAGGCTGATGG + Intergenic
1005136217 6:22571161-22571183 TAGGGTGGCCTTGAGGCTGTGGG - Exonic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006517951 6:34555148-34555170 CTGGGTGCCCCTGAGGCTGGTGG - Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1006945072 6:37779415-37779437 CATGGCCGCCTTGAGGCTGAGGG + Intergenic
1007749248 6:44062147-44062169 AAGGCTGCCCATGAGGCTGAGGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1009230266 6:61053121-61053143 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1009410600 6:63361367-63361389 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1010754811 6:79655161-79655183 GAGGGTGACCTTAAAGCTGAGGG + Intronic
1015392487 6:132698587-132698609 CAGGGTCAGCTTGGAGCTGAAGG - Intronic
1016002250 6:139053680-139053702 CAGGATGCCCTAGATGCTGAAGG - Intergenic
1016803466 6:148189745-148189767 CTGGATGACCTTGAGTCTGGGGG + Intergenic
1019003895 6:168779978-168780000 CATGGGGACCCTGAGCCTGAGGG + Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020905657 7:14061281-14061303 CAGGGTGAATTTAAAGCTGAGGG - Intergenic
1021984102 7:26082254-26082276 CAGGCTGACTCTGAGGTTGAAGG + Intergenic
1022452191 7:30525721-30525743 GAGGTTGACCTTGAGGCTTCAGG + Intronic
1022970709 7:35514239-35514261 CAGGGAGACCTGGAAGCAGAAGG - Intergenic
1024294537 7:47831837-47831859 CAGGCTGACCTGGAATCTGAGGG + Intronic
1024797540 7:53036516-53036538 CTGGGTGACCTCGAGGGCGAAGG - Exonic
1026870666 7:73849319-73849341 GGGGGTGACCTTGGTGCTGATGG + Intergenic
1029245494 7:99196667-99196689 CAGGGTTACCATGGAGCTGAGGG - Intronic
1029877028 7:103764988-103765010 ATTGGTGACCTTGAGGATGATGG + Intronic
1031435250 7:121725046-121725068 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1033728237 7:144145296-144145318 CTGGGTGACCCTGAGGTTGCAGG - Intergenic
1034077424 7:148245633-148245655 CAGGGTCACCATGAGGTTCAAGG + Intronic
1034999847 7:155603996-155604018 CAGGGTGACCTTGAGTGGGCGGG - Intergenic
1036746629 8:11414525-11414547 CAGGGTGTCCTTAGGGCTGCAGG + Intronic
1037359500 8:18058216-18058238 CAGGGTGACCTGGATGCTAAAGG + Intronic
1037449851 8:19005955-19005977 GAGGGTGAAATTGAGGCTCATGG - Intronic
1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG + Intronic
1038192999 8:25340975-25340997 CAGGCTGACCTTGATCTTGACGG - Exonic
1040305554 8:46209984-46210006 CAGGGGGACGTTGAGGCACAGGG + Intergenic
1040307188 8:46218174-46218196 CAGGGTGATGTTGAGGCAGGCGG - Intergenic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040768874 8:50949627-50949649 CATGGTGACCTTGTGGCTGCTGG - Intergenic
1041076282 8:54173041-54173063 AAGGATGACCATGGGGCTGACGG - Intergenic
1043133162 8:76487547-76487569 CAGGGTGATGCTGAGGCTGCTGG + Intergenic
1044146688 8:88724844-88724866 CAGGGTGAATTTATGGCTGAGGG + Intergenic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1048174908 8:132142870-132142892 CAGGGTGACTGTGTGGCAGAAGG - Intronic
1048498317 8:134954190-134954212 CATGGCCACTTTGAGGCTGAGGG - Intergenic
1049158781 8:141084311-141084333 CAGGGTGAGCTTGTGGCAGCAGG - Intergenic
1050132007 9:2422580-2422602 AAAGGTGGCCTTGAGGCTGATGG + Intergenic
1050504146 9:6329610-6329632 CAAGGTGACTTTGAGACTGAGGG - Exonic
1050723043 9:8612722-8612744 CTGGGGGACCCTGAGGCTGGTGG + Intronic
1051421023 9:16889448-16889470 CAGGGTCACCCTGTGGTTGAAGG + Intergenic
1051570335 9:18549846-18549868 CAGGCTGACGTTGATGCTGCTGG - Intronic
1052744835 9:32430415-32430437 CAGGGAGACCTTGTAGCTGTTGG + Exonic
1053512613 9:38701554-38701576 GTGGGTGGCCTCGAGGCTGAAGG + Intergenic
1056628411 9:88273170-88273192 CAGGGTGACCAGGAGGCCGTCGG + Intergenic
1058918102 9:109587000-109587022 AAGGTTGCTCTTGAGGCTGATGG + Intergenic
1059298938 9:113297660-113297682 CAGAGTGACACTGAGGATGACGG + Exonic
1060221556 9:121766688-121766710 CTGGGTGACCTTGGCGATGAGGG - Exonic
1060940434 9:127540255-127540277 CAGGGTGGCCTGGAGGCTTGGGG + Intronic
1061449036 9:130658946-130658968 GAGGGTGAGCTGGAGGCTGGAGG + Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062102914 9:134737818-134737840 CTGGGTGTGCTTGAGGCAGATGG + Intronic
1062434337 9:136540047-136540069 CTGTGTGACCCTGGGGCTGATGG + Intronic
1062546540 9:137066173-137066195 CAGGGGGGCCTTGAGCCTGGGGG - Intronic
1185812620 X:3124805-3124827 CAGGGTGAACTTCAAGATGAAGG - Intergenic
1186663795 X:11698040-11698062 CCAGGTGACATTGAGGCTGCTGG - Intergenic
1186665733 X:11715094-11715116 CAGGGAGACTTCGAGGCTGGAGG - Intergenic
1187126038 X:16455374-16455396 CAGGCTGGACTTCAGGCTGAGGG - Intergenic
1189037184 X:37505374-37505396 CAGGGTGACCTTGATGTTGATGG - Intronic
1189653600 X:43217066-43217088 CAGGGTGTACTTGAGGGTGGAGG + Intergenic
1189848592 X:45157992-45158014 GAGGGAGATCTTGAGGCTGGGGG + Intronic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1191039894 X:56068036-56068058 AAGGGAGACCATGAGGCTGAAGG - Intergenic
1191257737 X:58286988-58287010 CAGGGTGACATTGAGGCAGCTGG + Intergenic
1191719829 X:64220242-64220264 CAGGGTTTCCTCAAGGCTGAGGG + Intergenic
1191919796 X:66243325-66243347 CAGGGTGTACTTGAGGGTGGAGG + Intronic
1191927719 X:66331880-66331902 CAGGGTGTACTTGAGGGTGGAGG - Intergenic
1192239027 X:69314952-69314974 TAGGGTGACACTGAGGCTGGTGG + Intergenic
1192252782 X:69426763-69426785 AAGGGTTACCTTGAGGCAGTGGG + Intergenic
1193229968 X:79032294-79032316 CAAGGTGGCAGTGAGGCTGAGGG - Intergenic
1193974256 X:88098169-88098191 CTGGGTGACCTGGAGCCTCATGG - Intergenic
1196435640 X:115671974-115671996 CAGGCTGAACTTGAGCATGAGGG - Intergenic
1199637975 X:149831603-149831625 CACTGTGACCTTGAGGATGAGGG - Intergenic
1199727554 X:150599512-150599534 ACAGGTGACCTTGAGGCTGTCGG + Intronic
1200142253 X:153908078-153908100 GAGAGTGACCTGGAGGCTGAGGG - Intronic
1201038373 Y:9805296-9805318 CAGGGTGGCCTAGATGCTGTAGG + Intergenic
1201144465 Y:11056163-11056185 CGGGGTGACCTTGACTCAGAAGG + Intergenic
1201227521 Y:11832744-11832766 CAATGTGACCTTGAGCATGAAGG + Intergenic
1201249281 Y:12039796-12039818 CAAGGTGGCAGTGAGGCTGAGGG + Intergenic
1201268905 Y:12235450-12235472 CAGGGTGAACTTCAAGATGAAGG + Intergenic
1201915087 Y:19172911-19172933 CAAGGTGGCACTGAGGCTGAGGG + Intergenic