ID: 1143171486

View in Genome Browser
Species Human (GRCh38)
Location 17:4933081-4933103
Sequence CCTGACGCCCACACCCAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143171476_1143171486 16 Left 1143171476 17:4933042-4933064 CCTGAAAGGCAATGAGCTGAAGA 0: 1
1: 0
2: 2
3: 20
4: 225
Right 1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 170
1143171475_1143171486 28 Left 1143171475 17:4933030-4933052 CCAAGAGCTCTACCTGAAAGGCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 170
1143171479_1143171486 -7 Left 1143171479 17:4933065-4933087 CCCTGCCCCCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 30
4: 374
Right 1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 170
1143171480_1143171486 -8 Left 1143171480 17:4933066-4933088 CCTGCCCCCAGGGCTCCTGACGC 0: 1
1: 0
2: 3
3: 52
4: 439
Right 1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG 0: 1
1: 0
2: 3
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143171486 Original CRISPR CCTGACGCCCACACCCAAGC TGG Exonic
900292623 1:1929908-1929930 CCTGACCCTCAGACCCGAGCAGG - Intronic
900523366 1:3116750-3116772 CCTGAAGCCCTCACCCCAGCAGG + Intronic
900910960 1:5596785-5596807 CCTGAACCCCAAACTCAAGCCGG + Intergenic
901054657 1:6443575-6443597 CCTGGTTCCCTCACCCAAGCAGG + Intronic
902549100 1:17208661-17208683 ACTGACCCCCACACCCCAGTGGG + Intronic
902832927 1:19029342-19029364 CCTGAGGCACACAGCCAAGCAGG - Intergenic
905146863 1:35893725-35893747 CCTCGCGCCCACCCCCCAGCGGG - Exonic
921748061 1:218760190-218760212 CCTCACTCCCACACCCAGGTTGG + Intergenic
923135787 1:231117507-231117529 CCTGAGGCCCTCACCAAGGCAGG + Intergenic
1067059980 10:43073275-43073297 CCTGAGGCCCACAGGCAGGCAGG + Intergenic
1067474898 10:46558430-46558452 CCTGACACCCAGCCCCAAGAAGG - Intergenic
1069948040 10:72000882-72000904 GCTGAGGCCCACACCCCTGCTGG - Intronic
1070852748 10:79581003-79581025 TCTGTTGCCCACACCCAGGCTGG - Intergenic
1071498961 10:86190138-86190160 CTAGTCGCCCACCCCCAAGCAGG + Intronic
1076443416 10:130495793-130495815 CCTGCAGCCCACACCCTAGTTGG + Intergenic
1076609104 10:131710038-131710060 CCCGACACACACACACAAGCCGG + Intergenic
1077025574 11:438457-438479 CCTGACACACACAGCCAGGCAGG + Intronic
1077836870 11:5933792-5933814 CCTGACTCCCCCAGCCAAGATGG + Intronic
1078087753 11:8244241-8244263 CCAGCAGCCCACTCCCAAGCTGG - Intronic
1078131220 11:8615751-8615773 CCAGGAGGCCACACCCAAGCTGG + Exonic
1078429944 11:11280998-11281020 TCTGCTGCCCACACCCAGGCTGG + Intronic
1079857245 11:25621507-25621529 CCTAACCCCCACCCCCAAACAGG + Intergenic
1080645822 11:34186785-34186807 GCAGACGCCCACCCCCAGGCTGG + Intronic
1083610275 11:64000978-64001000 CCTGGCGCGCAAACCCCAGCTGG + Intronic
1084733705 11:71091214-71091236 CCCCCGGCCCACACCCAAGCTGG - Intronic
1084927096 11:72522552-72522574 CCTGCCCCCCAGACCCTAGCAGG - Intergenic
1085415250 11:76315365-76315387 CCTGACTTCCCCACTCAAGCTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093020344 12:14197754-14197776 TCTCACGCCCTCACCCAGGCAGG + Intergenic
1096703929 12:53406674-53406696 CCAGATGCCCAACCCCAAGCCGG + Exonic
1097335312 12:58376277-58376299 TCTGATGCCCACAACCAAGGAGG - Intergenic
1102722403 12:115028676-115028698 CCTGACACCCTCAGCCAGGCAGG - Intergenic
1103193868 12:119025384-119025406 CTTGACACCCACATCTAAGCAGG - Intronic
1103479616 12:121242508-121242530 CGTGAGGCTCACACCCAAGGCGG + Intronic
1106223254 13:27765310-27765332 TCTCACGCCGACACCCAGGCTGG - Intergenic
1108248466 13:48541239-48541261 CCAGACCCCCACCCCCAAACAGG - Intergenic
1108252209 13:48578505-48578527 CCTGACACCCAACCACAAGCAGG + Intergenic
1108576605 13:51796615-51796637 CCTGTGGCCCACACCACAGCAGG + Intronic
1114666079 14:24377860-24377882 CCTGAGGGCCACACCTCAGCTGG - Exonic
1117250610 14:53933674-53933696 TCTCACTCCCACACCCAGGCTGG - Intergenic
1122578764 14:102758080-102758102 ACTGTCGCCCACACCCATCCAGG + Intergenic
1122938862 14:104972363-104972385 CCTGACACCCACACTCAGCCAGG + Intronic
1124999497 15:34755231-34755253 CCTGACCGCCAGACCCAAGCAGG + Intergenic
1125416186 15:39455540-39455562 CCTGACCATCACACCCAAGATGG - Intergenic
1125760660 15:42093699-42093721 CCTGAGACCCAGGCCCAAGCTGG - Intronic
1129157070 15:73724893-73724915 CCTGAGACCCAGCCCCAAGCAGG - Intergenic
1129242292 15:74258904-74258926 CCTGGGGCCCCCACCCCAGCAGG - Intronic
1130691409 15:86084711-86084733 CCTTACCCCCACACCAAATCAGG - Intergenic
1131086033 15:89576126-89576148 CCTGCCGCCCACCCCTAAGCAGG + Exonic
1132930107 16:2454672-2454694 GCTGACACCCACACCCAACTGGG - Intronic
1133115550 16:3576223-3576245 CCTGCAGCCAACACCCAGGCTGG + Intronic
1136297107 16:29309853-29309875 CCAGACTCCCACACCCGGGCTGG - Intergenic
1137573474 16:49582101-49582123 CCTGACGCCTACACGCAAGCTGG + Intronic
1142137904 16:88460005-88460027 CCTGACACCCACCCTCTAGCTGG + Intronic
1142635656 17:1255796-1255818 TCTGTCGCCCAAACCCAGGCTGG - Intergenic
1143171486 17:4933081-4933103 CCTGACGCCCACACCCAAGCTGG + Exonic
1143368752 17:6425433-6425455 CCTGAGGCCCACAGCCACCCAGG - Exonic
1143400164 17:6638356-6638378 CCAGACGCCCACACAGCAGCAGG + Intronic
1144205052 17:12974085-12974107 CATGACCCTCACACCCATGCTGG - Exonic
1144228541 17:13175505-13175527 CCAGACCACCACACACAAGCTGG - Intergenic
1144415719 17:15044319-15044341 CCTGAGGCCCAGACCCAGGGAGG + Intergenic
1146917514 17:36687590-36687612 CCTGAGGCCCCCACCCACCCGGG - Intergenic
1147422805 17:40331025-40331047 CCTGGAGCCCCCACCCTAGCTGG - Exonic
1148073250 17:44920977-44920999 AATGAGACCCACACCCAAGCAGG - Intergenic
1148107737 17:45128309-45128331 CCTGACTTCCGCACCCAACCAGG - Intronic
1148243692 17:46016359-46016381 TCTCACTCCCTCACCCAAGCTGG - Intronic
1148692662 17:49540448-49540470 CCTCACTCCATCACCCAAGCTGG - Intergenic
1150631848 17:66885412-66885434 CCAGACTCCCACACCCATGCTGG - Exonic
1151290597 17:73147168-73147190 CCTGACCCCCACTCCCAGGCTGG + Intergenic
1151380059 17:73719672-73719694 CCTGACTCCCACGCCCAGGGTGG - Intergenic
1151973509 17:77471269-77471291 CCTGTCCCCTACCCCCAAGCAGG + Intronic
1152266485 17:79297724-79297746 CCTGAGGGCCACCCCCAAGTGGG - Intronic
1152503086 17:80726120-80726142 ACAGAGGCCCACATCCAAGCAGG + Intronic
1154321987 18:13361653-13361675 ACTGCTGCCCACACCCATGCAGG + Intronic
1156359762 18:36374308-36374330 TCTGAAGCCCACACTCAACCAGG + Intronic
1157572198 18:48720631-48720653 CCTCACGCCCACCCCCAAGCAGG + Intronic
1158877991 18:61751542-61751564 CCTATCACCCACACCCAGGCAGG - Intergenic
1160154912 18:76425903-76425925 GCTGACGTCGACACCCAAGCAGG + Intronic
1160333682 18:78018128-78018150 CCTGCCCCCCACAGCCCAGCTGG - Intergenic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1160704562 19:524023-524045 CCCGAAGCCCACAGCCAGGCAGG + Intergenic
1161297780 19:3528298-3528320 CCTGAAACCCCCACCCCAGCGGG - Intronic
1161420723 19:4174793-4174815 CCGCCCGCCCACCCCCAAGCTGG - Exonic
1161576299 19:5056297-5056319 CTGGACATCCACACCCAAGCCGG - Intronic
1161612401 19:5250625-5250647 CCCGACCCCCTCGCCCAAGCGGG - Intronic
1162752634 19:12838344-12838366 CCTGGCGCCCCCACCCCGGCGGG - Intronic
1162964146 19:14148164-14148186 CTTGACGCCCCCACCCCAGCTGG - Exonic
1163597925 19:18231322-18231344 CCTGCCTCCCAGAGCCAAGCGGG + Intronic
1163667621 19:18610650-18610672 GCTGACCCCCACCTCCAAGCAGG - Intronic
1165305854 19:35002320-35002342 CCTGATGCTCACAGTCAAGCAGG - Intronic
1165806687 19:38584708-38584730 CCTGCGCCCCACACCCAACCTGG + Intronic
1166216949 19:41342030-41342052 CCTGACTCCCACACCAAAGCAGG - Exonic
1166856538 19:45785156-45785178 CCTGAGTCCCAGACCCAGGCTGG + Intronic
1167038571 19:47008687-47008709 CCTGACTCCCCCAGCCAAGATGG + Intergenic
1167749945 19:51373357-51373379 GCTGGAGCCCCCACCCAAGCAGG - Intergenic
1168078767 19:53994173-53994195 ACAGACGCCCACCCCAAAGCAGG + Intronic
1168349719 19:55669000-55669022 CCCGACACCTACCCCCAAGCCGG - Intronic
925301975 2:2823324-2823346 CCTTACCCCCACACCCATGATGG + Intergenic
925404083 2:3594894-3594916 CCTGCCCCCCACCCCAAAGCCGG + Intronic
925841316 2:7994844-7994866 GCTGACCCTCACACCCTAGCAGG - Intergenic
928004181 2:27548576-27548598 CCTGGCTCCGTCACCCAAGCTGG - Intronic
928420430 2:31134306-31134328 GCTGACTCCCTCACCCATGCTGG + Intronic
932576324 2:72964268-72964290 CCTGACTCCCTCACCCAACAGGG + Intronic
933433565 2:82215392-82215414 CTTAAGGCCCAGACCCAAGCGGG + Intergenic
934662239 2:96149101-96149123 CCTGGCGTGCACCCCCAAGCAGG + Intergenic
936574292 2:113640809-113640831 GGTGACTCACACACCCAAGCAGG - Intronic
938310240 2:130284697-130284719 CCAGTCGCCCACACCCCACCTGG - Intergenic
939577651 2:143915282-143915304 CCTGACCCTCTCACCCAAGTTGG - Intergenic
941684127 2:168430210-168430232 CCTGGCGTCCACAACCAAGTGGG - Intergenic
942309838 2:174645783-174645805 CCTGATGCCAACAACCAAACTGG + Intronic
942445175 2:176072771-176072793 CCCGACCCCGACCCCCAAGCAGG - Intergenic
942624649 2:177886988-177887010 CCTGTTTCCCACACCCCAGCAGG - Intronic
1172524058 20:35586966-35586988 CCTGACCACCTTACCCAAGCAGG + Intergenic
1173139578 20:40470561-40470583 CCTTACTCTCACCCCCAAGCAGG - Intergenic
1173193552 20:40895312-40895334 CCTGACGTCTATACTCAAGCTGG - Intergenic
1175348828 20:58303053-58303075 CCTGACACCCACAGCCTGGCAGG - Intergenic
1176056603 20:63152268-63152290 CCGGACGCCGTCACCCAACCCGG - Intergenic
1178643296 21:34363883-34363905 CCTGAGGCACACACCCCATCAGG + Intergenic
1181511894 22:23393007-23393029 CCAGAGGCCCACACTGAAGCTGG - Intergenic
1183468370 22:37991861-37991883 CCTCAAGTCCACACCCCAGCAGG - Intronic
1184741078 22:46429419-46429441 CCCCACGCCCACAGCCACGCCGG - Intronic
1184935247 22:47716277-47716299 CCCGCCGGCCACACCCATGCTGG - Intergenic
1185072243 22:48662720-48662742 CAACACTCCCACACCCAAGCAGG - Intronic
1185425880 22:50770079-50770101 GGTGACTCACACACCCAAGCAGG + Intronic
952835926 3:37601883-37601905 CCTGACGCCCTCACCCAAAGCGG - Intronic
954202026 3:49029152-49029174 CCCCACGCCCACGCCCAAGGCGG + Intronic
954698994 3:52441959-52441981 CCAGCAGCCCACACCCAAGCAGG + Intronic
959945012 3:112116876-112116898 CCTATCGCCCCCACCCTAGCTGG - Exonic
960854091 3:122085501-122085523 CCTGAAGCCTAAACCCACGCTGG - Intronic
964112633 3:153103398-153103420 CCTGAGGCACACCTCCAAGCAGG - Intergenic
965508289 3:169540283-169540305 CCTCACTCCCACAACCAAGCAGG + Intronic
966886931 3:184381994-184382016 CCTGCAGCCCCCACCCAAGATGG + Exonic
968009475 3:195264362-195264384 CCTGAGGCCCACACACTTGCAGG + Intronic
968462450 4:732254-732276 CCTGACGACCACGCCCACTCGGG - Intronic
969584642 4:8084769-8084791 CCTGCCGCCCACGCCCCTGCTGG + Intronic
969609045 4:8216879-8216901 CCTGCCCCCCACACCCCTGCCGG - Intronic
971468868 4:26997495-26997517 CCTGACACCCTCACCCACTCAGG + Intronic
978466680 4:109016213-109016235 CCAGACACTCACAACCAAGCTGG + Intronic
982742229 4:159069461-159069483 CCTCACTCCGACACCCAGGCTGG + Intergenic
986073482 5:4311034-4311056 CCTGATGACCTCACCCATGCAGG + Intergenic
986335838 5:6754784-6754806 TCTCACGGCCACACCCAAGGCGG + Exonic
989849730 5:46194112-46194134 CCTGACCCCTGCCCCCAAGCAGG + Intergenic
991686098 5:69183787-69183809 TCTCACTCCCACACCCAGGCTGG - Intergenic
993592111 5:89806876-89806898 CCTAACCCCCACCCCCAAACAGG - Intergenic
999239072 5:150117169-150117191 TCTGACTCCTACAACCAAGCAGG + Intronic
999538635 5:152547535-152547557 CCTGGCTCCCACATTCAAGCTGG + Intergenic
1001526205 5:172430481-172430503 CCTGACACCCCCACCCACCCTGG + Intronic
1007185370 6:39966864-39966886 CCTGACACCCACCCTCCAGCAGG - Intergenic
1008081428 6:47198840-47198862 CCTGACACACACACACCAGCAGG - Intergenic
1014179324 6:118367506-118367528 CATAAAGCCCACAGCCAAGCTGG + Intergenic
1016198660 6:141379112-141379134 CTTGACCCCCACCCGCAAGCAGG - Intergenic
1016524555 6:144986817-144986839 CCTGATGACCACACCCAGGCAGG - Intergenic
1017220726 6:151962421-151962443 GCTGAGGTCAACACCCAAGCAGG - Intronic
1018431218 6:163724332-163724354 CGTGCTGCCCACACCCACGCTGG - Intergenic
1021191287 7:17622522-17622544 CCTGAAGCTAACACCCAATCAGG + Intergenic
1022721066 7:32942567-32942589 GGCGACGCCCACACCAAAGCGGG + Intergenic
1023338001 7:39189921-39189943 CCTCACTCCCTCACCCAGGCTGG + Intronic
1024064133 7:45718774-45718796 CCTGATGCCCCCACCCAGGGGGG - Exonic
1027054778 7:75042580-75042602 CCTGACTCCCTCGCCTAAGCTGG + Exonic
1027826304 7:83120369-83120391 TCTCACTCCAACACCCAAGCTGG - Intronic
1028428312 7:90716254-90716276 CCTCACACCCACACCAAAGGAGG + Intronic
1032710799 7:134458784-134458806 CCTGACGCCCAGGGCCAACCCGG + Intronic
1032962937 7:137060678-137060700 CCTGAGACCCCCACCCAGGCCGG + Intergenic
1033501505 7:141954988-141955010 CCTGACCCCCACACCCAACATGG - Intronic
1033657205 7:143381973-143381995 CCCGACTCCCACTCCCAGGCGGG - Intronic
1035386389 7:158475575-158475597 GCTGACACCCACACCCCAGCCGG + Intronic
1036910933 8:12755899-12755921 CCCGACGCCCCCGCCCAGGCCGG + Intronic
1039694781 8:39899184-39899206 TCTCACTCCCTCACCCAAGCTGG + Intergenic
1040425921 8:47286259-47286281 CCTGAGACGCACACCCAGGCAGG - Intronic
1040511766 8:48102297-48102319 CCTGCCTCCCACAGCCAGGCTGG - Intergenic
1047974283 8:130113809-130113831 TCAGACACCCACACCCAGGCTGG + Intronic
1048002695 8:130392708-130392730 CCTGAGGCCCTCACAGAAGCAGG - Intronic
1048334338 8:133491735-133491757 CCTGACGCTCCCACCCATCCCGG - Intronic
1050656956 9:7839328-7839350 CCTGAAACCCACTCCAAAGCTGG - Intronic
1051541064 9:18217909-18217931 CCTTACCCCCACTCCCAAGTTGG - Intergenic
1056573000 9:87832679-87832701 CCTGAAGCCACCACCCAAACAGG + Intergenic
1057380955 9:94567195-94567217 CCTGAAGCCACCACCCAAACAGG + Intronic
1060223173 9:121774937-121774959 CCTGACCCCACCCCCCAAGCTGG - Intronic
1060984173 9:127810115-127810137 CCTGCCGCCCACCCCCAAGTTGG - Intronic
1061955000 9:133956786-133956808 CCTTCCGCCCCCACCCAGGCGGG + Intronic
1062109272 9:134773098-134773120 CCTGCTGCCCACACCCCATCTGG - Intronic
1062543523 9:137051928-137051950 CCTGGCGGACACACCCAGGCAGG - Intronic
1062546289 9:137065044-137065066 CCAAACCCCCACACCCACGCTGG - Intronic
1189598016 X:42590358-42590380 CCTGACCCCGACCCCCGAGCAGG + Intergenic
1190063124 X:47223466-47223488 CCTAAAGCCCACAGCCTAGCAGG - Intronic
1193669592 X:84367845-84367867 CCTTACCCCCACACCCCAACAGG - Intronic
1194237253 X:91399535-91399557 CCTGCCACCTCCACCCAAGCAGG + Intergenic
1201145393 Y:11062320-11062342 CCTGCCACCCACTCCCCAGCAGG + Intergenic
1201240230 Y:11951857-11951879 CCTGCCGCCCACACCTAGGGTGG - Intergenic