ID: 1143172864

View in Genome Browser
Species Human (GRCh38)
Location 17:4940045-4940067
Sequence CTGCGCGCCTGCGCCCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143172864_1143172870 3 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172870 17:4940071-4940093 AAAGGCGGCCGGGAGTAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 155
1143172864_1143172872 12 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172872 17:4940080-4940102 CGGGAGTAAGGCGGAGCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 140
1143172864_1143172874 25 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172874 17:4940093-4940115 GAGCTGAAGGAGGAGCTTGATGG 0: 1
1: 0
2: 3
3: 47
4: 397
1143172864_1143172873 15 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172873 17:4940083-4940105 GAGTAAGGCGGAGCTGAAGGAGG 0: 1
1: 0
2: 0
3: 25
4: 249
1143172864_1143172867 -8 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172867 17:4940060-4940082 GCGCGCAGCGCAAAGGCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 72
1143172864_1143172868 -7 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172868 17:4940061-4940083 CGCGCAGCGCAAAGGCGGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1143172864_1143172869 0 Left 1143172864 17:4940045-4940067 CCGGCGCGGGCGCAGGCGCGCAG 0: 1
1: 0
2: 7
3: 18
4: 157
Right 1143172869 17:4940068-4940090 CGCAAAGGCGGCCGGGAGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143172864 Original CRISPR CTGCGCGCCTGCGCCCGCGC CGG (reversed) Exonic