ID: 1143174357

View in Genome Browser
Species Human (GRCh38)
Location 17:4947954-4947976
Sequence CACTTCCGCCTCTCCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143174357_1143174369 22 Left 1143174357 17:4947954-4947976 CCGCCCTGGGAGAGGCGGAAGTG 0: 1
1: 0
2: 0
3: 27
4: 186
Right 1143174369 17:4947999-4948021 CCCCTCCCCGCCCTGTGCCCCGG 0: 1
1: 0
2: 11
3: 122
4: 977
1143174357_1143174362 -9 Left 1143174357 17:4947954-4947976 CCGCCCTGGGAGAGGCGGAAGTG 0: 1
1: 0
2: 0
3: 27
4: 186
Right 1143174362 17:4947968-4947990 GCGGAAGTGGGCCGCCGCACCGG 0: 1
1: 0
2: 0
3: 6
4: 52
1143174357_1143174363 -8 Left 1143174357 17:4947954-4947976 CCGCCCTGGGAGAGGCGGAAGTG 0: 1
1: 0
2: 0
3: 27
4: 186
Right 1143174363 17:4947969-4947991 CGGAAGTGGGCCGCCGCACCGGG 0: 1
1: 0
2: 0
3: 49
4: 1603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143174357 Original CRISPR CACTTCCGCCTCTCCCAGGG CGG (reversed) Intronic
901324009 1:8356325-8356347 GACTTCCTCCTCACCCAGGATGG + Intronic
901414936 1:9110128-9110150 CACTTCTGCCTCTCTCCAGGAGG + Intronic
901904349 1:12394755-12394777 CATTTCCACCTCTCTCACGGTGG + Intronic
902373495 1:16019256-16019278 CAATGCCTCCTCCCCCAGGGAGG + Intronic
902395188 1:16128646-16128668 CACCTCCTCCTGTCCCAGGAAGG - Intronic
902444228 1:16451908-16451930 TGCTTCCCCCTCCCCCAGGGGGG + Exonic
902856554 1:19210303-19210325 CACTTCCGCCCCCTCCTGGGAGG - Intergenic
903026654 1:20434251-20434273 CATTTCCTCAACTCCCAGGGAGG + Intergenic
903854424 1:26328427-26328449 CACCTCCTCTTCTCCCATGGAGG + Intronic
904251087 1:29224869-29224891 CCCTCCCACCTCACCCAGGGTGG + Intronic
904359603 1:29963147-29963169 TCCTCCAGCCTCTCCCAGGGAGG + Intergenic
904359703 1:29963426-29963448 CCCTCCTGCCACTCCCAGGGAGG + Intergenic
905187538 1:36207423-36207445 CGCTTCCGCCCCTCCCAAGCTGG + Intergenic
905261072 1:36719691-36719713 CTCTTTCTCCTCTACCAGGGGGG + Intergenic
905269474 1:36777737-36777759 CAGTTCTCCCTCTCCCAGGCAGG - Intergenic
906780867 1:48571926-48571948 CACTTCTGCCTCCCCAAGAGAGG - Intronic
906809004 1:48807517-48807539 AACTTTCACCTCTCACAGGGAGG - Intronic
907346955 1:53790071-53790093 CACTTCCAGCTATCCCAGGCTGG - Intronic
908474021 1:64470863-64470885 CACTTGCGCCTCGTCCAGGATGG - Exonic
910333313 1:86100709-86100731 CCCTACCCCCTCTGCCAGGGAGG + Intronic
913450201 1:118987880-118987902 CGCCTCCGCCTCTCCCGGGCCGG - Intronic
916470672 1:165119299-165119321 CACTTCCTCATCTGCCAGGGTGG - Intergenic
920038555 1:203081608-203081630 CACCTCCCACACTCCCAGGGTGG - Intergenic
920679414 1:208060897-208060919 CCCTTCCCCCTCCCCCAGGGAGG + Intronic
922464805 1:225839443-225839465 CACTCCCTCCTCTCCCCTGGGGG - Intronic
922609052 1:226910915-226910937 CACTTCTGCCTCCCCCAGCCTGG + Intronic
922722928 1:227907838-227907860 CACAGCCGCCTCACCAAGGGTGG + Intergenic
922722936 1:227907863-227907885 CACAGCCGCCTCACCAAGGGTGG + Intergenic
1064554740 10:16537162-16537184 CACTTCGGCCTCTCAGAGTGTGG + Intergenic
1069908979 10:71748488-71748510 TCCTTCAGCCTCTCCCTGGGAGG + Exonic
1070813349 10:79309367-79309389 CCCTCCCTGCTCTCCCAGGGTGG + Intronic
1071623990 10:87149134-87149156 CACTTCGGCCTCTCAAAGTGCGG + Intronic
1075666223 10:124232940-124232962 CACCTCTGTCCCTCCCAGGGTGG - Intergenic
1076345235 10:129774854-129774876 CACCTCCCCCTCCCCCAAGGCGG + Intergenic
1077470996 11:2760518-2760540 CCCTTCCTCCTCTCCCAAGCTGG + Intronic
1077486999 11:2843546-2843568 CACACCCGCTGCTCCCAGGGTGG - Intronic
1077526351 11:3067973-3067995 CACGTCCTCCCCACCCAGGGCGG + Intergenic
1078934137 11:15937576-15937598 CACTTCTCCGTTTCCCAGGGAGG - Intergenic
1082162413 11:48900276-48900298 CACGTCCTCTTCTTCCAGGGCGG + Intergenic
1082167994 11:48968727-48968749 CACTTCCTCTTCTTCCAGGGCGG + Intergenic
1082243138 11:49891870-49891892 CACGTCCTCTTCTTCCAGGGCGG + Intergenic
1082657638 11:55872695-55872717 CACGTCCTCTTCTTCCAGGGCGG + Intergenic
1083263634 11:61536204-61536226 CACACCCGCCTTTCCCAGGAAGG + Intronic
1083302520 11:61746415-61746437 TAATTCCTCCTCTGCCAGGGTGG + Exonic
1083720456 11:64601201-64601223 CCCTTTGGCCTCTCTCAGGGTGG - Intronic
1083774594 11:64888219-64888241 CACACTCACCTCTCCCAGGGAGG + Intronic
1084149562 11:67281833-67281855 CACTACCACCTCTCCCAGCACGG + Exonic
1084546223 11:69816446-69816468 CACTCCCGCCGCCCCCACGGAGG + Intronic
1088750431 11:112837985-112838007 CACCCCCTCCTCTCCCAGGCAGG + Intergenic
1089325056 11:117651271-117651293 CACTGCAGCCCCTGCCAGGGTGG - Intronic
1089367648 11:117931067-117931089 CTCTTCCCTCTCTCCCAGGGAGG + Intergenic
1089483564 11:118827296-118827318 CACTTCCGCCTCTCAAAGTGCGG + Intergenic
1091582345 12:1797353-1797375 CACTTCCGCCTTGCCGAGGGCGG + Intronic
1097085685 12:56466573-56466595 TTCTTCCTCCTCTCCCAGAGTGG - Intronic
1097881809 12:64693315-64693337 CACATCCTCCTCTCCCAAAGGGG - Intronic
1098309708 12:69136222-69136244 CCTTCCTGCCTCTCCCAGGGTGG - Intergenic
1101894472 12:108745626-108745648 CACTTCTACCTCTCCCAGCCAGG - Intergenic
1102594820 12:113984244-113984266 CACCTCCCCTTCTCCCTGGGGGG + Intergenic
1103261789 12:119594569-119594591 CGCTTCCGCCACTCTCCGGGGGG + Intronic
1103373548 12:120437846-120437868 AGCTTCCGCCTCGCCCAGGTGGG + Intergenic
1103479281 12:121240806-121240828 CACTTCCTCCTCCCCCACGGGGG + Exonic
1109721633 13:66283160-66283182 CACTTGCAGCTTTCCCAGGGTGG + Intergenic
1113513202 13:110872153-110872175 CCCTCCCGCCTCTCCCTGCGGGG + Intergenic
1115789689 14:36865167-36865189 CACTGCCTCCTCTAGCAGGGAGG - Intronic
1116821715 14:49633890-49633912 CACCTCCGGGTCGCCCAGGGTGG + Exonic
1116867118 14:50040075-50040097 CCTTTCTGGCTCTCCCAGGGAGG - Intergenic
1118002657 14:61538037-61538059 CATTCCAGCCTCTCCCAGGAGGG - Intronic
1119524465 14:75311079-75311101 CACTTCCGTCCCTCTCAGGCCGG - Intergenic
1122114472 14:99520781-99520803 CACTTCCTCCTCTCCAAAGTAGG + Intronic
1122138861 14:99650279-99650301 CACTCCCTCCCCTCACAGGGAGG - Intronic
1122908265 14:104812969-104812991 CACTTCAGCCTCTCAAAGTGCGG - Intergenic
1128552710 15:68608649-68608671 CAGTTCCTCCTCTCCTAGGGAGG + Intronic
1129833559 15:78686523-78686545 CATTTCCAAATCTCCCAGGGTGG + Intronic
1131052062 15:89354995-89355017 CACTTCCGTCACTACCTGGGAGG + Intergenic
1131756105 15:95564225-95564247 CACTCCCTCCTCCCCAAGGGTGG + Intergenic
1132383374 15:101382238-101382260 CTCTCCTGCCTCTCCCAGGAAGG + Intronic
1132549768 16:549544-549566 TGCTTCCTCTTCTCCCAGGGCGG + Intronic
1132959264 16:2613052-2613074 CTCTTCCGTCTCCCCCATGGGGG + Intergenic
1132972324 16:2695027-2695049 CTCTTCCGTCTCCCCCATGGGGG + Intronic
1133147165 16:3796998-3797020 AATTTCCTCCTCTCCCAGGCTGG + Intronic
1133838225 16:9385435-9385457 CACCCCCGCCTCTCCAAGTGTGG + Intergenic
1134644969 16:15858362-15858384 CGCTCCCGCCGCTCCCGGGGAGG - Intergenic
1137487391 16:48903037-48903059 CACTTCCACCTCACCCCAGGAGG - Intergenic
1137548139 16:49418203-49418225 CACTGCCGCCTCCTCCAGGAAGG - Intergenic
1137581718 16:49637638-49637660 CACATCCGCGTCTCCCACTGCGG - Exonic
1137721536 16:50630394-50630416 CCCTTCCGGCCCTCCCAGGAAGG - Intronic
1138532964 16:57645247-57645269 CCCCTCTGCCTCTCCCAGCGAGG + Intronic
1140917631 16:79508214-79508236 CAAATCTGCCTCACCCAGGGAGG + Intergenic
1141635742 16:85313007-85313029 CTCCTCCTCCTCTCCCAGGGAGG - Intergenic
1141779553 16:86150533-86150555 CACTTCTTCCTGTCCCAGGTGGG - Intergenic
1141799394 16:86296635-86296657 CACACCCGACTCCCCCAGGGAGG - Intergenic
1141902791 16:87003480-87003502 CATTTCCACCTCTCTCAGGGAGG - Intergenic
1142119068 16:88377041-88377063 CCCTTCAGCATCTCCCAGGAGGG + Intergenic
1143174357 17:4947954-4947976 CACTTCCGCCTCTCCCAGGGCGG - Intronic
1144494876 17:15739737-15739759 CACTGCAGCCCCTCCCAGAGCGG - Intronic
1144905379 17:18636935-18636957 CACTGCAGCCCCTCCCAGAGCGG + Intronic
1145116154 17:20212147-20212169 CATTTCCTCCTCTCCCTTGGTGG + Intronic
1145275793 17:21429452-21429474 CACGTCCTCCTCACCCATGGTGG - Intergenic
1145313640 17:21715361-21715383 CACGTCCTCCTCACCCATGGCGG - Intergenic
1147425764 17:40345284-40345306 TACCCCCGCCTCTCCCCGGGAGG + Intronic
1148343666 17:46889319-46889341 CACCCCCGCCACGCCCAGGGAGG - Intergenic
1149678140 17:58485419-58485441 CTCTTCCCCCTCTTCCAGGAAGG - Intronic
1152427972 17:80228928-80228950 GGCTTCCACCTCCCCCAGGGTGG - Intronic
1153630051 18:7061042-7061064 CACTTCAGCCTCTCCATGGCTGG - Intronic
1153740324 18:8118905-8118927 CACTTCTTCTTCTTCCAGGGTGG + Intronic
1157177121 18:45461883-45461905 CACCTCAGACTCTCCCAGGGAGG - Intronic
1157412466 18:47475032-47475054 CACTCCTGCCTCTCCTAGAGTGG + Intergenic
1160045080 18:75379148-75379170 CTCTTCCGCCTGCCCCAGAGTGG - Intergenic
1160690400 19:458644-458666 CACTTCCGCCTCCCCAAGACCGG - Intronic
1160862145 19:1241970-1241992 CACCTTCGCCTCTCCCACGCAGG + Exonic
1161976584 19:7611031-7611053 CTCCTCCGCCTCTCCCCGGGGGG - Intronic
1165033335 19:33014417-33014439 CACTTCAGCCTCTCCAGGAGAGG + Intronic
1166111703 19:40626888-40626910 CTCTGCCTCCTCTCCCAAGGGGG + Intronic
1166146868 19:40844049-40844071 CAGCTGCGGCTCTCCCAGGGAGG + Intronic
1166151029 19:40875946-40875968 CAGCTGCGGCTCTCCCAGGGAGG + Intronic
1166155523 19:40908725-40908747 CAGCTGCGGCTCTCCCAGGGAGG + Intergenic
1166869760 19:45864238-45864260 CCCTCCCGCCTCCCCGAGGGCGG - Exonic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
931219227 2:60274275-60274297 CACTTCCTCCTATGCCAGCGAGG - Intergenic
933376959 2:81492052-81492074 CACTTCTGTCTCTGCCAGAGTGG + Intergenic
934588662 2:95527200-95527222 CACGTCCTCTTCTTCCAGGGCGG - Intergenic
935898072 2:107759287-107759309 CCCTGCCGCCTCTCCTAGGGTGG + Intergenic
938116104 2:128603837-128603859 CACAGCCCCCTCTCTCAGGGTGG + Intergenic
942276406 2:174326834-174326856 CTCCTCCGCCTCCCCCAGGTCGG + Intergenic
942277791 2:174335648-174335670 AACTTGCAGCTCTCCCAGGGTGG - Intronic
944700083 2:202238591-202238613 CACTTCCGCTTCGCGCAGGGAGG + Exonic
947792008 2:232873821-232873843 CACTTCCCCTCCTCTCAGGGTGG + Intronic
948012142 2:234657432-234657454 CAATTCCTCTTCTCCCAGTGTGG + Intergenic
948770751 2:240250306-240250328 CTCTCCCGCCTCTACCAGGCAGG + Intergenic
948989951 2:241548628-241548650 CAGTTCAGCATCTCCCAGGAAGG - Intergenic
1171349949 20:24494612-24494634 CACATGCACCTCTCCCGGGGGGG - Intronic
1172079822 20:32331323-32331345 CAGCTTCTCCTCTCCCAGGGCGG + Exonic
1172222001 20:33280468-33280490 TCCCTCCTCCTCTCCCAGGGAGG - Intronic
1175385281 20:58591008-58591030 CACTGCCACCCCTCCCAGGCTGG + Intergenic
1175998492 20:62821749-62821771 CACTCCTGCCTCTCCCTGGAGGG - Exonic
1176513045 21:7763121-7763143 CACTTGCGCTTCTGCCTGGGTGG + Intronic
1178647158 21:34393645-34393667 CACTTGCGCTTCTGCCTGGGTGG + Intronic
1179620704 21:42613932-42613954 CACTGCCGCCTCCCTCAGCGGGG + Intergenic
1179823086 21:43948293-43948315 CACTGCCTCCTCACCGAGGGAGG + Intronic
1180061664 21:45388480-45388502 CACTGCAGCCCTTCCCAGGGTGG + Intergenic
1181236040 22:21448211-21448233 CACTTCCGCCTCACCCTGGCCGG - Exonic
1181330493 22:22087064-22087086 CCCTTCCTCCTTTCCCAGGAGGG + Intergenic
1181360135 22:22327856-22327878 CCCTTCCTCCTCTACCAGGAGGG + Intergenic
1181370360 22:22410322-22410344 CACTTCCTCCTCTGCCAGGAGGG + Intergenic
1181509505 22:23382707-23382729 ATGTGCCGCCTCTCCCAGGGAGG + Intergenic
1181734087 22:24868429-24868451 CCCTTCCGCTTCCCCAAGGGCGG + Exonic
1182352538 22:29706882-29706904 CACATCCTCCTCTCCCTTGGCGG + Intergenic
1183513309 22:38248546-38248568 CATGTCAGCCTCTCCCAGGCTGG + Intronic
1183539955 22:38424025-38424047 CACTCCATCCTCTCCCAGGTGGG - Intergenic
1184455607 22:44608060-44608082 GATTTGCGCATCTCCCAGGGAGG + Intergenic
1184551881 22:45209052-45209074 CAGTCCAGCCTTTCCCAGGGAGG - Intronic
1184689222 22:46109955-46109977 CACATCTGCTTCTCCCAGGTGGG + Intronic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
954640802 3:52096670-52096692 CACTCCTGCCTCTGCCTGGGGGG + Exonic
961446060 3:126982393-126982415 CACAACCGCCACTCCCAGGCAGG - Intergenic
961654791 3:128435314-128435336 CACTGCCCTCTCCCCCAGGGAGG + Intergenic
962530793 3:136277935-136277957 CACTTCCCCCTGCCCCTGGGAGG + Intronic
964033091 3:152162458-152162480 CACTTCGGCCTCTCAAAGTGCGG - Intergenic
964269009 3:154934580-154934602 TACTTCCGCATCCCACAGGGTGG - Intergenic
964459645 3:156909619-156909641 CTCTGTCGCCTCTCCCAGGCTGG - Intronic
965966432 3:174496084-174496106 CACCTCTGGCTCTTCCAGGGTGG + Intronic
967890634 3:194361894-194361916 CACAGCAGCCTCTCCCAGCGAGG - Intronic
967892517 3:194373083-194373105 CTCTTCCGGTTCTCCCAGGGGGG - Intergenic
968286219 3:197510334-197510356 CGTTTCCGCCTCTCCCTGGGCGG - Exonic
968866997 4:3219449-3219471 CACTGCAGTCTCTCCCTGGGTGG + Intronic
969071065 4:4539816-4539838 CACTTCCACCTCTCCCTGAGTGG - Intronic
976447841 4:85152073-85152095 CACTTTCTCCTCTGCCATGGTGG + Intergenic
982079283 4:151771933-151771955 CCCTTCAGCCTCTCTCAGGCAGG + Intergenic
984206358 4:176792431-176792453 CGCCTCCGGCTCGCCCAGGGGGG - Exonic
984801869 4:183723244-183723266 CACTGCGGCATCTCCCAGGGCGG - Intergenic
986042953 5:4011161-4011183 AACTTCAGCCTCTGCCAGTGGGG - Intergenic
986351883 5:6887874-6887896 CTCTTCCCCCTCGCCCTGGGTGG - Intergenic
986748841 5:10767003-10767025 CACTAATGCCTCTCCCAGGAAGG + Intergenic
991718316 5:69472660-69472682 CACCTCGGCCTCCCCCAGTGTGG + Intergenic
999065848 5:148684743-148684765 AACTTCCTGCTCTCCCAGGAGGG - Intergenic
999628243 5:153542765-153542787 CACTTCCTCTTCTCCCAGTCTGG + Intronic
999696256 5:154190705-154190727 CACTTCCGCCGCTCGCCGGCCGG - Intronic
1002707222 5:181170048-181170070 CTCTTCCACATCTCCCTGGGCGG + Intergenic
1006851536 6:37102393-37102415 CTCCTCCCCCTCCCCCAGGGAGG + Intergenic
1009995507 6:70891033-70891055 CACTTCAGCCACTTCCAGGGAGG - Intronic
1012910584 6:105113285-105113307 CACTTGCCCCTCTTCCATGGGGG - Intronic
1017071044 6:150575847-150575869 CCCTTCTGACCCTCCCAGGGAGG + Intergenic
1017877396 6:158536402-158536424 GCCTTCTGCCTCTCCCGGGGCGG + Intergenic
1018452366 6:163920917-163920939 CACTTCCTGCTCTCAGAGGGAGG + Intergenic
1018632682 6:165834454-165834476 CACTCCCCCCACTCCCAGGCGGG - Intronic
1019605415 7:1907654-1907676 CACTCCTGCCACACCCAGGGAGG - Intronic
1019767567 7:2863115-2863137 GTCTTCCTCCTCTCCCAGGGTGG + Intergenic
1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG + Intergenic
1034432221 7:151046770-151046792 CACTGCTGCCTCTTCCAGGCTGG - Intronic
1034473721 7:151270581-151270603 CAGTTCCACCTCTTCCAGGGAGG - Intronic
1034962788 7:155372914-155372936 CACATCCGCCTCCCCCAGGAGGG + Intergenic
1035520690 8:273590-273612 TACTGCAGCCTCTCCCAGGAGGG - Intergenic
1042431057 8:68706863-68706885 CAGGACCTCCTCTCCCAGGGAGG - Intronic
1043769395 8:84179648-84179670 CACTTGGGCCTCTTCGAGGGTGG + Intergenic
1046671853 8:117064792-117064814 CTCTTCCTCCTCTCCCAGATGGG - Intronic
1048868860 8:138780938-138780960 TGCTGCCGTCTCTCCCAGGGGGG + Exonic
1049403691 8:142442380-142442402 CTCCTCCTCCTCTCCCAGAGAGG + Intergenic
1051602921 9:18892370-18892392 CACTTCTTCCTCTCCCCAGGTGG + Exonic
1053153300 9:35756629-35756651 CTCTGCCGCCTTTCCCAGAGAGG + Exonic
1053358329 9:37465476-37465498 CCATTCCGCCTCTCCCAGTTGGG + Intergenic
1053391417 9:37739167-37739189 CTCTTCCCCCTCTCCCAGGATGG - Intronic
1055108873 9:72540088-72540110 CACTCCCACCCCTGCCAGGGAGG + Intronic
1057701614 9:97366790-97366812 CTCTTCTGCCTCCCCCAGAGGGG - Intronic
1057702859 9:97376293-97376315 CACTTCAGCCTCTCCCAGTAAGG - Intronic
1060221256 9:121765201-121765223 CCCCTCCCCCTCTTCCAGGGGGG + Intronic
1060479172 9:124007977-124007999 CTCTGCCGCCTCTCCCTCGGGGG + Intronic
1060832055 9:126723017-126723039 CACAGCAGCCTCTCCCCGGGCGG + Intergenic
1062193092 9:135257643-135257665 CCCTCCTGCTTCTCCCAGGGTGG - Intergenic
1190960985 X:55247382-55247404 CACTTGGGCCTGTCCCAGGGTGG + Intronic
1192657126 X:73003485-73003507 CGCCTCCGCCTCCCCCAAGGGGG - Intergenic
1192664994 X:73079516-73079538 CGCCTCCGCCTCCCCCAAGGGGG + Intergenic
1197762074 X:130035037-130035059 CATTTTCGCCTCTCGCAGAGGGG + Intronic
1198708564 X:139476587-139476609 CACTTAGGATTCTCCCAGGGAGG + Intergenic
1200022742 X:153225819-153225841 CACATCCGGGTCTCCCAGGAAGG - Intergenic