ID: 1143178220

View in Genome Browser
Species Human (GRCh38)
Location 17:4968570-4968592
Sequence CGACCAGGAGGGACGAGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 619}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143178215_1143178220 -6 Left 1143178215 17:4968553-4968575 CCAAAAGAGACGGGGCACGACCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 619
1143178214_1143178220 0 Left 1143178214 17:4968547-4968569 CCAGGACCAAAAGAGACGGGGCA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143178220 Original CRISPR CGACCAGGAGGGACGAGGAG AGG Exonic
900121918 1:1051882-1051904 ACACCAGGAGGGCCCAGGAGGGG + Intronic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
900779594 1:4609115-4609137 GGACCAGGAGGGAGGATGGGAGG - Intergenic
900792619 1:4690168-4690190 CCCCCAGGAGGCCCGAGGAGGGG + Intronic
901023549 1:6267303-6267325 GGACCAGGAGGGGCCAAGAGAGG + Intronic
901100365 1:6715139-6715161 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
901100514 1:6715496-6715518 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
901210187 1:7520240-7520262 GGAGGAGGAGGGAAGAGGAGGGG - Intronic
901226145 1:7613943-7613965 AGACCTGGAGGGGTGAGGAGAGG + Intronic
902018787 1:13328737-13328759 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
902018862 1:13328911-13328933 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
902407273 1:16191636-16191658 GGACCAGGAGGAATGAGGAGGGG + Intergenic
902955934 1:19924075-19924097 AGAGCAGGAGGGTCGGGGAGGGG - Intergenic
903068833 1:20716662-20716684 AGAGCAGGAGGGACTAGGGGAGG + Intronic
903081434 1:20815763-20815785 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
903637770 1:24833537-24833559 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
903637845 1:24833712-24833734 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
903921398 1:26803568-26803590 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
903993293 1:27289085-27289107 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
904074353 1:27829133-27829155 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904077402 1:27853052-27853074 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904077504 1:27853278-27853300 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904329704 1:29750492-29750514 CGATCAGGAGTGACCAGGAGTGG - Intergenic
904784708 1:32974896-32974918 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
905315978 1:37081486-37081508 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
906025281 1:42668341-42668363 GGAGCAGGAGGGAGGAGGAGAGG - Intronic
906150466 1:43584511-43584533 GGACCAGGAGGGTAGAGGAAGGG - Intronic
906399976 1:45497691-45497713 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
906487370 1:46242293-46242315 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
906761762 1:48383184-48383206 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
907503634 1:54901825-54901847 AGACCAGGTGTGAGGAGGAGAGG + Intergenic
908320392 1:62972796-62972818 GGATCAGGAAGGAGGAGGAGAGG + Intergenic
908370280 1:63473457-63473479 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
908446217 1:64201406-64201428 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
909352694 1:74673418-74673440 GCAGCAGGAGGGAGGAGGAGGGG + Intronic
909491357 1:76229874-76229896 CGCCCAGTAGGGAGGAGCAGAGG + Intronic
909641051 1:77870095-77870117 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
909641107 1:77870226-77870248 CGACCGGGAGGGAGGTGGGGGGG - Intronic
910305700 1:85760719-85760741 TGACCAGGAGGCTGGAGGAGTGG + Intronic
910474853 1:87595714-87595736 AGACCGGGAGGGAGGAGGAGAGG - Intergenic
911465598 1:98249185-98249207 TGAGCAGGGGGGACCAGGAGAGG + Intergenic
912165464 1:107038371-107038393 AGAAGAGGAGGGAAGAGGAGGGG + Intergenic
912668883 1:111607646-111607668 CGTCCGGGAGGGACGTGGCGGGG - Intronic
912751765 1:112293521-112293543 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
912752108 1:112294288-112294310 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
913021129 1:114790645-114790667 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
913993833 1:143638014-143638036 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
913993987 1:143638365-143638387 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
913994233 1:143638908-143638930 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
914002306 1:143703275-143703297 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
914231434 1:145766947-145766969 CGACCGGGAGGGAGGTGGGGGGG - Intronic
914852694 1:151326927-151326949 CGACGAGGAAGGACAAGGATGGG + Intronic
915509487 1:156378709-156378731 CAGCGAGGAGGGAGGAGGAGGGG - Intronic
916104865 1:161423258-161423280 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
916105020 1:161423612-161423634 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
917582982 1:176396432-176396454 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
917583056 1:176396609-176396631 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
917860074 1:179135941-179135963 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
917860125 1:179136069-179136091 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
918255027 1:182741188-182741210 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
918309384 1:183274926-183274948 TGCCCAGGAGAGAGGAGGAGTGG - Intronic
919080157 1:192857521-192857543 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
919782298 1:201228783-201228805 CCACTGGGAGGGAAGAGGAGAGG + Exonic
920067398 1:203278548-203278570 TGGCCAGGAGAGAGGAGGAGGGG + Intergenic
920232338 1:204479026-204479048 AGACCAGGATGGAAGAGGTGAGG + Intronic
921140223 1:212298931-212298953 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921142446 1:212320816-212320838 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921638310 1:217523807-217523829 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921902743 1:220466620-220466642 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
922102664 1:222488249-222488271 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
922503768 1:226114983-226115005 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
1062906619 10:1183853-1183875 AGGCCAGGAGGGAAGAGGATGGG + Intronic
1063340619 10:5259969-5259991 CCACCAGGTGGGATGATGAGGGG - Intergenic
1064108580 10:12519944-12519966 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1064579407 10:16778688-16778710 AGAGGAGGAGGGAGGAGGAGAGG + Intronic
1064970108 10:21056850-21056872 CATCCAGGAGGGAGGAGGTGTGG + Intronic
1065122548 10:22543533-22543555 AGACCAGGGGGGATGAGCAGTGG - Intronic
1065478191 10:26163917-26163939 AGACTAAGAGGGAGGAGGAGAGG + Intronic
1066085461 10:31970174-31970196 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1066085536 10:31970349-31970371 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1066464162 10:35639307-35639329 CGCCCAGGAGGGGTGGGGAGGGG - Exonic
1067026574 10:42847696-42847718 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1067119986 10:43465195-43465217 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1067147546 10:43704198-43704220 AAACCAGCAGGGAGGAGGAGAGG - Intergenic
1068230903 10:54168508-54168530 CGACCAGGTGTGAGGAGGGGAGG - Intronic
1068592412 10:58864976-58864998 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1069741366 10:70687868-70687890 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1069949625 10:72009970-72009992 TCCCCAGGAGGAACGAGGAGAGG + Exonic
1070840597 10:79484719-79484741 AGAAGAGGAGGGACCAGGAGTGG - Intergenic
1070966672 10:80534650-80534672 CGTCCAGGAGGGAGGCGGGGGGG + Intergenic
1070966722 10:80534777-80534799 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1071616652 10:87081179-87081201 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072180377 10:92975509-92975531 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072648833 10:97276991-97277013 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072930718 10:99659615-99659637 GGACCCGGAGGGACGGGGAGAGG + Intronic
1072943136 10:99785352-99785374 GGCCCAGGAGGGGCCAGGAGGGG + Intronic
1072956579 10:99892155-99892177 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072980577 10:100093905-100093927 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1073594335 10:104785083-104785105 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1073865630 10:107800893-107800915 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1076059926 10:127405796-127405818 TGACCAGGAGTGACCAGGACAGG - Intronic
1076439308 10:130469593-130469615 GGACCAGCAGGGATGAGGAAAGG - Intergenic
1076785696 10:132748856-132748878 CGACCAGGAGGACCAAGGAGAGG - Intronic
1077048441 11:556112-556134 AGACCTGGAGGGGCGTGGAGCGG + Exonic
1077411198 11:2404751-2404773 AGGCCAGGAGGGACAAGGAGCGG + Exonic
1077668785 11:4138077-4138099 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1078176908 11:8978226-8978248 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1078582231 11:12547420-12547442 GGAATAGGAGGGATGAGGAGTGG - Intergenic
1079039866 11:17050691-17050713 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1079174003 11:18121437-18121459 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1079251746 11:18792051-18792073 GGACAAGGAGGGCGGAGGAGTGG + Intronic
1079444909 11:20548727-20548749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1081950123 11:47037980-47038002 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1082059579 11:47848652-47848674 CGACCAGGAGGGGCGAGGTCCGG + Intergenic
1082844766 11:57716845-57716867 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1083091030 11:60200924-60200946 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
1083131009 11:60622879-60622901 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1083204322 11:61138951-61138973 CCACCGGGAGGCTCGAGGAGAGG + Intronic
1083382719 11:62279689-62279711 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1083645633 11:64171350-64171372 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1083739648 11:64701937-64701959 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1083739746 11:64702162-64702184 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
1083771209 11:64868653-64868675 GGACCAGGAGTGACTATGAGGGG + Intronic
1083808773 11:65090628-65090650 AGAAGAGGAGGGAGGAGGAGAGG + Intronic
1084708810 11:70831306-70831328 AAACCAGGAGGAAAGAGGAGAGG + Intronic
1084745587 11:71167673-71167695 CGTCCAGGAGGGAGGTGGAGGGG - Intronic
1085111896 11:73896983-73897005 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1085292479 11:75410170-75410192 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1085360063 11:75877916-75877938 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1086104534 11:83133541-83133563 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1086522218 11:87682270-87682292 ATACCAGGAGGCACCAGGAGCGG - Intergenic
1087183375 11:95160658-95160680 CGAACAGCAGAGATGAGGAGCGG - Intergenic
1087948788 11:104194987-104195009 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1089577975 11:119460146-119460168 GGAAAAGGAGGGACGAGGTGTGG + Intergenic
1090320277 11:125837231-125837253 TGACCAGGAGGTAAGAGGAGAGG - Intronic
1091289330 11:134428661-134428683 GGAGCAGGAGGGAGCAGGAGGGG - Intergenic
1092134474 12:6136932-6136954 TGAACAGGAGAGAGGAGGAGTGG - Intergenic
1092331331 12:7589986-7590008 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
1092401954 12:8184585-8184607 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1092402003 12:8184712-8184734 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1092827580 12:12414114-12414136 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1092827779 12:12414564-12414586 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1093453359 12:19340350-19340372 CGTCCAGGAGGGAGGCGGGGAGG + Intronic
1094103384 12:26785413-26785435 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1094103437 12:26785539-26785561 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1096021987 12:48332469-48332491 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
1096039285 12:48500358-48500380 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1096082412 12:48842208-48842230 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1096134248 12:49186492-49186514 GGAGGAGGAGGGACGAGGAGCGG + Intronic
1096144658 12:49269785-49269807 GGAGGAGGAGGGACAAGGAGCGG - Intronic
1096430245 12:51537331-51537353 CGGCCAGCAGGGAGGAGGAGCGG - Intergenic
1096441245 12:51645315-51645337 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1096489065 12:52003761-52003783 CTTCCTGGAGGGAGGAGGAGGGG + Intergenic
1097028485 12:56075790-56075812 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1097127798 12:56789086-56789108 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1097149170 12:56963786-56963808 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1098412757 12:70202276-70202298 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1098883789 12:75941942-75941964 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1098884016 12:75942473-75942495 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1098967362 12:76804840-76804862 GGACCAAGAGGCACGAGGAAAGG - Intronic
1099255224 12:80307442-80307464 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1100570627 12:95841272-95841294 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1100582096 12:95947607-95947629 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1101317624 12:103643814-103643836 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1101843115 12:108341988-108342010 AGAGGAGGAGGGAAGAGGAGCGG + Intergenic
1101843159 12:108342138-108342160 GGAGGAGGAGGGAAGAGGAGGGG + Intergenic
1101863271 12:108500045-108500067 GGACGAGGAGGGACGAGCAGGGG + Intergenic
1101942023 12:109106379-109106401 AGTCCAGGAGGGGCGATGAGGGG - Intronic
1102089383 12:110173149-110173171 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1102293906 12:111723197-111723219 CGTCCGGGAGGGAGGAGGGGGGG - Intronic
1102294007 12:111723423-111723445 CGTCCAGGAGGGAGGCGGGGGGG - Intronic
1104299314 12:127549793-127549815 AGACCAGGAGGGAAGAAGGGAGG - Intergenic
1104719187 12:131035177-131035199 CGACCAGGAGCGACCAGGAAGGG - Intronic
1105585968 13:21743120-21743142 CGACAAGGAGGAACTAGGAGAGG - Intergenic
1107092329 13:36495373-36495395 AGACCAGGAGTGTTGAGGAGGGG + Intergenic
1107493237 13:40900857-40900879 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1107493416 13:40901257-40901279 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1107588803 13:41881733-41881755 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1107683213 13:42871372-42871394 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1108038812 13:46320535-46320557 AGACAAGAAGGGAGGAGGAGGGG + Intergenic
1108437335 13:50413636-50413658 CGACCTGGAGAGTCGGGGAGAGG + Intronic
1108512922 13:51171620-51171642 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1108800690 13:54091904-54091926 TGACAAGGAGGGAGGAGCAGGGG + Intergenic
1108803946 13:54131675-54131697 TGACCAGGTGTGAGGAGGAGAGG + Intergenic
1108814058 13:54268610-54268632 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1109424113 13:62149933-62149955 AGACCACCAGGGACAAGGAGTGG - Intergenic
1109716818 13:66230333-66230355 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1111458912 13:88516782-88516804 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1111631776 13:90852545-90852567 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1113194097 13:107783048-107783070 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1113478908 13:110606292-110606314 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
1113740100 13:112705634-112705656 CCCCCAGGAGGGATGAGCAGAGG + Intronic
1114165191 14:20212749-20212771 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165216 14:20212800-20212822 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165266 14:20212901-20212923 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165289 14:20212951-20212973 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165314 14:20213002-20213024 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114427743 14:22637393-22637415 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114466915 14:22929483-22929505 CGAACAGGAGGGATGGGGAGTGG + Exonic
1115240667 14:31249262-31249284 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1115847576 14:37555520-37555542 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1116191488 14:41673450-41673472 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116191742 14:41674079-41674101 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116191963 14:41674607-41674629 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116713279 14:48396905-48396927 GGACCAGGAGGGAAGAAGAATGG + Intergenic
1117516672 14:56508782-56508804 AGGCCTGGAGGGACAAGGAGGGG + Intronic
1117617284 14:57546436-57546458 GGACCAGAAGGGAGGAGGGGAGG + Intergenic
1118001582 14:61528070-61528092 AGACCAGGAGGGGTGGGGAGGGG - Intronic
1118184209 14:63522843-63522865 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1118341048 14:64895403-64895425 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1118341123 14:64895578-64895600 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1118517687 14:66545867-66545889 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1119484460 14:74978694-74978716 AGACAAGGAGGGACAAGGCGGGG + Intergenic
1119594833 14:75924917-75924939 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1121760687 14:96442280-96442302 CCACCAGTAGGGATGAGGTGAGG - Intronic
1122419296 14:101565039-101565061 CCACCGGTAGGGACGCGGAGCGG - Intergenic
1122635572 14:103128118-103128140 AGGCCAGGAGGCAGGAGGAGGGG + Intronic
1123059452 14:105587923-105587945 AGGCCAGGAGGGGCGAGGCGGGG - Intergenic
1123083787 14:105708193-105708215 AGGCCAGGAGGGGCGAGGCGGGG - Intergenic
1124513977 15:30350600-30350622 CCATCAGGAGGGAGCAGGAGTGG - Intergenic
1124728944 15:32180165-32180187 CCATCAGGAGGGAGCAGGAGTGG + Intergenic
1125016860 15:34946465-34946487 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1125651513 15:41321185-41321207 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1125759102 15:42084997-42085019 GGACCAGCAGGGACAAGGAAGGG - Intronic
1127782844 15:62332208-62332230 CGTCCGGGAGGGAGGTGGAGTGG - Intergenic
1128597317 15:68964358-68964380 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1130018255 15:80203630-80203652 GTTCCAGGAGGCACGAGGAGCGG + Intergenic
1131125240 15:89854002-89854024 CGTCCGGGAGGGACGTGGGGGGG + Intronic
1131127385 15:89868325-89868347 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
1131798054 15:96040695-96040717 CGAGCAGCAGGGAAGAGGAATGG + Intergenic
1132078624 15:98845468-98845490 GGAGGAGGAGGGAGGAGGAGGGG - Intronic
1132614464 16:833291-833313 TGGCCAGGAGGGGCGAGGGGAGG + Intergenic
1132776997 16:1599812-1599834 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1134082771 16:11335964-11335986 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1134471818 16:14532763-14532785 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1136572207 16:31104613-31104635 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1136611492 16:31369241-31369263 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1138247867 16:55480400-55480422 CCGGCAGGAGGGAGGAGGAGTGG + Intronic
1138351368 16:56347843-56347865 AGACCAGGAGGCAGGAGGGGAGG - Exonic
1138509593 16:57500678-57500700 TGACCAGGAGGGGCGTGGAGAGG + Intergenic
1139425056 16:66874042-66874064 GGAGGAGGAGGGAGGAGGAGGGG - Intergenic
1139864256 16:70051265-70051287 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1139864563 16:70051967-70051989 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1139885689 16:70205311-70205333 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1141372453 16:83500504-83500526 GGAGGAGGAGGGAGGAGGAGGGG - Intronic
1141518850 16:84564198-84564220 CGACCAGGAGATTCCAGGAGAGG + Intergenic
1142508711 17:381254-381276 CTTCCGGGAGGGATGAGGAGGGG - Intronic
1142808675 17:2385188-2385210 GGACCAGGAGGGAACAGGAAGGG + Exonic
1142818637 17:2447561-2447583 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1142913111 17:3112519-3112541 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG + Exonic
1145251481 17:21299092-21299114 CCACCAGGAGGGTCAAAGAGTGG - Intronic
1145863055 17:28224411-28224433 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1146745377 17:35324105-35324127 CAACCAGGAGGGAGAAGAAGTGG - Intergenic
1147172844 17:38631503-38631525 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1147852272 17:43452151-43452173 CGTCCAGGAGGGAAGTGGGGGGG + Intergenic
1147899230 17:43773090-43773112 TGACCAGGAAGGACCATGAGGGG + Intronic
1148733304 17:49850989-49851011 CGCACAGCAGGGACGAGGCGGGG + Intergenic
1149625008 17:58074217-58074239 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
1149772303 17:59331667-59331689 GGACCCGGAGGGATGCGGAGTGG + Intronic
1150213988 17:63456765-63456787 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1151042735 17:70882641-70882663 CTTCCAAGAGGGAGGAGGAGGGG + Intergenic
1151943076 17:77304967-77304989 GGACCAGGAGGGGAGAGGAGCGG - Intronic
1152020177 17:77776603-77776625 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1152077361 17:78168099-78168121 AGACCAGGAGGAATGGGGAGGGG + Intergenic
1152696137 17:81797877-81797899 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1152823456 17:82449170-82449192 CAACCAGCAGGGACCAGGACCGG + Exonic
1153269566 18:3306522-3306544 GGATCAGGAGGGACAAGGATAGG - Intergenic
1153779825 18:8484753-8484775 CTACCAGGAAGGAAGAGAAGGGG + Intergenic
1154278250 18:12980037-12980059 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1154278345 18:12980248-12980270 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1155066505 18:22273692-22273714 GGAGGAGGAGGGAGGAGGAGGGG - Intergenic
1156252004 18:35360306-35360328 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1156489428 18:37487496-37487518 TGACCAGGAGGGAGGAGGACGGG - Intronic
1157629426 18:49080594-49080616 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1157706667 18:49813427-49813449 GGACCCCGAGGGGCGAGGAGAGG + Intronic
1158459311 18:57633014-57633036 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1159164395 18:64683385-64683407 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1160448678 18:78947125-78947147 GGAGGAGGAGGGAGGAGGAGGGG + Intergenic
1160864579 19:1251109-1251131 CGCCGGGGAGGGAGGAGGAGGGG + Intronic
1160913698 19:1487071-1487093 AAACCAGGAGGGGCGGGGAGGGG + Intronic
1161010381 19:1956981-1957003 AGAGAAGGAGGGAGGAGGAGGGG + Intronic
1161194266 19:2977504-2977526 GGACAAGGCGGGACGAGGCGGGG + Exonic
1161246525 19:3255537-3255559 CGAGGAGGAGGGAGGAGAAGAGG - Intronic
1161567741 19:5012926-5012948 CCTCCAGGAGGGAAGACGAGGGG - Intronic
1161790293 19:6355733-6355755 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1162095267 19:8306436-8306458 CGACCTGGAGGGGCACGGAGGGG + Intronic
1162163963 19:8739727-8739749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163312530 19:16522755-16522777 GGACCAAGAAGGACGAAGAGAGG + Intronic
1163444150 19:17337092-17337114 TGACCGGGAGGGACGAGTACTGG - Intronic
1163485177 19:17581158-17581180 GGACCTGGGGGGAGGAGGAGGGG - Exonic
1163669297 19:18618072-18618094 TGACCAGGAGGGAGGAGGTCAGG - Intronic
1163718421 19:18885981-18886003 GCACCAGGAGGCAGGAGGAGGGG - Intronic
1164034732 19:21443576-21443598 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1164066568 19:21721448-21721470 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1164066641 19:21721623-21721645 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1164066692 19:21721721-21721743 CGTCCAGGAGGGGGGAGGGGGGG + Intergenic
1164192462 19:22926957-22926979 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
1164192874 19:22927896-22927918 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
1164298429 19:23937191-23937213 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
1164616357 19:29669010-29669032 GGACCAGGAAGGGCGAGGAGGGG - Intronic
1164767137 19:30780821-30780843 CTACCAGGAGGCTGGAGGAGGGG + Intergenic
1166028154 19:40107816-40107838 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1166163014 19:40966396-40966418 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1166261676 19:41644988-41645010 CGTCCGGGAGGGAGGATGAGGGG + Intronic
1166417974 19:42610398-42610420 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1167246184 19:48374512-48374534 GGCCCAGTAGGGAGGAGGAGCGG - Intronic
1167970900 19:53187429-53187451 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1168061750 19:53896985-53897007 CAACTAGGAGGGAAGGGGAGGGG + Intronic
1168228741 19:55015162-55015184 GGACCTGGAGGAATGAGGAGAGG + Exonic
1168314752 19:55479864-55479886 AGAACAGGAGGGGAGAGGAGGGG + Exonic
1168452708 19:56478209-56478231 CGGGGAGAAGGGACGAGGAGGGG + Intergenic
1168695957 19:58404871-58404893 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1168703177 19:58453513-58453535 GGACCAGGAGGGCAGAGGGGAGG + Intronic
1168703254 19:58453874-58453896 CAACCAGGAGGGAAGTGAAGAGG - Intronic
925403552 2:3591261-3591283 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
926215329 2:10902632-10902654 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
926266847 2:11330907-11330929 AGAGGAGGAGGGAGGAGGAGAGG + Intronic
926413523 2:12628257-12628279 GGACCAGGTGTGAGGAGGAGAGG - Intergenic
926464159 2:13167944-13167966 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
926639545 2:15220085-15220107 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
926675018 2:15612143-15612165 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
926683301 2:15680171-15680193 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
927757795 2:25723258-25723280 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
927897715 2:26795333-26795355 CCTCCGGGAGGGAGGAGGAGGGG - Intronic
928003148 2:27540401-27540423 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
928003203 2:27540531-27540553 CGACCGGGAGGGAGGTGGGGGGG - Intronic
928558046 2:32447708-32447730 CGACCAGGAGGGAGGTGGGGGGG - Intronic
929151876 2:38755888-38755910 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
929516080 2:42605845-42605867 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930099193 2:47589999-47590021 AGACCAGGTGTGAGGAGGAGAGG + Intergenic
930201866 2:48556173-48556195 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930202116 2:48556751-48556773 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930202217 2:48556977-48556999 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930665397 2:54095665-54095687 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930821516 2:55651056-55651078 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
931205328 2:60140812-60140834 GGAAGAGGAGGGAGGAGGAGCGG - Intergenic
932295783 2:70622374-70622396 CGACCAGGTGTGAGGAGGGGTGG - Intronic
932367279 2:71161267-71161289 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
932807339 2:74795770-74795792 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
932807486 2:74796126-74796148 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
933686857 2:85148360-85148382 CCACCTGGAGGGACAAGGGGTGG - Intronic
934514545 2:94977921-94977943 CTCCCAGGAGGGAAGATGAGAGG + Intergenic
936972219 2:118186619-118186641 CGAGAAGGAGGGAGGAGGCGAGG - Intergenic
937247049 2:120500288-120500310 GGGCCAGGAGGGACAAGCAGAGG - Intergenic
937274290 2:120674114-120674136 CAACCAGGAAGGACAGGGAGTGG + Intergenic
938089108 2:128419306-128419328 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
938533865 2:132221304-132221326 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
938891191 2:135707011-135707033 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
940269518 2:151875627-151875649 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
941295667 2:163736210-163736232 GGACCAGGAGGGAGAGGGAGAGG + Intergenic
941419476 2:165264600-165264622 TGACAAGGTGGGAGGAGGAGAGG - Intronic
941768808 2:169327167-169327189 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
941786778 2:169506113-169506135 CGTCCAGGAGGGAGGTGGGGGGG + Exonic
942505498 2:176637785-176637807 CGGCCAGGAGGGCCGGGAAGAGG + Intergenic
943323649 2:186473506-186473528 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
944341188 2:198602286-198602308 TGGCAAGGAGGGATGAGGAGAGG + Intergenic
944532934 2:200683687-200683709 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
944598551 2:201283098-201283120 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
944598697 2:201283447-201283469 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
944797978 2:203207272-203207294 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
945835796 2:214835499-214835521 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
945970313 2:216226451-216226473 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
946232233 2:218298788-218298810 AGCCCAAGATGGACGAGGAGAGG - Intronic
946318296 2:218931960-218931982 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
946747450 2:222860776-222860798 CGACCAGGAGGGACGGACCGCGG - Intergenic
946751022 2:222896161-222896183 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
946751396 2:222896978-222897000 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
948074013 2:235150984-235151006 CCACCAGGATGGAAGAGGAGTGG + Intergenic
1169085792 20:2824174-2824196 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1169085867 20:2824349-2824371 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1169132538 20:3173562-3173584 GGAGCAGGAGGGGCGCGGAGCGG - Intronic
1169920070 20:10726018-10726040 CCACCAGAATGGACAAGGAGGGG + Intergenic
1169935759 20:10881657-10881679 TGACTAGGAGGGACGTCGAGGGG - Intergenic
1171861333 20:30405244-30405266 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1171861613 20:30405914-30405936 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
1172337960 20:34132727-34132749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1172402013 20:34658932-34658954 CGTCCGGGAGGGAGGCGGAGGGG + Intronic
1172402118 20:34659187-34659209 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1172457944 20:35092581-35092603 GGACCAGGAGGGGCGGGGCGGGG - Intronic
1172721177 20:37000754-37000776 CGTCCAGGAGGGAGGCGGGGGGG + Intronic
1172721229 20:37000881-37000903 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1172774969 20:37402030-37402052 CGACCAGGAGTGACGAGGATTGG + Intronic
1172907251 20:38378943-38378965 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1173273064 20:41555239-41555261 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1173628530 20:44491949-44491971 AGACCAGAAGGGACCTGGAGAGG + Exonic
1174020458 20:47525568-47525590 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1174112462 20:48205894-48205916 AGAGAAGGAGGGAGGAGGAGGGG - Intergenic
1174168774 20:48603625-48603647 AGAGAAGGAGGGAGGAGGAGGGG + Intergenic
1174843648 20:53922424-53922446 GGAAGAGGAGGGAGGAGGAGAGG - Intergenic
1174958771 20:55131701-55131723 GGCACAGGAGGGAAGAGGAGAGG - Intergenic
1175429381 20:58891260-58891282 GGAGGAGGAGGGCCGAGGAGCGG - Intronic
1175882755 20:62270331-62270353 AGGCCAGGAGGGACAAGGAGAGG - Intronic
1175882809 20:62270536-62270558 AGGCCAGGAGGGACAAGGAGAGG - Intronic
1178034444 21:28564149-28564171 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1180613814 22:17114570-17114592 TGACCAGGTAGGAGGAGGAGAGG + Exonic
1181171727 22:21013908-21013930 CCGCCAGGAGCGCCGAGGAGAGG + Intronic
1181586190 22:23854794-23854816 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1181657745 22:24317090-24317112 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1181783497 22:25209273-25209295 CCCCCAGGTGGGAAGAGGAGGGG + Intergenic
1183149621 22:36027998-36028020 GGGCCAGGAGGCACGACGAGTGG - Intronic
1183588231 22:38765495-38765517 CGCTCAGGAGAGACGAAGAGGGG + Intronic
1183782482 22:40007634-40007656 CGAGGAGGAGAGAAGAGGAGAGG - Intronic
1183819611 22:40334789-40334811 AGACGTGGAGGGAGGAGGAGAGG - Exonic
1183871574 22:40745237-40745259 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1183871649 22:40745412-40745434 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1183928997 22:41225456-41225478 CCTCCAGGAGGGCCAAGGAGGGG - Intronic
1183941031 22:41295010-41295032 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1183995630 22:41631096-41631118 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1184698272 22:46151331-46151353 CGACCGGGAGCGACGTGGCGCGG - Intronic
1185159565 22:49215084-49215106 CGACAAGGAGGGATGGTGAGTGG - Intergenic
949569956 3:5283860-5283882 CGTCCAGGAGGGAGGCGGGGGGG - Intergenic
950307104 3:11924346-11924368 TGACCAAGAGGGATGGGGAGAGG + Intergenic
950754705 3:15162844-15162866 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
950926426 3:16746072-16746094 GGACCAGGTGTGACGAGGGGAGG - Intergenic
953511008 3:43539142-43539164 GTACCAGGAGGGAGCAGGAGGGG - Intronic
953652725 3:44821260-44821282 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
954080674 3:48211421-48211443 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
954081133 3:48212439-48212461 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
954851208 3:53602111-53602133 AGACCAGGAAGGGTGAGGAGAGG - Intronic
955434854 3:58890442-58890464 CGTCCGGGAGGGACGTGGGGGGG - Intronic
956225867 3:66957476-66957498 GGAGCAGGAGGGAGTAGGAGCGG - Intergenic
956270411 3:67444044-67444066 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
956414990 3:69016199-69016221 GGGCAAGGAGGGAAGAGGAGGGG + Intergenic
957501707 3:81066510-81066532 GGAAGAGGAGGGAGGAGGAGAGG - Intergenic
958957218 3:100477542-100477564 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
960780481 3:121313444-121313466 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
960862092 3:122164688-122164710 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
960862241 3:122165041-122165063 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
960924138 3:122780141-122780163 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
961346035 3:126263948-126263970 GGAGCAGAAGGGAGGAGGAGAGG + Intergenic
961540836 3:127598316-127598338 CGACCAGAAGGGACACGGAGGGG - Exonic
961555663 3:127695187-127695209 CGACCTGGAGGAAGAAGGAGAGG + Exonic
961697250 3:128713966-128713988 GGACCAAGAGGGACAGGGAGGGG + Intergenic
961962531 3:130868358-130868380 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
962572385 3:136723963-136723985 CGACCAGGAGGGAGGTGGGGGGG + Intronic
963244613 3:143047452-143047474 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
966015434 3:175132663-175132685 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
966638970 3:182168254-182168276 GGGGAAGGAGGGACGAGGAGAGG - Intergenic
966783920 3:183608279-183608301 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
966784253 3:183609005-183609027 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
968411817 4:396130-396152 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
968553092 4:1234025-1234047 CAGCCAGCAGGGACGAGGAGGGG + Intronic
968667277 4:1828561-1828583 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
968667489 4:1829044-1829066 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
968759966 4:2437538-2437560 CGTCCAGGAAGGGAGAGGAGTGG + Intronic
968850427 4:3074375-3074397 CGGCGAGGCGGGACGAGGAAGGG - Intergenic
970454810 4:16212588-16212610 AGATAAGGAGGGAGGAGGAGTGG - Intronic
970472592 4:16393215-16393237 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
970472662 4:16393383-16393405 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
972551739 4:40141223-40141245 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
973274440 4:48292662-48292684 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
973593716 4:52465588-52465610 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
973593872 4:52465945-52465967 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
973673050 4:53238310-53238332 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
973784977 4:54325526-54325548 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
973785000 4:54325575-54325597 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
975685660 4:76917032-76917054 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
975846688 4:78532615-78532637 TTACCAGGAGCGACGAGGAGGGG - Intronic
976265623 4:83185366-83185388 CGTCCAGGAGGGAGGTGGAGGGG - Intergenic
976265763 4:83185679-83185701 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
976340731 4:83943512-83943534 CGTCCGGGAGGGAGGTGGAGGGG - Intergenic
977875403 4:102143646-102143668 AGACGATGAGGGAAGAGGAGAGG + Intergenic
978409160 4:108409676-108409698 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
979468565 4:121070486-121070508 GGACCGGGTGGGAGGAGGAGAGG + Intronic
979622479 4:122812252-122812274 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
979622578 4:122812506-122812528 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
982040490 4:151391153-151391175 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
982053596 4:151526666-151526688 CGTCCGGGAGGGAGGAGGGGGGG - Intronic
982820650 4:159939220-159939242 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
983628806 4:169828588-169828610 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
983940514 4:173530744-173530766 GCCCCAGCAGGGACGAGGAGCGG + Intergenic
984813445 4:183816493-183816515 CTAAAAGGAGGGAGGAGGAGGGG + Intergenic
984935182 4:184883478-184883500 GGAACAGGAGGGAGGAGGGGAGG + Intergenic
985736486 5:1586312-1586334 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
985911480 5:2887406-2887428 CCACCAGGAGGGACGGGAAGCGG - Intergenic
986388807 5:7265337-7265359 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
986905704 5:12491588-12491610 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
988544508 5:32142810-32142832 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
989021364 5:37013047-37013069 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989075767 5:37563180-37563202 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989211271 5:38861751-38861773 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989587541 5:43087287-43087309 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
989587936 5:43088176-43088198 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989587987 5:43088303-43088325 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
990498648 5:56372836-56372858 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
992964020 5:81983240-81983262 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
995123474 5:108559009-108559031 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
995374411 5:111458035-111458057 CGACCATCAGGGAAGGGGAGAGG + Intronic
997930855 5:138070579-138070601 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
998693779 5:144615339-144615361 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
999180997 5:149670316-149670338 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1000407749 5:160906745-160906767 CGAGCAGGAGGAAGAAGGAGAGG - Intergenic
1001431693 5:171667525-171667547 CGCTCAGGAGAGAGGAGGAGGGG + Intergenic
1001823019 5:174724698-174724720 CGACGAGGAGGGCCCAGCAGTGG + Exonic
1002473219 5:179449939-179449961 AGACCAGGAAGGCAGAGGAGGGG + Intergenic
1002481003 5:179500714-179500736 AGACCAGGAAGGCAGAGGAGGGG - Intergenic
1002658304 5:180771340-180771362 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1002877735 6:1226364-1226386 CAACAAGGAGGGGCAAGGAGGGG + Intergenic
1003430240 6:6031741-6031763 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1004414851 6:15415599-15415621 CGACCGGGAGGGAGGTGGAGGGG - Intronic
1004664206 6:17735574-17735596 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1005054898 6:21720303-21720325 TGACCAGGAAGGACCAGGAGAGG - Intergenic
1005069795 6:21851998-21852020 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1005158852 6:22836763-22836785 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1005837333 6:29718997-29719019 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1006209759 6:32384994-32385016 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1008112122 6:47505805-47505827 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1008827571 6:55716099-55716121 GGAGCAGGAGGGAAGAAGAGTGG - Intergenic
1008926319 6:56894536-56894558 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1008926468 6:56894859-56894881 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
1010059868 6:71610391-71610413 CGACCAGGATGGAAGAGGAGAGG - Intergenic
1010239407 6:73601672-73601694 CGTCCAGGAGGGAGGTGGGGTGG + Intronic
1011771016 6:90674171-90674193 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1012066616 6:94557905-94557927 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1013204622 6:107934654-107934676 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1013204740 6:107934927-107934949 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1013243912 6:108269992-108270014 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1014764037 6:125388848-125388870 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1014764112 6:125389023-125389045 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1015233963 6:130949590-130949612 GGAAGAGGAGGGAAGAGGAGGGG + Intronic
1016802124 6:148178830-148178852 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1017493725 6:154966234-154966256 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
1017843962 6:158240751-158240773 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1018391079 6:163342595-163342617 GGACCAGAAGAGGCGAGGAGGGG - Intergenic
1019177208 6:170166038-170166060 CAACCAGCAGGCAGGAGGAGAGG + Intergenic
1019406531 7:887031-887053 AGAGCAGCAGGGACTAGGAGTGG - Intronic
1019458981 7:1146811-1146833 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1019674488 7:2303041-2303063 CGTCCAGGAGGGAGGTGGGGAGG + Intronic
1019674608 7:2303315-2303337 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
1020276572 7:6628264-6628286 TGAGCAGGAGGAAAGAGGAGAGG + Intergenic
1020284797 7:6671356-6671378 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1020563939 7:9772574-9772596 AGGCCAGGAAGGATGAGGAGAGG - Intergenic
1020831790 7:13102934-13102956 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1020831815 7:13102983-13103005 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1021440310 7:20668706-20668728 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021672322 7:23046234-23046256 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1021735404 7:23636884-23636906 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021735760 7:23637689-23637711 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021789890 7:24194283-24194305 GGAGCAAGAGGGAGGAGGAGGGG + Intergenic
1022083334 7:27044979-27045001 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1023059262 7:36313006-36313028 GGACCAGGAGGGCCGGGGTGTGG + Intergenic
1024309909 7:47959730-47959752 CGTCCGGGAGGGAGGTGGAGGGG + Intronic
1024358506 7:48443743-48443765 GGAACCGGAGGCACGAGGAGAGG - Intronic
1024725513 7:52189490-52189512 GGAACAGGAGGGAAGGGGAGGGG + Intergenic
1025000635 7:55312114-55312136 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1025979229 7:66393618-66393640 CGTCCGGGAGGGAGGTGGAGGGG - Intronic
1026868341 7:73836261-73836283 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1029279581 7:99427289-99427311 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1030509043 7:110460494-110460516 AGAGGAGGAGGGAGGAGGAGAGG + Intergenic
1032042725 7:128576644-128576666 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1032042749 7:128576694-128576716 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1032291401 7:130591761-130591783 CGTCCGGGAGGGAAGTGGAGGGG + Intronic
1032569828 7:132985487-132985509 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1032569852 7:132985536-132985558 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1034234137 7:149554679-149554701 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1034234256 7:149554954-149554976 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1034638699 7:152586083-152586105 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1034961802 7:155367718-155367740 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1035280668 7:157776250-157776272 GGAAGAGGAGGGAGGAGGAGAGG - Intronic
1035319493 7:158019709-158019731 AGACCAGGTGGGACTTGGAGGGG - Intronic
1035387718 7:158485340-158485362 CGAGCAGGAGGGGCGCAGAGGGG - Intronic
1035387729 7:158485369-158485391 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387738 7:158485398-158485420 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387754 7:158485454-158485476 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387763 7:158485483-158485505 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387772 7:158485512-158485534 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387781 7:158485541-158485563 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035387790 7:158485570-158485592 CGAGCAGGAGGGGCGCAGAGAGG - Intronic
1035507709 8:149482-149504 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1037515329 8:19625179-19625201 TGACCAGGAGGGACGTGGGGTGG + Intronic
1038595189 8:28881236-28881258 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1039060666 8:33569781-33569803 TGGCCAGGAGGGACGAAGGGAGG - Intergenic
1040069857 8:43179939-43179961 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1040595588 8:48834811-48834833 TCATCAGGAGGGATGAGGAGAGG + Intergenic
1040785590 8:51159447-51159469 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1040818774 8:51534560-51534582 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1041270347 8:56104424-56104446 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1041286891 8:56272012-56272034 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1041676876 8:60547835-60547857 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1041776272 8:61526741-61526763 TGACCAGTAGAGACTAGGAGTGG + Intronic
1042089613 8:65144427-65144449 GGAGGAGGAGGGAAGAGGAGGGG + Intergenic
1042663263 8:71178833-71178855 GATCCAGGAGGGATGAGGAGAGG - Intergenic
1042865888 8:73356605-73356627 TGAGCTGGAGGGAGGAGGAGGGG - Intergenic
1043985857 8:86694130-86694152 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1044306614 8:90646461-90646483 CGACCAGGAGGGAACGGGCGAGG - Intronic
1045120349 8:99028723-99028745 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1045298489 8:100892232-100892254 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1045442499 8:102228139-102228161 CTACCAGCAGAGAAGAGGAGAGG + Intronic
1046636297 8:116678846-116678868 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1046636351 8:116678975-116678997 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1047266724 8:123315111-123315133 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047266872 8:123315462-123315484 CGTCCAGGAGGGAGGTGGTGGGG + Intergenic
1047687401 8:127316737-127316759 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047687551 8:127317062-127317084 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047847814 8:128825892-128825914 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1048368658 8:133758329-133758351 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1048368682 8:133758378-133758400 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1049122038 8:140747687-140747709 GGAGGAGGAGGGAGGAGGAGGGG + Intronic
1051849362 9:21489661-21489683 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1052492790 9:29189149-29189171 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1052941947 9:34137698-34137720 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1052999837 9:34571839-34571861 AGACCCAGAGGGACAAGGAGAGG + Intronic
1053157547 9:35791532-35791554 GGGCCGGGAGGGAGGAGGAGAGG + Intergenic
1053255828 9:36615349-36615371 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1055137322 9:72841064-72841086 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1056002429 9:82231115-82231137 CTACCAGGAGGGCTGAGGACTGG + Intergenic
1056006230 9:82274452-82274474 AGACCAAGAGGTACAAGGAGTGG - Intergenic
1056896776 9:90558893-90558915 TGACCAGGCGGGAAGAGGAAAGG + Intergenic
1057154683 9:92830699-92830721 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1058659487 9:107256654-107256676 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1058661557 9:107272193-107272215 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1058661659 9:107272447-107272469 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1059401443 9:114072870-114072892 CGCCCACAAGGGACGAAGAGGGG + Intronic
1059707748 9:116840511-116840533 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1060065438 9:120496769-120496791 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060350231 9:122852615-122852637 TGACCGGGAGGGAGGTGGAGGGG + Intronic
1060351898 9:122867441-122867463 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060682439 9:125577547-125577569 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060682550 9:125577792-125577814 CGTCCAGGAGGGAGGATGGGGGG + Intronic
1060729328 9:126027331-126027353 CAACCTGGAGGAAAGAGGAGAGG - Intergenic
1060909995 9:127341882-127341904 GGGCCAGGAAGGACCAGGAGGGG + Intronic
1061143181 9:128780510-128780532 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1061275777 9:129568849-129568871 GGAGGAGGAGGGAGGAGGAGGGG + Intergenic
1061852838 9:133425961-133425983 CGCTCAGCAGGGACGAGGTGAGG - Exonic
1062164995 9:135103198-135103220 ACACAAGGAGGGAAGAGGAGGGG - Intronic
1062459918 9:136658761-136658783 CGCCCAGCAAGGCCGAGGAGGGG + Intergenic
1203405580 Un_KI270539v1:356-378 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
1185575569 X:1169290-1169312 GGAGGAGGAGGGAGGAGGAGGGG + Intergenic
1186244811 X:7608684-7608706 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1186244961 X:7609065-7609087 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1186490788 X:9970502-9970524 CGAGAAGGAGGGAAGAGGGGAGG - Intergenic
1187183410 X:16964664-16964686 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1187736915 X:22314153-22314175 GGAGGAGGAGGGAGGAGGAGAGG + Intergenic
1188367908 X:29334330-29334352 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1189837999 X:45041306-45041328 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1190171530 X:48115455-48115477 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1190779040 X:53578467-53578489 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1191797348 X:65035039-65035061 CGACGTGGAGGGACGAGGGGAGG - Intergenic
1192141308 X:68649143-68649165 CCACCGGGAGGGACTTGGAGAGG + Intronic
1192476967 X:71452163-71452185 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193114818 X:77766323-77766345 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193132264 X:77931775-77931797 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193132364 X:77932001-77932023 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193336137 X:80291557-80291579 CGAAAAGAAGGGACGGGGAGGGG + Intergenic
1193362360 X:80591557-80591579 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1193362382 X:80591606-80591628 CGTCCGGGAGGGAGGTGGAGGGG + Intergenic
1195009978 X:100724230-100724252 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1195291234 X:103433523-103433545 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1195908751 X:109869173-109869195 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1196686151 X:118512236-118512258 CGACAAGGAGGTAGGAGGAATGG + Intronic
1199296221 X:146161819-146161841 AGACCAGGAGTGAGGAAGAGTGG - Intergenic
1199967430 X:152831572-152831594 CGAGCATGAGGGGCGGGGAGAGG + Intronic
1200059393 X:153477447-153477469 GGACCAGGAGGCAGGAGGACTGG + Intronic
1200150934 X:153951125-153951147 CGGCAAGGAGGGACGTGGCGAGG + Intronic