ID: 1143187652

View in Genome Browser
Species Human (GRCh38)
Location 17:5020303-5020325
Sequence TTGGTTGACAAGAATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143187640_1143187652 23 Left 1143187640 17:5020257-5020279 CCGCCCCAGGGAACAGGAAGAGG 0: 1
1: 0
2: 2
3: 38
4: 367
Right 1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 154
1143187643_1143187652 19 Left 1143187643 17:5020261-5020283 CCCAGGGAACAGGAAGAGGATGC 0: 1
1: 0
2: 1
3: 35
4: 336
Right 1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 154
1143187644_1143187652 18 Left 1143187644 17:5020262-5020284 CCAGGGAACAGGAAGAGGATGCC 0: 1
1: 0
2: 3
3: 36
4: 312
Right 1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 154
1143187642_1143187652 20 Left 1143187642 17:5020260-5020282 CCCCAGGGAACAGGAAGAGGATG 0: 1
1: 0
2: 3
3: 40
4: 409
Right 1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 154
1143187645_1143187652 -3 Left 1143187645 17:5020283-5020305 CCAAGCTCTTGCAATTCCCTTTG 0: 1
1: 0
2: 0
3: 13
4: 218
Right 1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143187652 Original CRISPR TTGGTTGACAAGAATGGGGT TGG Intronic
901660029 1:10793697-10793719 GTGGCTAACAAGAAGGGGGTGGG + Intronic
902275666 1:15337539-15337561 TTGGTTGTCAAAACTGGGGTGGG + Intronic
903012193 1:20339128-20339150 TTGGTTGTCATGATTGGGGATGG - Intronic
905468246 1:38172207-38172229 TGGGTTGACTAGAATTGGCTAGG + Intergenic
908338358 1:63150414-63150436 TTGGTTGCTAAGACTGGGGTGGG - Intergenic
910557093 1:88546167-88546189 TTACTTGACAAGAAGGTGGTAGG + Intergenic
914844845 1:151277162-151277184 TGGGTTTACAAGAATGGAGGAGG - Intergenic
916899122 1:169201583-169201605 TTGATTGACTATAATGGGTTGGG + Intronic
917457648 1:175199208-175199230 TGGGTTGACCAGAATGTGGGAGG + Intergenic
918593687 1:186268752-186268774 TTTGTTGACATGGGTGGGGTGGG - Intergenic
921876774 1:220205576-220205598 TTGGTTGTCAATACTAGGGTTGG + Intronic
1063371412 10:5525140-5525162 CTGTTTGACAAGGATGGGGACGG + Exonic
1065474211 10:26116844-26116866 TTGGTTGTTACAAATGGGGTTGG - Intronic
1066419662 10:35252755-35252777 TTGGATGACAACAATGCAGTTGG - Intronic
1066489901 10:35884318-35884340 TGGTTTGACAATAATGGGGAAGG - Intergenic
1068448527 10:57155686-57155708 GTGGTTGCCAGGGATGGGGTTGG - Intergenic
1070020455 10:72580323-72580345 TTGGGTGAGTAGAGTGGGGTGGG - Intronic
1070939367 10:80329809-80329831 TTGGTAGACAGGAAAGGGGCTGG - Intergenic
1072019338 10:91382756-91382778 TTGGTTGTCAGAACTGGGGTAGG + Intergenic
1072775463 10:98187533-98187555 ATGGTTTACAAGAATGAAGTAGG + Intronic
1074328941 10:112483662-112483684 TTGATTGCCATGACTGGGGTTGG - Intronic
1076564466 10:131388737-131388759 TTGGGAGGCAAGAATGGGGTGGG - Intergenic
1077972861 11:7213548-7213570 TTGGGTGACAAAAAAGGGGTGGG + Intergenic
1078224218 11:9377752-9377774 TTGGTTGTCAGGAAAGGGCTAGG - Intergenic
1080035487 11:27705696-27705718 ATGGTTGTGAAGAATGGGTTAGG + Intronic
1087182700 11:95155390-95155412 TGTGTTGAAAAGAATGGGGCTGG + Intergenic
1087440899 11:98182552-98182574 TTGATTGACAGGATTGGGGCTGG + Intergenic
1088088463 11:106009152-106009174 TGGGTTGTCAAAACTGGGGTGGG - Exonic
1088714283 11:112535175-112535197 GTGGTAGAAAAGAATGGGGGTGG - Intergenic
1089266677 11:117268435-117268457 TTGAAAGACAAGATTGGGGTCGG + Intronic
1090341771 11:126029032-126029054 TTGGTTGTGAGGGATGGGGTTGG - Intronic
1091696237 12:2630152-2630174 ATGGTTGAGAAGTAAGGGGTTGG - Intronic
1093128816 12:15364648-15364670 TTGTTTGACAAGAAAGGGGGTGG + Intronic
1098184232 12:67879225-67879247 TTGGTTGTCTAAAATGGGGAAGG + Intergenic
1099574220 12:84361225-84361247 TTGGCTGTCAAGATTGTGGTGGG + Intergenic
1102242163 12:111331444-111331466 TGGGTTGGCAAGCATGGTGTGGG - Intronic
1104392269 12:128400914-128400936 TCTGTTGTCAAGAATGGGGCTGG - Intronic
1105379497 13:19873873-19873895 TTGGGTGCCAGGCATGGGGTTGG - Intergenic
1106777909 13:33026427-33026449 TTGAATGGGAAGAATGGGGTGGG + Intronic
1108581697 13:51833578-51833600 TCGGGTGACAAGAATGGTGGAGG + Intergenic
1111166604 13:84465352-84465374 CTGATTGATAATAATGGGGTGGG + Intergenic
1112305496 13:98269671-98269693 TTGTTTGTCAAGGAAGGGGTTGG + Intronic
1115155797 14:30337534-30337556 TTGCTTGACAAGAATGGGTGGGG + Intergenic
1116123477 14:40751839-40751861 TTTGTTGACAGGAATGTGGTAGG - Intergenic
1117865284 14:60142074-60142096 TTGGTTGCCTGGAATGGGGTGGG + Exonic
1124882939 15:33659072-33659094 TTGGTTGTCATGACTGTGGTGGG + Intronic
1128377937 15:67090506-67090528 TTTGTTGGGAAGAATGGGGCAGG + Intronic
1128767763 15:70261538-70261560 GGGGTTGAGAAGAATGGGTTGGG - Intergenic
1131800168 15:96060192-96060214 TGGGTTGATGAGAATGGGGGAGG + Intergenic
1133742792 16:8663968-8663990 TTGGTTGTCATGACTGTGGTCGG - Intergenic
1133850578 16:9499599-9499621 TTGGTTGACATGACTGGGGGTGG + Intergenic
1135601990 16:23791449-23791471 TTGGTTGTCTAAAATGGGTTAGG - Intergenic
1135973510 16:27089596-27089618 TTGGCTGACATGAGTGGGGAAGG - Intergenic
1137686687 16:50391495-50391517 TTGGTTTTCGGGAATGGGGTGGG + Intergenic
1139161970 16:64520691-64520713 CTGGTTGACAAGAATATGGTTGG - Intergenic
1140583494 16:76258553-76258575 TTTGTTGAATAGAATGTGGTGGG + Intergenic
1141226272 16:82119090-82119112 TAGGTTGACATAAATGGTGTTGG + Intergenic
1141709938 16:85692496-85692518 CTGATTGACAAGTATGGGGTAGG + Intronic
1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG + Intronic
1144789208 17:17848138-17848160 TTGGTGGGCAAGGGTGGGGTAGG - Intronic
1147558009 17:41491828-41491850 TTGGTTGTCAACACTGGGGCAGG - Intronic
1147685349 17:42283776-42283798 TTCTTGGACAAGAATGGGGGTGG + Intergenic
1149185131 17:53988947-53988969 TTGGTTGCCTAAAATGAGGTGGG - Intergenic
1149940882 17:60864448-60864470 TTGGCCAACAAAAATGGGGTAGG + Intronic
1150160305 17:62892216-62892238 GTGGTTGTCAAGTAAGGGGTTGG + Intergenic
1150354567 17:64471965-64471987 TTTGTTGTAAAGAATGAGGTAGG - Intergenic
1150464561 17:65381132-65381154 TAGGTTGCCAAGTGTGGGGTGGG + Intergenic
1150966865 17:69980681-69980703 TTGGTTGTCACGATTGAGGTGGG - Intergenic
1155469604 18:26177244-26177266 TTGGTTGTCACAACTGGGGTGGG + Intronic
1157142235 18:45121045-45121067 TTGGGTGGTAAGAATGGGGGTGG - Intergenic
1157932202 18:51835416-51835438 TTGGTTGTCACAAATGGGTTGGG - Intergenic
1158219401 18:55134711-55134733 ATGGTTCACAAGCTTGGGGTTGG - Intergenic
1159220052 18:65449030-65449052 TTAGTTGACAAGAACTGTGTGGG - Intergenic
1159220947 18:65462398-65462420 TTGGTTTACTAGATTGGTGTGGG + Intergenic
1161718453 19:5890454-5890476 GTGTTTGACATGATTGGGGTGGG - Intronic
1162610000 19:11741973-11741995 TTGACTGTCAGGAATGGGGTGGG - Intergenic
1166420832 19:42634786-42634808 TTGGTTGACAGAACTGGGGGAGG + Intronic
1166564301 19:43754477-43754499 TGGGTTGGCAGGAATGGGGGCGG - Intronic
1167646049 19:50705636-50705658 TTGGTTGTCATGACTGGGGAGGG - Intronic
925468638 2:4135095-4135117 TTTCTTGACAAGAAAGGAGTTGG - Intergenic
925526486 2:4808644-4808666 TTTGTTTACAAGAATGGGGGAGG + Intergenic
925839509 2:7978620-7978642 TTGATTGACAGGAAGGTGGTGGG - Intergenic
931525718 2:63150355-63150377 TTGGTTGCCGTGACTGGGGTTGG + Intronic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
936254059 2:110894462-110894484 TTTGTTGGCATGGATGGGGTGGG - Intronic
939459471 2:142480747-142480769 TTGGTTTACATGATTGGGTTTGG - Intergenic
939539256 2:143473434-143473456 CTGCTTGACAAAAATGGGGAGGG + Intronic
940567573 2:155387350-155387372 TTGGTGGAGAAGACTGGGGAAGG - Intergenic
944275740 2:197835468-197835490 ATGGTTGCCAGGAATGGGGAGGG - Intronic
944351002 2:198726404-198726426 TATGTTGACAAGAATGGGAATGG - Intergenic
948931457 2:241134963-241134985 CTTGTTGACAAGCATGGGGTGGG - Intronic
1169840623 20:9932259-9932281 TTGCATGACAAGAATGATGTGGG - Intergenic
1172329403 20:34064529-34064551 TGGTTTGACAGGAATGGGGCAGG + Intronic
1172887627 20:38241690-38241712 TTGGGTGAAAAGTATAGGGTAGG + Exonic
1174213880 20:48901119-48901141 TTGGTTGTCATGACTGGGGATGG - Intergenic
1174886834 20:54345008-54345030 TTGGTTGTCACCACTGGGGTGGG + Intergenic
1175417221 20:58809901-58809923 TTAGTTGTCATGACTGGGGTGGG - Intergenic
1178686282 21:34713130-34713152 TTGATTGAAAAGAAGGGGGTGGG + Intronic
1179164621 21:38925790-38925812 TTGGTTGGCACAAATGGGGCAGG + Intergenic
950034955 3:9878666-9878688 TTGGTTGGCATGCATGGGGCCGG - Intronic
952245474 3:31585637-31585659 GTGGTTGCCAGAAATGGGGTAGG - Intronic
955764655 3:62329325-62329347 TTGGTTGAGAAGTAAGGGCTAGG + Intronic
957425422 3:80033014-80033036 TTAGTCCACAAGAGTGGGGTTGG - Intergenic
958164097 3:89857036-89857058 TTGGTAGTTGAGAATGGGGTAGG - Intergenic
958735192 3:98001153-98001175 TGGGTTAACAAGAATGTGGAAGG - Intronic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
961017203 3:123477515-123477537 TTGGGTGAGAAGAAAGGGGTTGG + Intergenic
961833243 3:129635662-129635684 TTTGTTCACAAGAATGAGGATGG + Intergenic
962701654 3:138006523-138006545 CTGTTTAACAATAATGGGGTTGG - Intronic
962953783 3:140245567-140245589 TGTGGTGACAAGAATGGGGCAGG + Intronic
964922392 3:161913105-161913127 TAAGTTGAAAAAAATGGGGTCGG - Intergenic
965133449 3:164731226-164731248 TTAGTTGACAAGAAGGATGTTGG + Intergenic
965330250 3:167363786-167363808 TTGGTTGAAAAGAAAACGGTGGG - Intronic
965559031 3:170044498-170044520 CAGTTTGACAAGAATGGAGTAGG + Intronic
966666954 3:182481925-182481947 TGGGTTGATAAAAATGAGGTGGG - Intergenic
969143669 4:5101461-5101483 TTGGCTCACAAGAAGGGGATGGG + Intronic
972709768 4:41583419-41583441 TTAGTTGCCAAGAATGTGCTAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977076829 4:92464041-92464063 ATGTTTGAGAAGAATAGGGTAGG - Intronic
978480370 4:109183152-109183174 TTTGTGGACATGGATGGGGTGGG - Intronic
979848128 4:125543103-125543125 TTGTTTGACAAGCTTGTGGTAGG + Intergenic
981283023 4:142983049-142983071 TTGCTGGACAAGAATGTGCTGGG - Intergenic
986238151 5:5931825-5931847 TTGGTTGACAGCAATGGAGGTGG - Intergenic
990615113 5:57499978-57500000 TTGGTTGTCATGACTGAGGTGGG - Intergenic
990790246 5:59469685-59469707 TTGCTTGTCAAGAATGGAATGGG - Intronic
992796892 5:80261364-80261386 TTGGTTAACAAGAGTAGGCTGGG + Intergenic
993267940 5:85751536-85751558 TTGGTAGTCAAAAATGGGGACGG + Intergenic
995634275 5:114167825-114167847 TTGCTTGAAAAGTATGGGATGGG - Intergenic
995923119 5:117337644-117337666 TTGGTTTAGAAGAATGTGTTTGG + Intergenic
997655700 5:135552779-135552801 TTGGGTGCAGAGAATGGGGTTGG + Intergenic
997692096 5:135833938-135833960 AAGGTTGACAAGAATGGTGAAGG - Intergenic
1000036923 5:157455964-157455986 TTGATTGTCAAAACTGGGGTGGG + Intronic
1000523068 5:162320897-162320919 TTGGTTGCCAGGGATGGGGTGGG + Intergenic
1000933459 5:167280536-167280558 TTGCTTGTGAAGATTGGGGTGGG + Intergenic
1001698730 5:173691427-173691449 CTGAATGACAAGAATGGGCTGGG - Intergenic
1002712058 5:181201259-181201281 TTGGTTGTCAACAATGGGATAGG - Intronic
1005079962 6:21946900-21946922 TTGGTTGTCATGAATGGGGTAGG + Intergenic
1007053136 6:38853497-38853519 TAGGTTGACAAGCAGGTGGTTGG - Intronic
1008395341 6:51000079-51000101 TTGGGTGAAAAGATTGGGGAGGG - Intergenic
1008820991 6:55630282-55630304 ATTTTGGACAAGAATGGGGTGGG + Intergenic
1010050227 6:71495401-71495423 TTGGCTGCAAAGAATGGGGAAGG + Intergenic
1013707298 6:112852720-112852742 ATGGTTGACAAGAAAGGGTTAGG + Intergenic
1017929079 6:158936977-158936999 TTGGTTGACCAGAATGAAATCGG - Intergenic
1021879376 7:25079022-25079044 TTGGTTGGAAAGAAAGGGATTGG - Intergenic
1022445379 7:30466158-30466180 TTGGTTTTCAAGGAAGGGGTGGG - Intronic
1024834752 7:53503761-53503783 ATGGTTGACAAAAATGGTGTGGG - Intergenic
1037279166 8:17216825-17216847 TGGTTTGACTAGAATGAGGTTGG + Intronic
1037320146 8:17633864-17633886 TTGGTGGTCTGGAATGGGGTAGG - Intronic
1038354829 8:26818150-26818172 GTGGTTGCCAAGGATGGGGGTGG + Intronic
1039195426 8:35025825-35025847 TTGGTTGTCAAAAATGGGTGGGG - Intergenic
1041918344 8:63158143-63158165 TTGGGTGGAAAAAATGGGGTCGG + Intergenic
1042015753 8:64308719-64308741 TTGGTTGACAATAAAGGGACTGG - Intergenic
1042017300 8:64328116-64328138 TTGGTGGACCAGAATGGTGGGGG + Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1048340378 8:133534131-133534153 TTGGTTGAATAGAATGGAATTGG - Intronic
1048847661 8:138615847-138615869 TTGGTTGGCAAGGATGAGATTGG - Intronic
1049333494 8:142068915-142068937 GTGGATGACAGGAATCGGGTTGG + Intergenic
1050705489 9:8391965-8391987 TTGTTTAACAAGGAGGGGGTAGG + Intronic
1051617079 9:19016564-19016586 TTGATTGTCAAAAGTGGGGTAGG + Intronic
1055479514 9:76696079-76696101 TTGGTTGTCACAACTGGGGTGGG - Intronic
1056307564 9:85305194-85305216 TTGATTGACCAGAATGGAGGTGG + Intergenic
1056347715 9:85716125-85716147 GTTGTTGATAAGAATGGTGTTGG - Intronic
1057882513 9:98803147-98803169 TTGGTTGAAAGGAATTGTGTTGG - Intergenic
1059204053 9:112446703-112446725 ATGGCTGACAAGGATGGGGAGGG - Intronic
1060759641 9:126236416-126236438 GTGGTTGCCCAGTATGGGGTGGG - Intergenic
1189301817 X:39957847-39957869 TGGGGAAACAAGAATGGGGTTGG + Intergenic
1189535856 X:41934775-41934797 GTGGGTGTCAAGAATGGAGTTGG + Intergenic
1191025315 X:55907920-55907942 TTTTTTGACTAGAATGGGGAAGG - Intergenic
1191631648 X:63328582-63328604 TTGGTAGACAAGGATTGGGCAGG + Intergenic
1192839992 X:74844891-74844913 TTTGTTGAAAAAAATGGTGTTGG - Intronic
1193451138 X:81669252-81669274 GTGGTTGACAAGAAATGTGTAGG - Intergenic
1194819310 X:98486529-98486551 TTGGTTGACAAAAATTGGCAGGG - Intergenic
1196195652 X:112836271-112836293 GTTGTTAACAAGAATGGGGGAGG + Intronic
1198974542 X:142321425-142321447 TTGATAAACAAGAATGGGGCAGG - Intergenic
1199428716 X:147734112-147734134 TTGGTTGGAAAGGCTGGGGTTGG - Intergenic
1199758414 X:150886695-150886717 TTGGTTGACAAGACTAGGGAGGG + Intronic