ID: 1143190287

View in Genome Browser
Species Human (GRCh38)
Location 17:5035365-5035387
Sequence CTCAAATGGACCCCGGGACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143190281_1143190287 -9 Left 1143190281 17:5035351-5035373 CCAACACGCTCACCCTCAAATGG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1143190287 17:5035365-5035387 CTCAAATGGACCCCGGGACAAGG 0: 1
1: 0
2: 1
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143190287 Original CRISPR CTCAAATGGACCCCGGGACA AGG Exonic
900533386 1:3165580-3165602 CTCACCTGGGCCCAGGGACAGGG + Intronic
900533414 1:3165676-3165698 CTCACCTGGGCCCAGGGACAGGG + Intronic
900533433 1:3165748-3165770 CTCACCTGGGCCCAGGGACAGGG + Intronic
904535982 1:31199634-31199656 CCCAGATGGACCCCCGGAGATGG - Intronic
912720304 1:112014525-112014547 CTCAAATGAACCCCAGGGGATGG - Intergenic
913221284 1:116662685-116662707 GTCAAATGGTCCCCAGGAAAGGG + Intronic
923689653 1:236179679-236179701 TTCATATGGACCCTGGGACTTGG - Intronic
1067361669 10:45587032-45587054 CTCAAATTGACAACAGGACATGG + Intronic
1069940468 10:71951896-71951918 CTCAAATGGACTGAGGAACAAGG + Intergenic
1075330450 10:121570191-121570213 GGCAAATGGACCCAAGGACACGG - Intronic
1077167578 11:1150680-1150702 CTGAACTGGACCCAGGCACAGGG + Intergenic
1083178202 11:60966277-60966299 CTCAAATGGAGCCTGGAACAAGG - Intergenic
1084981889 11:72833585-72833607 CAGAAATGAACCCAGGGACAGGG - Intronic
1089317244 11:117600510-117600532 CTCAAATGGCCCCTGGGACCTGG - Intronic
1105303432 13:19154069-19154091 CTCCAATGCACACCGGGACTGGG + Intergenic
1106584352 13:31044137-31044159 CCCAAATGGACCCCGGCACAGGG + Intergenic
1106836764 13:33643368-33643390 GTCAAATGGAACCAAGGACAAGG - Intergenic
1112651627 13:101405441-101405463 CTCAAATGGGCCCTGGGAATTGG - Intronic
1114539805 14:23446515-23446537 CTCACATGCATCCAGGGACAGGG - Intergenic
1119953265 14:78767889-78767911 CTTCAAGGGACCCAGGGACAAGG - Intronic
1122976455 14:105172836-105172858 CTGAGATGGCCCTCGGGACACGG - Intergenic
1137600795 16:49754862-49754884 CTCAAAGGGCCCCCTGGGCAGGG + Intronic
1141101885 16:81203503-81203525 CTAAAAGGGACTCCTGGACATGG - Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1143190287 17:5035365-5035387 CTCAAATGGACCCCGGGACAAGG + Exonic
1143219973 17:5253490-5253512 CTCAAATGGTCCACCGGACTTGG - Intergenic
1145263933 17:21370552-21370574 CTCAGAGGGGCCCCGGGCCAAGG + Intergenic
1161231438 19:3176895-3176917 CTCCCTTGGACCCCAGGACAGGG + Intronic
1165598729 19:37034589-37034611 CTCATATGTACCACTGGACAAGG + Intronic
1167724098 19:51199376-51199398 CTGAAAGGGACCCAGGGAGATGG + Intergenic
1167725721 19:51211625-51211647 GTCAAAGGGACCTCAGGACAGGG + Intergenic
930446333 2:51477772-51477794 CTGAATTGGATCCTGGGACAGGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935132227 2:100269188-100269210 CTAACATGGAGCCCGGGAGATGG - Intergenic
941108773 2:161394055-161394077 ATCACTTGGACCCCGGGAGACGG - Intronic
1171535611 20:25885652-25885674 CTCATATGTACCACTGGACAAGG - Intergenic
1171572253 20:26264254-26264276 CTCATATGTACCACTGGACAAGG + Intergenic
1173202253 20:40962702-40962724 TTCATATGGAGCCTGGGACATGG + Intergenic
1182433592 22:30315749-30315771 CTCATATGTACCCCAAGACAAGG - Intronic
1182558473 22:31141531-31141553 CTCAGATGGAGCCTGGGGCAGGG - Intergenic
1183951341 22:41354743-41354765 CTCTTCTGTACCCCGGGACAGGG - Intronic
954103700 3:48397881-48397903 CTCCAAGGGACCCAGGGACCCGG + Intronic
961155578 3:124676741-124676763 CTCAGAAGGAGCCAGGGACATGG + Intronic
961465187 3:127077076-127077098 CACAGATGGCCCCAGGGACATGG - Intergenic
961536260 3:127572866-127572888 CTCAGATGGGCCCAGGGGCAGGG + Intergenic
963073662 3:141326905-141326927 GCCAGATGGACCCCTGGACAAGG + Intronic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
980415260 4:132480002-132480024 CTCAATAGAACCCCGGTACATGG + Intergenic
984897225 4:184552381-184552403 CTCATATGTACCACTGGACAAGG + Intergenic
985685034 5:1277514-1277536 CTCACATGGAGACCGGGAGAGGG + Intronic
988520627 5:31942437-31942459 CTCACATGGACCTGGAGACATGG + Intronic
988602279 5:32650800-32650822 CTAAAATGTACCCAGGGCCAGGG - Intergenic
992381346 5:76240735-76240757 CCCAAATGGAGCCTGAGACAGGG - Intronic
997208098 5:132062082-132062104 CTCAAATGGAGCCAGAGACTGGG + Intronic
997664256 5:135615943-135615965 CTCAAAGGGTCCCAGGTACATGG + Intergenic
998377496 5:141700959-141700981 CTCAAATGGACACAGGCACCAGG - Intergenic
1022098524 7:27155701-27155723 TTGAAATGGACCCTGGCACAGGG + Intronic
1023329098 7:39094804-39094826 CTCAAATTGACCCAGGGTAAAGG + Intronic
1029495346 7:100893425-100893447 CCCCAATGGACCCTGGGCCACGG - Exonic
1029530859 7:101124347-101124369 CTCAAAAGTACCCCAAGACAGGG - Intergenic
1034174533 7:149090532-149090554 CTCACGGGGACCCCAGGACACGG + Intronic
1038266345 8:26042221-26042243 CTCAAAGTGGGCCCGGGACAGGG + Exonic
1043327446 8:79070216-79070238 CTGAACTGGCCCCCGGGGCATGG + Intergenic
1043760922 8:84067162-84067184 CTCAAATGCACTCTAGGACATGG + Intergenic
1048327016 8:133447674-133447696 CTCACATGACCCCGGGGACAGGG - Intergenic
1052423042 9:28268538-28268560 CTCAAATGGACTCATTGACAGGG - Intronic
1057724026 9:97555694-97555716 CTCACATAGAACCTGGGACATGG - Intronic
1059407290 9:114109058-114109080 CTCAAATGCACCCAGAAACAGGG + Intergenic
1059866410 9:118519448-118519470 CTCAGATGCACACAGGGACAAGG - Intergenic
1061847077 9:133393860-133393882 CTCAACTGGAACCCCAGACAGGG - Intronic
1200698443 Y:6381802-6381824 CTCACCTGGACCCCTGGCCATGG + Intergenic
1201035671 Y:9782897-9782919 CTCACCTGGACCCCTGGCCATGG - Intergenic