ID: 1143197842

View in Genome Browser
Species Human (GRCh38)
Location 17:5089761-5089783
Sequence CTGGGGAGGCTGAGGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10768
Summary {0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143197842_1143197850 12 Left 1143197842 17:5089761-5089783 CCCTCCTACCTCAGCCTCCCCAG 0: 5
1: 90
2: 940
3: 3161
4: 6572
Right 1143197850 17:5089796-5089818 CAGACACATGCCACTGCCCCTGG 0: 1
1: 10
2: 120
3: 1124
4: 8843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143197842 Original CRISPR CTGGGGAGGCTGAGGTAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr