ID: 1143201996

View in Genome Browser
Species Human (GRCh38)
Location 17:5119789-5119811
Sequence CATCTCAGCTGATAAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143201994_1143201996 4 Left 1143201994 17:5119762-5119784 CCAGCACTACAAGTGACTCACAG 0: 5
1: 0
2: 0
3: 8
4: 97
Right 1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 160
1143201993_1143201996 5 Left 1143201993 17:5119761-5119783 CCCAGCACTACAAGTGACTCACA 0: 5
1: 0
2: 0
3: 8
4: 118
Right 1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143201996 Original CRISPR CATCTCAGCTGATAAACAGC TGG Intronic
900654020 1:3746248-3746270 CATCTCAGAGGATCAACAGTGGG + Intergenic
903266212 1:22159595-22159617 AATGTCAGCAGATAAACAACTGG + Intergenic
903303973 1:22399804-22399826 CAGCTCAGCTTATAATCAGGTGG + Intergenic
904120280 1:28193714-28193736 CCTCTTACCTGAGAAACAGCAGG + Intronic
904803377 1:33113378-33113400 CATCTCAGCTCAAAAACACAGGG - Intronic
905817687 1:40964841-40964863 CATCTCTGCTGATTATAAGCTGG + Intergenic
906846457 1:49197962-49197984 AATCTCAGCTCATAACAAGCTGG - Intronic
908796413 1:67834169-67834191 CATCGCAGTTGGTACACAGCGGG - Intergenic
912265014 1:108148646-108148668 CTTCTCAGCTTGTAGACAGCTGG - Intronic
912662446 1:111544597-111544619 CTTATCAGCTGATAAACATTTGG + Intronic
915803272 1:158817383-158817405 CATCTCAGAAGAGAAACTGCTGG + Intergenic
916503617 1:165408120-165408142 CATCTCAGCTGAGACACAGATGG - Intronic
918029998 1:180798526-180798548 CATCTCACCTAATAACCAGTTGG - Intronic
920697719 1:208194263-208194285 CAGATCAGCTCATTAACAGCAGG - Intronic
923897556 1:238289064-238289086 AATCTGAGCTGCCAAACAGCAGG + Intergenic
924659762 1:246005572-246005594 CCTCTCAGCTGGAATACAGCAGG + Intronic
1064292355 10:14047531-14047553 CCCATCAGCTGATAATCAGCTGG - Intronic
1066070818 10:31809121-31809143 TTTCTCATCTGAAAAACAGCAGG + Exonic
1067903517 10:50266609-50266631 CATCTCACATGATTAAGAGCAGG - Intergenic
1072220135 10:93319745-93319767 CATCTCTGCTGAGAAGGAGCCGG + Intronic
1072593547 10:96849692-96849714 TATCTCAGCTGAAAAGCACCGGG - Intronic
1073413869 10:103365273-103365295 CATCTCAGCTCCTAAAGTGCTGG + Intergenic
1075073672 10:119336101-119336123 CACCTCAGCACAAAAACAGCTGG - Intronic
1075945801 10:126432097-126432119 AAGCTCATCTGATAAATAGCAGG + Intronic
1077462859 11:2719379-2719401 CATCTCAGCCCCCAAACAGCTGG - Intronic
1080389474 11:31831331-31831353 TAACTCAGCTAGTAAACAGCAGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082166505 11:48955955-48955977 CATCTCAGATGATGGGCAGCCGG + Intergenic
1082863313 11:57875275-57875297 CATCTCAGCTGAGAGCCCGCCGG - Intergenic
1084072045 11:66743186-66743208 CATCAAACTTGATAAACAGCTGG - Intergenic
1084989553 11:72909912-72909934 CATCTCAGATGATGGGCAGCCGG - Intronic
1086430480 11:86732172-86732194 CATCTCAGATGATGGCCAGCCGG - Intergenic
1087593106 11:100217764-100217786 CTTCTAAGCTGAATAACAGCTGG - Intronic
1089075002 11:115731141-115731163 CATCTCAGCTGACAAAAAGCAGG + Intergenic
1090534210 11:127622943-127622965 CATTTCAGTTTATAGACAGCAGG - Intergenic
1093070145 12:14700035-14700057 GATATCAGCTGAGAAACAGAAGG - Intergenic
1096331102 12:50713593-50713615 CATCTCCTCTGAAAAACATCTGG - Intronic
1098990317 12:77058605-77058627 CACCCCTGCTGATAAGCAGCAGG - Intronic
1100253936 12:92862022-92862044 CATATAAGCTGATGAACAGAAGG + Intronic
1100714612 12:97292745-97292767 AAACTCAGCTGATGATCAGCAGG + Intergenic
1105291791 13:19058168-19058190 CATCTCAGCTCCTAAGAAGCAGG - Intergenic
1108910082 13:55537902-55537924 CATTTTCTCTGATAAACAGCTGG - Intergenic
1111942789 13:94630761-94630783 CATCTCAGCTGAGAACCTGAAGG - Exonic
1115324136 14:32118133-32118155 CAACTTAGCTGATAAACCGAAGG - Intronic
1116185139 14:41590852-41590874 TACCTCATCTGATAATCAGCAGG - Intergenic
1127378735 15:58409429-58409451 AATCTCATCTGAAAAACAACTGG - Intronic
1128377502 15:67088001-67088023 CATCTGAGCTGTCAATCAGCTGG - Intronic
1130979752 15:88804237-88804259 CCTCTCAGCTGACAGACGGCAGG - Intronic
1131228624 15:90645039-90645061 CAGCTCAGGTAATATACAGCAGG - Intronic
1133155616 16:3873395-3873417 CACCTCAGCAGATACATAGCCGG - Intronic
1136088415 16:27901955-27901977 CATCTGAGCTGGGAAGCAGCCGG - Intronic
1136994952 16:35182931-35182953 CATTCCAGCTGAGAAGCAGCAGG - Intergenic
1136995510 16:35186083-35186105 TCTTTCAGCTGAGAAACAGCTGG + Intergenic
1138500573 16:57440625-57440647 TATCTCAACTGAAAAACAACAGG + Intronic
1139041405 16:63003176-63003198 AATCTCTGCTGATAAACAAGTGG + Intergenic
1139560317 16:67737682-67737704 CACCCCAGCTGACACACAGCTGG + Intronic
1141697006 16:85624879-85624901 CAGCTCAGCTGAGACAGAGCCGG - Intronic
1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG + Intronic
1147642098 17:42009208-42009230 CATCTCCGCTAATAAAGAGAAGG + Intronic
1149462803 17:56846164-56846186 CTCATCAGCTGATGAACAGCTGG - Intronic
1150958020 17:69883322-69883344 CATCCCAGCAGAAAATCAGCTGG + Intergenic
1153190571 18:2533342-2533364 CATCTCAGCAGAAAAACAGAGGG + Intergenic
1156220151 18:35042743-35042765 CCTCTCAGCTGATGAGCAACAGG + Intronic
1157367597 18:47080051-47080073 CATTTCCTCTGATCAACAGCTGG + Intronic
1157487124 18:48095879-48095901 CTTGTGAACTGATAAACAGCTGG + Intronic
1162160011 19:8705056-8705078 CATCTCGGATGATAATCTGCTGG + Intergenic
1167588766 19:50391165-50391187 CATCTCAGACGATGAGCAGCCGG + Intronic
928273694 2:29879956-29879978 CATCTCAGGTGATAAAGAGTTGG - Intronic
930724418 2:54668389-54668411 CATCTCCTCTGATAAACACGAGG + Exonic
931215114 2:60234752-60234774 CATCTCAGCTGAGCAAAGGCTGG - Intergenic
932219063 2:69986338-69986360 CTTCTCAGCTGCTAAGCAGAGGG - Intergenic
932410322 2:71543289-71543311 CATCTCAGATGATGGGCAGCCGG + Intronic
932924414 2:75955914-75955936 CCTGTCAGCTGAAAGACAGCAGG - Intergenic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
934544623 2:95204705-95204727 CATCTCACTTTATTAACAGCAGG - Intergenic
934723285 2:96596944-96596966 CATCACAGCTGAGAAGCTGCAGG - Intronic
935486427 2:103661005-103661027 CATCACAGCTGACACACAGTGGG - Intergenic
936698664 2:114983419-114983441 AATCTCAACTAATAAACAGTTGG + Intronic
944590501 2:201212655-201212677 CCTCTCATCTGATAAAGAGTTGG + Intronic
945831703 2:214795210-214795232 CATTTCAGCTGATATATAACTGG + Intronic
945953160 2:216059487-216059509 CTTATCAGCTGATAAACATTTGG + Intronic
947579782 2:231307925-231307947 CATCCCAGCTGAGGAGCAGCAGG + Intronic
1169357272 20:4917719-4917741 CATCTCAGCTGGGCAACAGGAGG - Intronic
1170410982 20:16091569-16091591 TTTATCAGCTGATAGACAGCTGG - Intergenic
1172442185 20:34973615-34973637 CATCTCAGCCCATCAGCAGCGGG - Intergenic
1179546063 21:42112938-42112960 CATCTCAGGAGATTCACAGCAGG + Intronic
1181869199 22:25884560-25884582 CCTCTCAGCTAAAGAACAGCTGG + Intronic
950058093 3:10044581-10044603 CATCTCAAAAGATAAAAAGCCGG + Intronic
951140408 3:19151639-19151661 TATCTCAACTGATAAATAGTAGG - Intronic
955173091 3:56584520-56584542 CATCTCAGATGATGGGCAGCCGG + Intronic
955448948 3:59046928-59046950 CATCTAAAATGATACACAGCAGG + Intronic
955810316 3:62781258-62781280 CAACTCAGCTGCTAAAGGGCTGG - Intronic
958411563 3:93823058-93823080 CTTCTCAGCAAATAAACAGCAGG + Intergenic
961031878 3:123613159-123613181 GATTTCAACTGATAAAGAGCTGG - Exonic
961083524 3:124046375-124046397 CATCTGACCTGAAAAACACCTGG - Intergenic
961623923 3:128246172-128246194 CACCTGAGCTGAACAACAGCAGG - Intronic
962596819 3:136954754-136954776 CATGTCAGAAGATAAACCGCTGG - Intronic
964733468 3:159892116-159892138 CATCTCGGATGAGAAGCAGCTGG - Exonic
965763646 3:172107688-172107710 CTTCACAGCTGATGATCAGCTGG + Intronic
966906658 3:184531047-184531069 CATCTCAGAGAATAAGCAGCAGG + Intronic
967146826 3:186613364-186613386 TATTTCAGCTCATAGACAGCAGG - Intronic
968542431 4:1174812-1174834 CATCTCAGCAGATGAAGTGCTGG - Intronic
970263527 4:14255257-14255279 CATCTGAGCTGAGAAACTACTGG - Intergenic
972304685 4:37820398-37820420 CATCTCAGATGATGGGCAGCCGG - Intergenic
972919724 4:43923539-43923561 CTTCACAGCTGAAAATCAGCAGG - Intergenic
977423221 4:96830314-96830336 AATGTTAGCTGATAAACAGATGG - Intergenic
978718156 4:111871229-111871251 CATCTCAACAGAAAATCAGCTGG + Intergenic
980736044 4:136890128-136890150 TATTCCAGCTGATGAACAGCTGG - Intergenic
981247741 4:142560039-142560061 CATCACATCAGATAAGCAGCAGG + Intronic
982981001 4:162134930-162134952 CATGTCAGCTGCTAAACTGGTGG + Intronic
985325710 4:188767368-188767390 CATTTCAGAAGAAAAACAGCAGG + Intergenic
986160799 5:5226610-5226632 CATCTAAACTGATAAACCTCAGG - Intronic
986200919 5:5577549-5577571 CATTGCTGCTGATAAACAGTGGG - Intergenic
986577112 5:9223816-9223838 CATTTCAGCTGACACACATCAGG + Intronic
990939878 5:61191154-61191176 CCTCTCAGCTCCTAGACAGCTGG + Intergenic
992674131 5:79088679-79088701 CACCTCAGCTGCTCAGCAGCTGG - Exonic
993535612 5:89082092-89082114 CTTCTCTCCTGAGAAACAGCTGG - Intergenic
993598508 5:89889908-89889930 CATCTCAGCAGCTAAACTGAGGG - Intergenic
997570829 5:134926024-134926046 CTTCTCAGCCGATGAATAGCTGG + Intronic
998000701 5:138622735-138622757 CATCTCCGTGGACAAACAGCTGG - Intronic
1000330278 5:160200102-160200124 CATCTCTGCTGCTTAATAGCTGG + Intronic
1001687464 5:173604882-173604904 CATCCCACCTGATAAGCAACAGG - Intergenic
1003153045 6:3568889-3568911 GGACTCTGCTGATAAACAGCAGG - Intergenic
1006696801 6:35937937-35937959 CAACTAAGATGAAAAACAGCTGG - Intergenic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1010436914 6:75842152-75842174 CATCTAAGTTGATCAAGAGCAGG - Intronic
1012801971 6:103842042-103842064 CATCTCAGCTTCTAAGTAGCTGG + Intergenic
1012829144 6:104184691-104184713 AATGTCAACTGATTAACAGCTGG + Intergenic
1012967957 6:105695855-105695877 AATCACAGCTGAGAAACTGCTGG + Intergenic
1013606957 6:111759429-111759451 CTTCTCAGCTCATAAACAAATGG + Intronic
1013849654 6:114498423-114498445 CCCTTCAGCTGATAATCAGCTGG + Intergenic
1014044474 6:116869289-116869311 TATTTCAGCTGATAACCAGTTGG - Intergenic
1015834083 6:137400462-137400484 CATCTCAGGGAAAAAACAGCAGG - Intergenic
1017053600 6:150417959-150417981 CTCCTCAGCAGATAAACATCTGG + Intergenic
1018177818 6:161193260-161193282 CATGTCAGCTTAAACACAGCTGG - Intronic
1019860707 7:3656087-3656109 CAAATGAGCTGAGAAACAGCTGG - Intronic
1021811015 7:24401083-24401105 CATCACAGCTGATAATCTCCTGG + Intergenic
1022780849 7:33581575-33581597 GAGCCCAGCTGATAAATAGCTGG + Intronic
1023632482 7:42178116-42178138 CATCTCAGCTGGGACACAGCTGG - Intronic
1027526741 7:79278713-79278735 CATCTCTGCTTATAGACAGTGGG + Intronic
1027938738 7:84644043-84644065 CATCTTATCTTCTAAACAGCTGG - Intergenic
1029525663 7:101092355-101092377 CATCTCAGATGATGGGCAGCCGG - Intergenic
1031522846 7:122787586-122787608 CATCTCCGCCAATAGACAGCTGG + Intronic
1034158018 7:148971586-148971608 CACCTCAGCTAACAAATAGCTGG + Intergenic
1036737155 8:11329881-11329903 CATCTCAGATGATGGGCAGCTGG - Intergenic
1036828450 8:11999422-11999444 TATCTATGTTGATAAACAGCTGG + Intergenic
1037161224 8:15775061-15775083 CTCCTCAGCTGATGAACATCTGG - Intergenic
1041614790 8:59893724-59893746 CACCTCAGCTGCTCAGCAGCTGG + Intergenic
1043536568 8:81211522-81211544 CATGTTAGCTGGTAAAGAGCTGG - Intergenic
1046346828 8:112940219-112940241 TATCTCAGCAGTGAAACAGCAGG - Intronic
1047656011 8:126978125-126978147 TATCACAGCTGATAGACAGTAGG - Intergenic
1048140519 8:131789928-131789950 CAGCTCAGTTCCTAAACAGCAGG + Intergenic
1052503133 9:29317982-29318004 CAGCTCAACTGATACAGAGCTGG + Intergenic
1053350831 9:37412290-37412312 CGTCCAAGCTGAGAAACAGCAGG - Intergenic
1056142249 9:83694127-83694149 CATCTCACCTATTAAACATCCGG + Intronic
1057268566 9:93634422-93634444 CATCTCAGCTCTTAAGAAGCAGG + Intronic
1057664988 9:97038458-97038480 CTTCTTGGCTGATACACAGCAGG + Intronic
1058108466 9:101002988-101003010 AATCTCATCTGACAAAGAGCAGG - Intergenic
1060562393 9:124556917-124556939 CAAGTCAGCTGGCAAACAGCAGG + Intronic
1202630510 M:12750-12772 CCTCTCAGCCGATGAACAGTTGG - Intergenic
1186552333 X:10519713-10519735 CACCTCAAATGATGAACAGCTGG + Intronic
1187747880 X:22429477-22429499 CATATCAGCTGAAAAACATTGGG + Intergenic
1188556816 X:31421221-31421243 CATCACATCTGAAAAATAGCTGG - Intronic
1192123528 X:68478931-68478953 CATCCCAGATGATGGACAGCCGG - Intergenic
1192850027 X:74945009-74945031 CATCTCAGTTGATAAAAAGAAGG - Intergenic
1200527777 Y:4295565-4295587 CATCTCAGATGATGGGCAGCTGG - Intergenic
1201938234 Y:19430964-19430986 GCTCTTAGCTAATAAACAGCAGG - Intergenic
1202048307 Y:20756092-20756114 AATCTGCGGTGATAAACAGCGGG - Intergenic