ID: 1143202621

View in Genome Browser
Species Human (GRCh38)
Location 17:5122901-5122923
Sequence CCCCGGCTTCGGGGTGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143202621_1143202628 -1 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202628 17:5122923-5122945 GACCGCCAAGCCGGAGCCAGTGG 0: 3
1: 0
2: 1
3: 12
4: 107
1143202621_1143202638 22 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202638 17:5122946-5122968 AGGGGGCGAAGTCGGCGAGTTGG 0: 1
1: 0
2: 3
3: 17
4: 65
1143202621_1143202626 -10 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202626 17:5122914-5122936 GAAGCCGGGGACCGCCAAGCCGG 0: 3
1: 0
2: 0
3: 7
4: 92
1143202621_1143202633 4 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202633 17:5122928-5122950 CCAAGCCGGAGCCAGTGGAGGGG 0: 3
1: 1
2: 1
3: 12
4: 203
1143202621_1143202634 5 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202634 17:5122929-5122951 CAAGCCGGAGCCAGTGGAGGGGG 0: 1
1: 2
2: 1
3: 23
4: 257
1143202621_1143202631 3 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202631 17:5122927-5122949 GCCAAGCCGGAGCCAGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 163
1143202621_1143202636 14 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202636 17:5122938-5122960 GCCAGTGGAGGGGGCGAAGTCGG 0: 1
1: 0
2: 0
3: 22
4: 231
1143202621_1143202630 2 Left 1143202621 17:5122901-5122923 CCGAGAGCACCCCGAAGCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 120
Right 1143202630 17:5122926-5122948 CGCCAAGCCGGAGCCAGTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143202621 Original CRISPR CCCCGGCTTCGGGGTGCTCT CGG (reversed) Intronic