ID: 1143204107

View in Genome Browser
Species Human (GRCh38)
Location 17:5131141-5131163
Sequence CACTGTCCCCATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 6, 1: 1, 2: 4, 3: 35, 4: 290}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143204096_1143204107 1 Left 1143204096 17:5131117-5131139 CCATTTCCCTAGAGCTACAGCCC 0: 3
1: 14
2: 3
3: 39
4: 176
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204089_1143204107 21 Left 1143204089 17:5131097-5131119 CCACCGGCCCCTGTCCTCCTCCA 0: 1
1: 0
2: 7
3: 78
4: 709
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204088_1143204107 22 Left 1143204088 17:5131096-5131118 CCCACCGGCCCCTGTCCTCCTCC 0: 1
1: 0
2: 8
3: 52
4: 605
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204097_1143204107 -5 Left 1143204097 17:5131123-5131145 CCCTAGAGCTACAGCCCTCACTG 0: 16
1: 2
2: 1
3: 15
4: 135
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204098_1143204107 -6 Left 1143204098 17:5131124-5131146 CCTAGAGCTACAGCCCTCACTGT 0: 16
1: 2
2: 1
3: 33
4: 193
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204095_1143204107 4 Left 1143204095 17:5131114-5131136 CCTCCATTTCCCTAGAGCTACAG 0: 3
1: 14
2: 2
3: 19
4: 201
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204094_1143204107 7 Left 1143204094 17:5131111-5131133 CCTCCTCCATTTCCCTAGAGCTA 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204090_1143204107 18 Left 1143204090 17:5131100-5131122 CCGGCCCCTGTCCTCCTCCATTT 0: 1
1: 2
2: 5
3: 82
4: 672
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204092_1143204107 13 Left 1143204092 17:5131105-5131127 CCCTGTCCTCCTCCATTTCCCTA 0: 1
1: 2
2: 1
3: 75
4: 602
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204093_1143204107 12 Left 1143204093 17:5131106-5131128 CCTGTCCTCCTCCATTTCCCTAG 0: 1
1: 2
2: 1
3: 51
4: 366
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290
1143204091_1143204107 14 Left 1143204091 17:5131104-5131126 CCCCTGTCCTCCTCCATTTCCCT 0: 1
1: 2
2: 6
3: 118
4: 1116
Right 1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG 0: 6
1: 1
2: 4
3: 35
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143204107 Original CRISPR CACTGTCCCCATGGGGAAGG GGG Intronic
900386408 1:2412899-2412921 CGCTGTCCCCAGTGGGAGGGCGG - Intronic
900405872 1:2492785-2492807 CTCTGTCCCCCTGGGGTAGCCGG + Intronic
900574242 1:3375139-3375161 CACTGTCACGATGAGGATGGTGG + Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900702519 1:4057139-4057161 CACTGTCTTCATGGTGCAGGGGG + Intergenic
901326978 1:8372735-8372757 CTCTGTCTGCATGGGCAAGGAGG - Intronic
901405332 1:9041315-9041337 GCCTGGCCCCATGGGGGAGGTGG - Intronic
901524627 1:9812349-9812371 CTCTTTTCCCAAGGGGAAGGAGG + Intronic
902121335 1:14168553-14168575 CACTGTTGCCATGAGGAAGCTGG - Intergenic
902626227 1:17677977-17677999 CGCAGCCCCCATGAGGAAGGAGG - Intronic
902651012 1:17837616-17837638 CTCTGTGCCCTTGGGGGAGGGGG + Intergenic
902659960 1:17894119-17894141 CACAGTCCACATGGGGTGGGTGG + Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
905023624 1:34835367-34835389 CACAGTCCACCTGGGGAAGCAGG + Intronic
907162347 1:52380161-52380183 GACTATTCCCATGGGAAAGGAGG + Intronic
907896692 1:58699541-58699563 AACTATCCCCATGTGGAAGAAGG + Intronic
909698161 1:78490917-78490939 CTCTGTGCCCATGGAAAAGGGGG + Intronic
912248288 1:107984102-107984124 CTCTGTGCCCATGGAGAGGGTGG - Intergenic
912272789 1:108227976-108227998 CCCTGTCCTCAGGGGGAGGGAGG - Intronic
912295431 1:108466346-108466368 CCCTGTCCTCAGGGGGAGGGAGG + Intronic
912811424 1:112798123-112798145 CACTGACCCTGTGGAGAAGGTGG + Intergenic
913186345 1:116373502-116373524 CACCGCCACCATGGGGAAGGGGG + Intronic
914195876 1:145447952-145447974 GAGGGTCCCCATGGGCAAGGAGG - Intergenic
914395803 1:147266996-147267018 CATATTCCCCATGGGTAAGGGGG + Intronic
914815828 1:151061306-151061328 TGCTGCCACCATGGGGAAGGGGG - Intronic
915508520 1:156372619-156372641 CACTGTCCCCTAGAGGCAGGCGG + Intronic
916001414 1:160619939-160619961 CATTGTGCCCTTGGGGAAAGTGG - Intronic
916630262 1:166605352-166605374 CACTGTTCGCATGTTGAAGGGGG + Intergenic
916803375 1:168235103-168235125 CACTGGTCCCATGAGGAAGATGG - Exonic
918758572 1:188371106-188371128 CACTGTCCCCATTGAAAATGTGG - Intergenic
920039309 1:203085451-203085473 CCCCGTCCCCTTGGGGCAGGGGG + Intronic
920200174 1:204255331-204255353 AACTGCCCCCAGGGGGCAGGTGG - Intronic
922184789 1:223264739-223264761 CACAGTCCCCACCGGGAAGGAGG + Exonic
922422817 1:225471086-225471108 CTCTGTCCCCTTAGGGATGGAGG - Intergenic
922616074 1:226961895-226961917 CTGTGTCCTCATGGGGCAGGAGG + Intronic
923266526 1:232319737-232319759 CACTGTCCTCAGCTGGAAGGAGG - Intergenic
923993343 1:239464454-239464476 CAATGTCCCCATGGAAATGGAGG - Intronic
924595270 1:245439876-245439898 CACTTTGCCCAAGGGTAAGGTGG - Intronic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1063998477 10:11643010-11643032 TCCTGTCCCCCTGGGTAAGGAGG + Intergenic
1065701032 10:28425621-28425643 CATTGTCCCCAGGGGAAGGGTGG - Intergenic
1068791043 10:61031594-61031616 CATTGGCCCCATGAGGAAGCTGG - Intergenic
1069574678 10:69517873-69517895 AACTGGGCCCATGGGAAAGGGGG + Intergenic
1071524053 10:86347963-86347985 CACTGGGACCATGGGGAAGGTGG - Intronic
1072206154 10:93206937-93206959 CACTGTGCCCATGCTGAAAGAGG - Intergenic
1072518523 10:96210179-96210201 GACTTGCCCCATGGGGCAGGGGG - Intronic
1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG + Intronic
1074981256 10:118621563-118621585 GACTGTTCTTATGGGGAAGGTGG - Intergenic
1075058466 10:119237759-119237781 CAGTGTTCCCATGGGGAGTGGGG - Intronic
1075102518 10:119516400-119516422 CTGTGTCCTCATGGGGAAAGTGG - Intronic
1076285924 10:129296492-129296514 CACCATCCCCTGGGGGAAGGTGG + Intergenic
1076438390 10:130462290-130462312 CACGGGACCCATGGGGAAGGGGG + Intergenic
1076593633 10:131609432-131609454 CACAGGCCACATGGGAAAGGGGG + Intergenic
1077555589 11:3224514-3224536 CTCTGTCCCCTGGTGGAAGGAGG - Intergenic
1077725490 11:4671100-4671122 CACTGACACCATGGAGAAAGGGG + Intergenic
1079003128 11:16774165-16774187 CACTCTCCCCACATGGAAGGAGG - Intergenic
1080388656 11:31825165-31825187 TAGTGTCCCCTTGGGGAAGGGGG - Intronic
1080699284 11:34630880-34630902 CACTGGCTTCATGGGGGAGGGGG - Intronic
1080752083 11:35160031-35160053 CACTCTCCCCAGGGGCAATGGGG + Intronic
1081582889 11:44364774-44364796 CACTGTTACCTTGGGGATGGTGG - Intergenic
1081679245 11:44990174-44990196 CAGCGATCCCATGGGGAAGGCGG + Intergenic
1081861343 11:46334784-46334806 GAATGTCCCCCTGGGGCAGGAGG + Intronic
1082636670 11:55603569-55603591 CACTTTCCCCATGGACAAGATGG - Exonic
1083277264 11:61603835-61603857 CATGGGCCCAATGGGGAAGGAGG - Intergenic
1083367903 11:62152533-62152555 TACTGTCACGATGGGGCAGGTGG + Exonic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084317701 11:68354914-68354936 CCCTGTCCCCACGGGGCCGGAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084748891 11:71190821-71190843 CACTTTCCCCATCTGGAAGGTGG + Intronic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1084958637 11:72704449-72704471 CACCTTCCCCATTGGGAAAGTGG - Intronic
1084972852 11:72781169-72781191 CACACTCCCCATGGAGAAGCTGG - Exonic
1085703158 11:78763250-78763272 CACTGTCACCATGTAAAAGGGGG - Intronic
1086413449 11:86566172-86566194 CACAGTCCCCATGGGGATTCTGG - Intronic
1086596302 11:88575518-88575540 CAATGTCTGCATGGGCAAGGTGG + Intronic
1088339887 11:108752057-108752079 CTCTCTCTCCATGGGGTAGGTGG + Intronic
1088792097 11:113235201-113235223 CACTGCCCCCAGGGAGAAGAAGG - Intronic
1089659129 11:119974497-119974519 ATCTTCCCCCATGGGGAAGGAGG - Intergenic
1090118220 11:123997254-123997276 CACTTTCCCCTTGGGCAATGTGG - Intergenic
1090265528 11:125350902-125350924 CAGGGTCCTCCTGGGGAAGGAGG + Intronic
1091009112 11:131982208-131982230 CACTGTTCTCATGGGAAGGGAGG + Intronic
1091393918 12:142136-142158 GACTGTCCCCAAGGAGAAAGAGG - Intronic
1092033767 12:5312256-5312278 CACTGATACCATGGTGAAGGTGG + Intergenic
1092103646 12:5905268-5905290 CACTGCCCCCAGGGTGATGGGGG - Intronic
1092294696 12:7189141-7189163 CACTGTCTCCATGGAGACAGGGG - Intronic
1094176896 12:27550191-27550213 CAGTGGCCCCATGGGGGAGCTGG + Intronic
1094474610 12:30831738-30831760 CACTTTCCCCACTGGGATGGGGG + Intergenic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1096563952 12:52460235-52460257 AACTATCCCCATGGATAAGGGGG + Intergenic
1098179723 12:67833008-67833030 CACTGGCCCCATGGTGAGTGTGG - Intergenic
1099200951 12:79675953-79675975 CACTGACCCCATTGTGAAGCTGG + Intronic
1100870881 12:98908745-98908767 CATTGTTCCCAAGAGGAAGGTGG + Intronic
1101300309 12:103472826-103472848 CCCTGTACCCATGGGGAAGACGG + Intronic
1102520199 12:113472984-113473006 CGCTGGCCCCAGGGGAAAGGAGG - Intergenic
1102730212 12:115102574-115102596 GACTGTCCCCAGAGGCAAGGTGG + Intergenic
1103912453 12:124359963-124359985 CACCGTCCCCACGGGGAATGAGG + Intronic
1104187259 12:126444717-126444739 CACTGTCACCAAGGAGATGGTGG - Intergenic
1104736947 12:131140847-131140869 CACTGTCACCATGTGGCAGGTGG - Exonic
1105415926 13:20211305-20211327 CACTGTCCCAGTGGGGATGTTGG - Intergenic
1107188253 13:37548979-37549001 CACAGTCCCCATGGCTAAGGAGG - Intergenic
1107188522 13:37550871-37550893 CACAGTCCCCATGGCTAGGGAGG - Intergenic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1110006753 13:70281925-70281947 CATTGTCCCCATGGGGCATGAGG - Intergenic
1111907453 13:94271784-94271806 CACTTTCCAGATGAGGAAGGAGG - Intronic
1117498125 14:56326201-56326223 CACTATCCTCATGGAAAAGGAGG + Intergenic
1117523498 14:56574813-56574835 CACTGCCACCATGGAGAAGAGGG - Intronic
1117762594 14:59046739-59046761 TTCAGACCCCATGGGGAAGGGGG - Intergenic
1118055468 14:62075210-62075232 CACAGTCCCCATGTGAAAGAGGG + Exonic
1119555813 14:75551516-75551538 CACTGAACCCGTGGGGAAGAAGG - Intergenic
1120328786 14:83061119-83061141 CACTTCCCCCACGGGGAATGTGG - Intergenic
1120865332 14:89291497-89291519 CACAGGCCCCCTGGGGATGGCGG - Intronic
1121607537 14:95252293-95252315 CACTGTCCCCATACGGAAAGTGG + Intronic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122289105 14:100670192-100670214 CACTGTCCCCATGCTGCAGATGG - Intergenic
1122883360 14:104699909-104699931 CACTGGCCCCCTGGGGCAGTTGG + Intronic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124959372 15:34383262-34383284 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1124975998 15:34529483-34529505 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1126122737 15:45268116-45268138 CACTGTCCCTATCGTGCAGGAGG - Intronic
1127857821 15:62967219-62967241 CCCTGTCCCCAGGGAGGAGGTGG + Intergenic
1128347036 15:66860862-66860884 CACTGGCAGCCTGGGGAAGGAGG + Intergenic
1129153402 15:73703099-73703121 AAATGTCCCCTTGGGGGAGGGGG + Intronic
1131034255 15:89210829-89210851 CACTGGGGCCATGGGGAACGGGG - Intronic
1131272008 15:90953295-90953317 CACTGACCACTTGGGGAATGCGG - Exonic
1132851229 16:2025940-2025962 GACTGTCCTGTTGGGGAAGGAGG + Intronic
1132999234 16:2840848-2840870 CACGGTCCCAATGGCGAGGGGGG + Intergenic
1133587959 16:7213986-7214008 CACTGTCCTGATGGAGCAGGTGG + Intronic
1134124198 16:11605264-11605286 CTGTGTCCCCGTGGGGAATGTGG + Intronic
1134391873 16:13827428-13827450 CACTGTCTCCTTTGGGATGGTGG + Intergenic
1135980349 16:27142304-27142326 CACCGTCCTCATGGTGAATGTGG + Intergenic
1136031727 16:27507961-27507983 GACTGTCCCCATGTGGGAGTAGG + Intronic
1136427451 16:30178584-30178606 CACTTTCTCCATGGAGAAGGCGG + Intergenic
1138245444 16:55463663-55463685 CACTGTCCTCAGTGGGGAGGAGG + Intronic
1138431356 16:56971196-56971218 GACTGGCCACATGGAGAAGGTGG - Intronic
1138554990 16:57765755-57765777 CACAGCCCCCTAGGGGAAGGGGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139937572 16:70582484-70582506 CACTGCCCACATGTGGAAAGTGG - Intronic
1140857913 16:78993923-78993945 CACTGTTCCCACGGGGGAAGCGG - Intronic
1142150922 16:88512229-88512251 CCCTGCCCTCATGGGGAAGTGGG - Intronic
1142161912 16:88562054-88562076 CGCTGTTCCCGGGGGGAAGGGGG - Intergenic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143359049 17:6352472-6352494 CACTCTGTCCATGGGGCAGGTGG + Intergenic
1143673539 17:8413367-8413389 CTCTGTGCCCATGAGGCAGGCGG + Intronic
1144328437 17:14203944-14203966 CAGGGACCCCATGGAGAAGGTGG + Intronic
1144584853 17:16481948-16481970 CCAGGTCCCCATGGGGAAAGGGG + Intronic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145097373 17:20042343-20042365 CACTGTCACCATGGGGGAAGAGG + Intronic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145263942 17:21370582-21370604 CCCTGCCCCCATGAGGAAGGAGG + Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1146573007 17:33968874-33968896 CCCTGTCCCCTTGGGGAAGTTGG - Intronic
1148685924 17:49501219-49501241 CAGTGGCCACATGGGGGAGGGGG + Intronic
1150280038 17:63924578-63924600 CACTTTCCCCATGTGGCAGGAGG - Intergenic
1150428839 17:65100064-65100086 CACTCTCCCCAGGGGGTGGGCGG - Intergenic
1151523561 17:74648249-74648271 TACAGATCCCATGGGGAAGGAGG + Intergenic
1151538446 17:74751664-74751686 CTCTCTCCCCACGGGGCAGGCGG - Intronic
1151562835 17:74879779-74879801 CACTGTTCAGATGGGGAGGGAGG - Intronic
1151718396 17:75842979-75843001 CAGGGTCCCCCTGGGCAAGGAGG - Intronic
1152105205 17:78324661-78324683 CTCTGTCTCCATGGGGATGGAGG + Intergenic
1152177663 17:78798399-78798421 GACTGTGCCCCTGTGGAAGGAGG - Exonic
1152422021 17:80198620-80198642 CACTGTCCCCATGAGGAGCCCGG - Intronic
1153131808 18:1862151-1862173 AAATGTCCCTATGGGTAAGGTGG + Intergenic
1154107723 18:11537450-11537472 TACTGTCCCCATGGTAAAGATGG - Intergenic
1155067482 18:22280209-22280231 GACTCTCCCCACTGGGAAGGGGG - Intergenic
1156451040 18:37266652-37266674 CATTGTCCCCATGGGCATGAGGG - Intronic
1157557242 18:48620931-48620953 CCCTGTCCCCACTGGGAAGCAGG + Intronic
1158534051 18:58291779-58291801 CACTGTATCCATGGGGTGGGGGG - Intronic
1158911555 18:62068173-62068195 CACTTTCTCCATGGGGATGAAGG + Intronic
1160607108 18:80059407-80059429 CACTGTGCGCCTGGGGAAGCTGG - Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161613331 19:5256437-5256459 AACTGTCCCCAAGAGGATGGAGG + Intronic
1161983620 19:7642867-7642889 CCCTGCGCCCATGGGGAGGGGGG - Intronic
1162282136 19:9707598-9707620 CACTTTTCCCTTGGTGAAGGTGG - Intergenic
1162715802 19:12632412-12632434 TACTGGCCTCATGTGGAAGGTGG + Intronic
1163245639 19:16092309-16092331 GCCTGTCACCCTGGGGAAGGTGG + Intronic
1163563964 19:18038642-18038664 CAATGACCCCATGTGCAAGGGGG - Intergenic
1163678179 19:18665897-18665919 CATTGAGCCCATGGGGCAGGCGG - Intronic
1165015352 19:32876417-32876439 CACTTGCAGCATGGGGAAGGAGG + Intergenic
1166540730 19:43603816-43603838 CACTATCCCCATGGGAACTGGGG + Intronic
1166698080 19:44865610-44865632 GACGGACCCCTTGGGGAAGGTGG - Exonic
1166947520 19:46406083-46406105 CCATGTCCTCATGGGAAAGGGGG - Intergenic
1167148976 19:47698284-47698306 CACTGGCCCCAGGTGGCAGGAGG + Intronic
1167453935 19:49588619-49588641 CCCTGTCCCCAAGAGTAAGGGGG + Exonic
1168148184 19:54430932-54430954 CGCGGACCCCACGGGGAAGGCGG + Intronic
1168328245 19:55549757-55549779 CACTGTCCCCATCAGGAAATTGG - Intergenic
1168351989 19:55681120-55681142 TATTGTCCCCGTGGAGAAGGAGG + Intronic
925665377 2:6249360-6249382 TACTGTGCCCATGAGGAAGTGGG - Intergenic
925697995 2:6602746-6602768 CACTGACGCCATGATGAAGGAGG + Intergenic
928370012 2:30733840-30733862 TACTGTCCCAATGGGGAAAATGG - Intronic
929028705 2:37630152-37630174 CACTTTCACCATGGGGAGGTGGG - Intergenic
929572564 2:43031903-43031925 CACCCTCCCCATGGGGAGTGAGG - Intergenic
929572565 2:43031904-43031926 CTCACTCCCCATGGGGAGGGTGG + Intergenic
930244033 2:48965035-48965057 AACTTGCCCCTTGGGGAAGGAGG - Intronic
930596161 2:53390440-53390462 CATTGTTCCAACGGGGAAGGAGG - Intergenic
934674406 2:96239488-96239510 CACTGTCCCCAGAGGGGTGGTGG - Intergenic
935711821 2:105905839-105905861 CTCTATCCCCATGGGACAGGAGG - Intergenic
939051950 2:137317918-137317940 CCCTGTCTCTATGGGGGAGGGGG + Intronic
940346132 2:152630932-152630954 CACAGCCCCCATGGATAAGGGGG - Intronic
944069221 2:195651251-195651273 CACTGTCAGAATGGGGAAGTTGG - Intronic
944711396 2:202337916-202337938 GTCTGTCCCCAAGGGGAATGAGG + Intergenic
945042534 2:205754306-205754328 CACTGCCCCCACCGGGAAGAAGG - Intronic
946408691 2:219505988-219506010 CAACGTCTCCATCGGGAAGGGGG + Exonic
947623389 2:231604754-231604776 CACGGTCGCCATGGAGACGGCGG - Intergenic
947878815 2:233486804-233486826 CCATGTCCCCATGGGGGAGGGGG + Intronic
948143583 2:235692299-235692321 CACTGGCACCCTGGGGAAGATGG - Intronic
1171214111 20:23339962-23339984 CCCTGTCTTCATGGGGATGGGGG - Intergenic
1171349254 20:24490412-24490434 CACAGTCCTCATGGGAAAGGTGG + Intronic
1172604981 20:36208043-36208065 CACAACCCCCATGGAGAAGGTGG + Intronic
1174239785 20:49124282-49124304 CGCTGTCCCCAAGGTGAAAGGGG - Intronic
1175227268 20:57451882-57451904 CACTGTCCCCATGGGCTGTGCGG - Intergenic
1175517697 20:59579330-59579352 CACTTTCCCCAAGGAGAAAGCGG + Intronic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1178727313 21:35065349-35065371 GACTTTCCTCATGGGGATGGGGG + Intronic
1179048455 21:37868127-37868149 CACTGTCCCCATAGTGCTGGAGG - Intronic
1179546876 21:42118567-42118589 CCCTGTCCTAATGGGGAAGTTGG + Intronic
1180928571 22:19573482-19573504 CTGTGTCCCCATGGGGCAGAAGG + Intergenic
1181406322 22:22687345-22687367 CACAGTCCTCCTGGGGCAGGAGG - Intergenic
1182299656 22:29330473-29330495 CACTGTCGCCAAGAGGAACGTGG - Exonic
1183456400 22:37925514-37925536 GACTGTCCCCATGGGGATGGGGG + Intronic
1183506832 22:38214115-38214137 CATTGACCCGATGGGGAAGGAGG - Intronic
1183934435 22:41254225-41254247 CACTTTCACAATGGGGTAGGGGG - Intronic
1183999644 22:41663713-41663735 CACTGTGCCCATGCTGAAAGAGG + Exonic
1184881094 22:47304586-47304608 CACTCTCACCATGGGGCTGGAGG - Intergenic
1185182078 22:49369412-49369434 CACTGTCCCCATGGGTGGGAGGG + Intergenic
950497424 3:13342120-13342142 CTCTGTCCCCATGATGCAGGTGG - Exonic
950703263 3:14765072-14765094 CAATGTCCTCATGGACAAGGTGG + Intronic
951098182 3:18655903-18655925 CACTCGCCCCATGTGGCAGGTGG + Intergenic
952906108 3:38140011-38140033 TACTGTTCCCATGGGACAGGTGG + Intronic
955960886 3:64340278-64340300 CTCTGCCCCCTTGGGGAAGGGGG - Intronic
956262888 3:67364291-67364313 CACTGACCCCATGTAGGAGGTGG - Intronic
960939327 3:122923146-122923168 CCCTTTCTCCATGGGGATGGGGG + Intronic
961741056 3:129033354-129033376 CTCGGTCCCCATGGGGGTGGAGG - Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
962805421 3:138923618-138923640 CACTGCCCCCTTGTGGAGGGTGG + Intergenic
966916155 3:184585046-184585068 AACTGCCCCCATGGGGCAAGTGG - Intronic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
973700696 4:53534139-53534161 CAGTTACCCCATGGAGAAGGGGG + Intronic
973844949 4:54902148-54902170 AACTGTCCCTAGGGGGAATGGGG + Intergenic
974489592 4:62547825-62547847 TACTTTTCCCATGGGGCAGGTGG - Intergenic
976167643 4:82272290-82272312 CTCTGTCCCCAGGGAGATGGGGG - Intergenic
978252622 4:106650802-106650824 CTCTATCCCCATAGGGGAGGAGG - Intergenic
980840100 4:138248908-138248930 CTCTGCCCCCATGGGAAAAGTGG - Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
983961284 4:173757788-173757810 ATCTGTCCCCCTGGGGAATGGGG - Intergenic
985287814 4:188354740-188354762 CACTGTGCCCATTGGGGAGGGGG + Intergenic
985763705 5:1765370-1765392 CACTGATCCCATGGTGGAGGAGG + Intergenic
986443992 5:7805531-7805553 CACTGTCCTGAGGGGAAAGGAGG - Intronic
986539517 5:8828977-8828999 CATTCACCCCATGGGGAAGCTGG + Intergenic
986858303 5:11898056-11898078 CTCTGTCCCTGTGGGGAGGGAGG + Intronic
990616522 5:57514039-57514061 AATTTTCCCCATGGGTAAGGGGG - Intergenic
991917983 5:71624159-71624181 CACTAATCCCATGGGGAGGGGGG + Intronic
992069542 5:73136378-73136400 GCCTGTCCCCTTGGGGAGGGAGG - Intergenic
992736698 5:79728971-79728993 GACTGTCACCATGGAAAAGGAGG - Exonic
993307767 5:86291985-86292007 CCCTGTCCTCAGGGGGAGGGAGG + Intergenic
994979639 5:106857033-106857055 CACTGTGCACTGGGGGAAGGGGG - Intergenic
997614617 5:135237776-135237798 CTTTGTCCACATGGGGAAGTAGG + Intronic
1002060834 5:176625032-176625054 CCCTGCCTCCATGGGGATGGGGG - Intronic
1002397159 5:178966948-178966970 CACTGCCCCTATGGGGAGTGTGG + Intergenic
1003286020 6:4734497-4734519 CACTCTCCCCATCTGGAATGTGG - Intronic
1003548974 6:7085173-7085195 CACTGTCCACATGGGGACTTAGG + Intergenic
1003727819 6:8785872-8785894 CCCAGTCCCCCTGGGGGAGGAGG + Intergenic
1004239724 6:13909512-13909534 CATTGGCCCCATGGGGTTGGAGG + Intergenic
1004251556 6:14026867-14026889 CTCGATCCTCATGGGGAAGGGGG + Intergenic
1004407869 6:15351435-15351457 CACTGGCCTCATGGAGCAGGAGG + Intronic
1004703598 6:18102082-18102104 CATTCTCCCCATGAGGAAGATGG + Intergenic
1006361242 6:33588595-33588617 CACTGTGCTGAGGGGGAAGGAGG + Intergenic
1007630616 6:43271123-43271145 CTCTGTTCCCCTGGGGAATGCGG + Intronic
1011274063 6:85611507-85611529 CAGTATCCCTTTGGGGAAGGGGG + Intronic
1012592564 6:101000667-101000689 CACTTTCCACATGAGAAAGGAGG + Intergenic
1016130057 6:140456951-140456973 CACTGTCACCATGGGAAAGAGGG + Intergenic
1016780296 6:147950612-147950634 CACTGTGCCCATTAGGAAGGAGG - Intergenic
1018672983 6:166194913-166194935 CTCTGTCCCCATGATGTAGGTGG - Intergenic
1018907773 6:168085344-168085366 CACTGTGGCCATGTGGAGGGAGG - Intergenic
1018956729 6:168415449-168415471 CACTGTCCCCTTGGCTCAGGAGG - Intergenic
1019552282 7:1608999-1609021 CACTGTCCCCAGCAGCAAGGAGG - Intergenic
1020080803 7:5284728-5284750 CACTGTCCCCATGGTGGAGGGGG - Intronic
1022308594 7:29174066-29174088 CATAGTCTCCATGGGGAAGAGGG + Intronic
1025198113 7:56947439-56947461 TACTGTCCCCATGGTGGAGGGGG + Intergenic
1025673836 7:63629498-63629520 TACTGTCCCCATGGTGGAGGGGG - Intergenic
1025996289 7:66529566-66529588 GAATGTCCCCATGGGGATGAAGG + Intergenic
1026929930 7:74218111-74218133 CAGCGTCCCCATGTGGGAGGTGG + Intronic
1026988301 7:74568783-74568805 AAATGTCCCCATGGGGATGAAGG + Intronic
1028989250 7:97032536-97032558 CACTTTCTCCATGGGCATGGAGG + Intergenic
1028990521 7:97044422-97044444 TACTTTTCCCATGTGGAAGGTGG - Intergenic
1029127400 7:98304084-98304106 CTCTGTCCCCAGGGGGAGAGTGG - Intronic
1029536215 7:101159359-101159381 CCCTGACCCCATGGGGTGGGAGG + Intronic
1030359596 7:108580615-108580637 CACTGTCTCCATGGCCAAGTGGG + Intergenic
1031609011 7:123803134-123803156 CACAGACTCCATGGGCAAGGTGG + Intergenic
1033075556 7:138247041-138247063 CCCTTTCTCCAGGGGGAAGGAGG - Intergenic
1034554235 7:151839830-151839852 CACGGTGTCCCTGGGGAAGGCGG - Intronic
1035286516 7:157810492-157810514 CAGGGTCTCCATGGGGACGGCGG + Intronic
1035519524 8:266038-266060 CAGTGTCCCCCTGGGGAGGGGGG + Intergenic
1035838763 8:2787918-2787940 TAATGTCCCCATGGTGAAGCTGG + Intergenic
1036176226 8:6540958-6540980 TGCTGTCCCCAGGGGGCAGGTGG + Intronic
1036662701 8:10718093-10718115 CACAGTCCCCAGGGGAAAGAAGG + Intergenic
1039919951 8:41886515-41886537 CAGTGTACCCTTGGGCAAGGGGG - Intronic
1041683237 8:60614909-60614931 CACCGGCCACATGGGGAAGCAGG + Intronic
1041889680 8:62855363-62855385 CACTGTGCCCATGCTGAAAGAGG - Intronic
1044713307 8:95077323-95077345 CATATTCCCCATGGAGAAGGGGG - Intronic
1048326188 8:133441276-133441298 CACTGCCCACCTGGGGGAGGGGG + Intergenic
1049765900 8:144355085-144355107 CACAGTCCCCATGTGAAGGGTGG + Intronic
1050244858 9:3678073-3678095 GACTGTCCCCATGGCTAAGGTGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051359973 9:16273375-16273397 CACTGGCCCCCTTGGGAAGAAGG - Intronic
1052373182 9:27688987-27689009 CACTGTCCCCTTGGCAAACGCGG + Intergenic
1052865162 9:33460399-33460421 GATTATCCCCATGGGGGAGGGGG - Intergenic
1055071033 9:72165956-72165978 CTCTCTTCCCTTGGGGAAGGGGG - Intronic
1059337928 9:113580814-113580836 CACTTTCCCCAAGGGGTGGGCGG + Intronic
1059772243 9:117438134-117438156 TACTGTTGCCATGTGGAAGGCGG - Intergenic
1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG + Intronic
1060968331 9:127724000-127724022 CACTGCCTCCATGGGTCAGGAGG + Intronic
1061221579 9:129255124-129255146 CACTGTCTCCATGGGCAATGGGG - Intergenic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061329773 9:129885251-129885273 CACTGTCCCCGTCGGGGATGGGG - Intergenic
1061871799 9:133524833-133524855 CAGCGTCCCCATGGGCCAGGAGG + Exonic
1061893026 9:133632745-133632767 CACAGTCCCCTTGGGGAACTTGG - Intergenic
1062231559 9:135484822-135484844 CTTTGACCCCATGGGGGAGGAGG + Exonic
1062697128 9:137881152-137881174 CACTGTTCCCCTGGGGCAGATGG + Intronic
1062698856 9:137888870-137888892 GAGGGTCCCCATGGGCAAGGAGG + Intronic
1187213681 X:17254141-17254163 CACTGTTCCCAGGGGGATGAAGG - Intergenic
1187953861 X:24496701-24496723 CACTGTGACCAAGGGGATGGTGG - Intronic
1189659277 X:43279440-43279462 CACAGTGCCCATGGAGGAGGAGG + Intergenic
1190285920 X:48961431-48961453 CACTGTCCCCATGGAGCTGGTGG - Exonic
1190317053 X:49157743-49157765 CACTGTCCCTATTGGGAAACTGG + Intergenic
1190480500 X:50872128-50872150 CATTCTCCCCATGTGGAAGCTGG - Intergenic
1190753215 X:53380174-53380196 CACAGTCCCCTTGCTGAAGGAGG + Exonic
1194621849 X:96182558-96182580 CAGTGTCCCCATGTGGCAGAAGG + Intergenic
1196581689 X:117386797-117386819 CACTTTTCCCATGGAGAAGTGGG - Intergenic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1199681942 X:150231151-150231173 CACTGTGCCCATGTTGAAAGAGG - Intergenic