ID: 1143204216

View in Genome Browser
Species Human (GRCh38)
Location 17:5131559-5131581
Sequence CAGTGTCCCCATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 7, 2: 3, 3: 36, 4: 407}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143204204_1143204216 3 Left 1143204204 17:5131533-5131555 CCCCATGTCCTTATATCTACAGC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204198_1143204216 21 Left 1143204198 17:5131515-5131537 CCACCTACCCCTGTTCTCCCCCA 0: 1
1: 13
2: 9
3: 49
4: 674
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204203_1143204216 4 Left 1143204203 17:5131532-5131554 CCCCCATGTCCTTATATCTACAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204200_1143204216 14 Left 1143204200 17:5131522-5131544 CCCCTGTTCTCCCCCATGTCCTT 0: 1
1: 0
2: 3
3: 53
4: 481
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204201_1143204216 13 Left 1143204201 17:5131523-5131545 CCCTGTTCTCCCCCATGTCCTTA 0: 1
1: 0
2: 2
3: 53
4: 286
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204207_1143204216 -5 Left 1143204207 17:5131541-5131563 CCTTATATCTACAGCCCTCAGTG 0: 1
1: 0
2: 0
3: 38
4: 115
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204202_1143204216 12 Left 1143204202 17:5131524-5131546 CCTGTTCTCCCCCATGTCCTTAT 0: 1
1: 0
2: 2
3: 27
4: 309
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204197_1143204216 22 Left 1143204197 17:5131514-5131536 CCCACCTACCCCTGTTCTCCCCC 0: 1
1: 13
2: 7
3: 39
4: 523
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204199_1143204216 18 Left 1143204199 17:5131518-5131540 CCTACCCCTGTTCTCCCCCATGT 0: 1
1: 0
2: 5
3: 48
4: 359
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204205_1143204216 2 Left 1143204205 17:5131534-5131556 CCCATGTCCTTATATCTACAGCC 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407
1143204206_1143204216 1 Left 1143204206 17:5131535-5131557 CCATGTCCTTATATCTACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG 0: 1
1: 7
2: 3
3: 36
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143204216 Original CRISPR CAGTGTCCCCATGGGGAAGG GGG Intronic
900208364 1:1441117-1441139 CAGAGTCCACGTGGGGAAAGGGG - Exonic
902340737 1:15782108-15782130 CAGTTTCCCCATGTGAAATGGGG - Intronic
902398857 1:16146588-16146610 CAGGGGCCGCCTGGGGAAGGGGG + Intronic
902708470 1:18222577-18222599 CAGTTTCCCCATGTGTAATGTGG - Intronic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903779339 1:25811346-25811368 CAGTGTCCTCATCTGGAAAGTGG + Intronic
904407510 1:30302650-30302672 CTGTGTCCTCATAGGGGAGGGGG - Intergenic
904726170 1:32549988-32550010 CAGTTTCCCCATGTGAAATGTGG - Intronic
907566291 1:55437362-55437384 CAGTGGTTCCATGGGGTAGGAGG + Intergenic
908166651 1:61465508-61465530 CAGTTTCCCCATTGGTAAGATGG + Intergenic
908794421 1:67816906-67816928 CAGTGTCCCCATCTGTAAAGTGG + Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
913094269 1:115501827-115501849 TAGTGTCCACATGGGAAAGAAGG + Intergenic
913186345 1:116373502-116373524 CACCGCCACCATGGGGAAGGGGG + Intronic
913446518 1:118956048-118956070 CTGTGTCCCCATGTGGTAGAAGG - Intronic
914195876 1:145447952-145447974 GAGGGTCCCCATGGGCAAGGAGG - Intergenic
914395803 1:147266996-147267018 CATATTCCCCATGGGTAAGGGGG + Intronic
916001414 1:160619939-160619961 CATTGTGCCCTTGGGGAAAGTGG - Intronic
917070203 1:171142137-171142159 TTGTGTCCCCGTGGGGAAGTGGG - Intronic
917670745 1:177270996-177271018 CTGTGTCCACATGTGGAGGGAGG + Intronic
920744211 1:208610765-208610787 CTGTGTCCTCATGTGGAAGAAGG + Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921286897 1:213616976-213616998 CAGTGTCCTCATTGGTAAGAAGG + Intergenic
921508479 1:216003468-216003490 CAGAGGCCTCATTGGGAAGGTGG + Intronic
922184789 1:223264739-223264761 CACAGTCCCCACCGGGAAGGAGG + Exonic
922616074 1:226961895-226961917 CTGTGTCCTCATGGGGCAGGAGG + Intronic
923847207 1:237748293-237748315 CAGTGCCTCCCCGGGGAAGGAGG + Intronic
923993343 1:239464454-239464476 CAATGTCCCCATGGAAATGGAGG - Intronic
1062803310 10:395963-395985 CAGGGTCCACATGGGGATGAGGG - Intronic
1065701032 10:28425621-28425643 CATTGTCCCCAGGGGAAGGGTGG - Intergenic
1066364467 10:34763434-34763456 CTGTGTCCTCTGGGGGAAGGTGG + Intronic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067688197 10:48480553-48480575 CTGTGTTCCCATGGGGTGGGTGG + Intronic
1068180503 10:53512450-53512472 AAGTGTCCCCATGGGCAATTCGG + Intergenic
1068791043 10:61031594-61031616 CATTGGCCCCATGAGGAAGCTGG - Intergenic
1070112744 10:73500563-73500585 CAGTATACCTATGGGGAGGGGGG - Intronic
1070244941 10:74721916-74721938 AGGTGTCCCCATGGTGAGGGAGG - Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1070882804 10:79864197-79864219 AAGTGTCCCCAAGGGGAGCGTGG - Intergenic
1071524053 10:86347963-86347985 CACTGGGACCATGGGGAAGGTGG - Intronic
1071649369 10:87380499-87380521 AAGTGTCCCCAAGGGGAGCGTGG - Intergenic
1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG + Intronic
1073213869 10:101826058-101826080 CAGTCTTCTGATGGGGAAGGGGG + Intronic
1073543962 10:104333823-104333845 CAGTGACCTGATGGGGAAGTTGG + Exonic
1074358594 10:112807151-112807173 CAGTGCAGCCATGGGGAAGAAGG + Intronic
1075024228 10:118972163-118972185 CAGTCTCCCGCTGGGGCAGGAGG - Intergenic
1075058466 10:119237759-119237781 CAGTGTTCCCATGGGGAGTGGGG - Intronic
1075102518 10:119516400-119516422 CTGTGTCCTCATGGGGAAAGTGG - Intronic
1075222541 10:120597700-120597722 CAGTGTCCTCATGTGTAAGATGG + Intergenic
1076438390 10:130462290-130462312 CACGGGACCCATGGGGAAGGGGG + Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076541700 10:131219199-131219221 GAGGGGCCCCATGGGGAAGTTGG - Intronic
1077192424 11:1260982-1261004 AGGTGTCCCCCTGGGGAGGGTGG + Intronic
1077718326 11:4603041-4603063 CAGTTTCTCCATGGGGATGTAGG - Intronic
1080381975 11:31781393-31781415 CAGTGTCCACGTGAGGAAGCAGG - Intronic
1080388656 11:31825165-31825187 TAGTGTCCCCTTGGGGAAGGGGG - Intronic
1081663946 11:44905605-44905627 CAGTTTCCCCTGGGGGATGGGGG + Intronic
1081679245 11:44990174-44990196 CAGCGATCCCATGGGGAAGGCGG + Intergenic
1081861343 11:46334784-46334806 GAATGTCCCCCTGGGGCAGGAGG + Intronic
1083277264 11:61603835-61603857 CATGGGCCCAATGGGGAAGGAGG - Intergenic
1083621465 11:64051433-64051455 CAGTGCCACCCTGGGGAGGGTGG - Intronic
1083962186 11:66020727-66020749 CAGTGACCCCATCGGCAAAGTGG - Intronic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084296379 11:68215200-68215222 CAGTTTCCCTCTGTGGAAGGCGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084412787 11:69013907-69013929 CAGGGGCTCAATGGGGAAGGGGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084748891 11:71190821-71190843 CACTTTCCCCATCTGGAAGGTGG + Intronic
1085055108 11:73398773-73398795 CAGCCTTCCCCTGGGGAAGGAGG - Intergenic
1085530182 11:77187822-77187844 CAGTTTCCCCATCAGGAAAGTGG - Intronic
1086596302 11:88575518-88575540 CAATGTCTGCATGGGCAAGGTGG + Intronic
1086953034 11:92909994-92910016 CAGTGTCCCCATGAGATATGTGG + Intergenic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1089640259 11:119843250-119843272 CAGTGTCCCCCTGGCTGAGGGGG - Intergenic
1089730250 11:120514683-120514705 CAGTGCCCACTTGGGGTAGGGGG - Intronic
1090265528 11:125350902-125350924 CAGGGTCCTCCTGGGGAAGGAGG + Intronic
1091395716 12:153252-153274 CTGTGTCATCCTGGGGAAGGTGG - Intronic
1094176896 12:27550191-27550213 CAGTGGCCCCATGGGGGAGCTGG + Intronic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1098184854 12:67885421-67885443 AAGCGTCCACATAGGGAAGGAGG - Intergenic
1100870881 12:98908745-98908767 CATTGTTCCCAAGAGGAAGGTGG + Intronic
1100981629 12:100166852-100166874 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1101300309 12:103472826-103472848 CCCTGTACCCATGGGGAAGACGG + Intronic
1101814647 12:108136620-108136642 CAGTGTCCACATGGGTCAAGTGG - Intronic
1101818179 12:108162006-108162028 CAGTGTCCCCATCTGTAAAGTGG - Intronic
1102137984 12:110591268-110591290 CAGGCTCCTCATGGTGAAGGAGG - Intergenic
1102488248 12:113272768-113272790 CTGTGGCCATATGGGGAAGGGGG + Intronic
1102511782 12:113420986-113421008 CAGTTTCCCTATGTGGAAAGTGG - Intronic
1102785862 12:115604364-115604386 CAGTCTCCTCATGGAGCAGGTGG - Intergenic
1103024610 12:117563465-117563487 CAGTTTCCCCATCTGTAAGGTGG + Intronic
1103145891 12:118595560-118595582 CAGTTTCCCCATGTGTAAGATGG + Intergenic
1103912453 12:124359963-124359985 CACCGTCCCCACGGGGAATGAGG + Intronic
1103942500 12:124508648-124508670 CAGGGTCCACGTGGGGCAGGGGG + Intronic
1104736947 12:131140847-131140869 CACTGTCACCATGTGGCAGGTGG - Exonic
1106130243 13:26933705-26933727 CTGTGTCCTCATGGGGTGGGAGG - Intergenic
1106363437 13:29053438-29053460 CAGTGTCCCCTTGGGCAAATAGG + Intronic
1107044914 13:35983963-35983985 CAGTTTCCCCATAGTCAAGGAGG - Intronic
1107114842 13:36735364-36735386 CAGGGTCTCCATGGGAAGGGAGG + Intergenic
1107188253 13:37548979-37549001 CACAGTCCCCATGGCTAAGGAGG - Intergenic
1108177997 13:47813592-47813614 CAGTTTCCCCATCTGTAAGGGGG - Intergenic
1108231281 13:48344588-48344610 AAGTGTCCACACGGGGGAGGGGG + Intronic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1110006753 13:70281925-70281947 CATTGTCCCCATGGGGCATGAGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1112398489 13:99055332-99055354 CTGTGTCCCCATGCGGTAGCAGG + Intronic
1117648932 14:57882180-57882202 TAGTTTCTCCAGGGGGAAGGGGG - Intronic
1118326880 14:64787157-64787179 CTGTGTCCCCATCCGGCAGGTGG - Exonic
1119118255 14:72047396-72047418 CAGTGTCCTCACGGGAAAAGGGG - Intronic
1119182990 14:72616911-72616933 CAGTTTCCCCATCTGGAAAGCGG - Intergenic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1121607537 14:95252293-95252315 CACTGTCCCCATACGGAAAGTGG + Intronic
1121719429 14:96098821-96098843 CAGTGCCACCATGTGGGAGGAGG - Intergenic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1123472988 15:20568609-20568631 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1123645018 15:22431744-22431766 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123666309 15:22611520-22611542 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123733289 15:23163600-23163622 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123751423 15:23360975-23360997 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124052213 15:26207961-26207983 AAGTGAGCCCATAGGGAAGGAGG + Intergenic
1124283793 15:28384893-28384915 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124298904 15:28526720-28526742 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124320130 15:28705926-28705948 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124371463 15:29106911-29106933 CAGTTTCCCCATGGGTGAAGTGG - Intronic
1124406887 15:29400992-29401014 CAGTGGCCACCTGGGCAAGGAGG - Intronic
1124482382 15:30089491-30089513 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124521195 15:30407718-30407740 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124537465 15:30558502-30558524 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124754690 15:32396730-32396752 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124761191 15:32449085-32449107 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124777443 15:32599978-32600000 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124959372 15:34383262-34383284 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1124975998 15:34529483-34529505 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1126536121 15:49767364-49767386 CTGTCTCTCCATGGGAAAGGGGG + Intergenic
1129119654 15:73388339-73388361 CAGGCTTCCCATGGGGCAGGTGG - Intergenic
1129153402 15:73703099-73703121 AAATGTCCCCTTGGGGGAGGGGG + Intronic
1129323476 15:74787446-74787468 CAGTTTCCCCATGGGAAAAATGG - Intronic
1129333393 15:74838981-74839003 GAGAGTCCCCATGAGGAAGTGGG - Intronic
1129734181 15:77950735-77950757 CAGTGGTCCCTTTGGGAAGGTGG - Intergenic
1129841402 15:78745256-78745278 CAGTGGTCCCTTTGGGAAGGTGG + Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129928092 15:79384061-79384083 CAGTGTTCCTATGGAGATGGTGG + Intronic
1130255710 15:82325181-82325203 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130255930 15:82326063-82326085 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130259716 15:82345627-82345649 CAGTGTCCCCATCAGTAAAGAGG - Intronic
1130269003 15:82433809-82433831 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130281517 15:82523382-82523404 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130472890 15:84239565-84239587 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130480381 15:84354136-84354158 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130491388 15:84433993-84434015 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130503004 15:84513033-84513055 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130595183 15:85244199-85244221 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130599252 15:85264805-85264827 CAGTTTCCCTGAGGGGAAGGTGG - Intergenic
1131282807 15:91034504-91034526 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1132100535 15:99020039-99020061 CAGTGTGGCCATGGGGTTGGTGG + Intergenic
1132433015 15:101775713-101775735 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1132644034 16:990687-990709 CCGTAGGCCCATGGGGAAGGCGG - Intergenic
1132871373 16:2117143-2117165 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1132925414 16:2426812-2426834 CAGTCTACCCATGTGGGAGGTGG - Intergenic
1133302011 16:4788101-4788123 GTGTGTCCCCCTGGGGAAAGTGG - Intronic
1133728301 16:8557265-8557287 TAGTGCTCCCATGGGCAAGGTGG - Intergenic
1133832829 16:9339954-9339976 CAGTGTCCTCATTTGGAAAGTGG + Intergenic
1134124198 16:11605264-11605286 CTGTGTCCCCGTGGGGAATGTGG + Intronic
1134521154 16:14919751-14919773 CAGTTTCCCCATCTGGAAAGGGG + Intronic
1134550417 16:15136221-15136243 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1134708830 16:16318402-16318424 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134716041 16:16358436-16358458 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1134950775 16:18350243-18350265 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134958715 16:18393723-18393745 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1135621503 16:23959867-23959889 CAGTGTCCCCATCTGCAAAGTGG - Intronic
1135998073 16:27268522-27268544 CAGTTTCCCCATCAAGAAGGGGG + Intronic
1136427451 16:30178584-30178606 CACTTTCTCCATGGAGAAGGCGG + Intergenic
1137710092 16:50560480-50560502 CAGTTTCCCTATGGGTAAGATGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138619369 16:58198605-58198627 CAGGGTCCAGAGGGGGAAGGAGG - Intergenic
1140469557 16:75206543-75206565 CAGTGTCCCCATCAGCAAAGTGG + Intronic
1141010402 16:80391664-80391686 CAGTGTCCTCATCTGTAAGGTGG + Intergenic
1141134212 16:81455348-81455370 CAGTGTCCCCATCGGTAAAATGG - Intronic
1141315744 16:82961169-82961191 CAGTGTCCTTGTCGGGAAGGTGG - Intronic
1141668700 16:85480264-85480286 CAGTGTTTCGATGGGGATGGAGG + Intergenic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143214822 17:5216951-5216973 CAGTGTACCTAGGGGGATGGAGG - Intronic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1143755106 17:9061326-9061348 CAGTGGCCCAAAGGGTAAGGGGG + Intronic
1144328437 17:14203944-14203966 CAGGGACCCCATGGAGAAGGTGG + Intronic
1144584853 17:16481948-16481970 CCAGGTCCCCATGGGGAAAGGGG + Intronic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145097373 17:20042343-20042365 CACTGTCACCATGGGGGAAGAGG + Intronic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145263942 17:21370582-21370604 CCCTGCCCCCATGAGGAAGGAGG + Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1146573007 17:33968874-33968896 CCCTGTCCCCTTGGGGAAGTTGG - Intronic
1146936092 17:36813506-36813528 CTGTCTCCCCCTGGGGATGGGGG + Intergenic
1148654750 17:49274919-49274941 CGGTGGCCACATGGGGAAGTGGG - Intergenic
1148685924 17:49501219-49501241 CAGTGGCCACATGGGGGAGGGGG + Intronic
1148853799 17:50567631-50567653 CAGAGACCCCCTGGGGAATGGGG - Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1150280038 17:63924578-63924600 CACTTTCCCCATGTGGCAGGAGG - Intergenic
1151718396 17:75842979-75843001 CAGGGTCCCCCTGGGCAAGGAGG - Intronic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1152105205 17:78324661-78324683 CTCTGTCTCCATGGGGATGGAGG + Intergenic
1152185034 17:78850559-78850581 CAGTGTGCACATGGGCCAGGGGG + Intergenic
1152805516 17:82354025-82354047 GAGTGGTCCCATGGGGAAAGGGG - Intergenic
1153131808 18:1862151-1862173 AAATGTCCCTATGGGTAAGGTGG + Intergenic
1156451040 18:37266652-37266674 CATTGTCCCCATGGGCATGAGGG - Intronic
1157504936 18:48219468-48219490 CAGTGTCCCCACCTGGAATGTGG - Intronic
1157804187 18:50645863-50645885 CAGTTTTCCCATGTGTAAGGTGG + Intronic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158278536 18:55795143-55795165 AAGTTTCCCCATGGGGTATGGGG + Intergenic
1159886671 18:73914245-73914267 CAGGCTCCCCATGGGGAGGCAGG - Intergenic
1160519579 18:79496866-79496888 CAGTTTCCCCCCGGGAAAGGGGG - Intronic
1160738845 19:676807-676829 CAGTTTCCCCATCTGGAAGACGG - Intronic
1160773993 19:846484-846506 CAGTCTCCCCACCTGGAAGGTGG + Intronic
1160857944 19:1225856-1225878 CAGTGTCCACCTGGGCAGGGTGG + Intronic
1160911006 19:1473794-1473816 CAGTGTCCCAGGGTGGAAGGTGG - Exonic
1161143873 19:2665351-2665373 CAGTGTCCCCTGGGGGGGGGGGG + Intronic
1161287116 19:3474357-3474379 CAGTTTACCTCTGGGGAAGGAGG - Exonic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161389151 19:4012133-4012155 CAGTGTCCACAGGGCCAAGGAGG + Intronic
1161838241 19:6662395-6662417 CAGTTTCCCCATCGGCAAGATGG - Intronic
1163442175 19:17327797-17327819 CAGCGCCGCCAGGGGGAAGGCGG + Exonic
1163563964 19:18038642-18038664 CAATGACCCCATGTGCAAGGGGG - Intergenic
1163664273 19:18595698-18595720 CCGTTTCCCCATCTGGAAGGTGG - Intronic
1163665550 19:18602277-18602299 CAGTTTCCCCATCTGGAAAGTGG + Intronic
1163678179 19:18665897-18665919 CATTGAGCCCATGGGGCAGGCGG - Intronic
1163785865 19:19274671-19274693 CAGTGGACACCTGGGGAAGGAGG - Intergenic
1164475463 19:28572535-28572557 CAGTTTCACCATGGGGAAAATGG + Intergenic
1165060720 19:33204094-33204116 CAGTTTCCCCAAGGGCCAGGTGG + Intronic
1165805171 19:38576093-38576115 CAGTTTCCCCATGGGGAGATGGG + Intronic
1165927440 19:39335739-39335761 AAGAGTCCCCGTGGAGAAGGCGG - Intronic
1166125024 19:40709956-40709978 CAGTTTCCTCATGCGGAAGATGG - Intronic
1166281570 19:41797653-41797675 CAGTGTCGCAGAGGGGAAGGAGG + Exonic
1166325936 19:42051253-42051275 GAGAGGCCCCATGGGGAAGCTGG - Intronic
1166947520 19:46406083-46406105 CCATGTCCTCATGGGAAAGGGGG - Intergenic
1167466628 19:49653708-49653730 GAGTGTCCCCTGGGGGAGGGTGG + Intronic
1168351989 19:55681120-55681142 TATTGTCCCCGTGGAGAAGGAGG + Intronic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
925306653 2:2851536-2851558 CAGTGTCCCGGAGGGGAGGGAGG - Intergenic
925912545 2:8583094-8583116 CAGCCTCCCCAGGTGGAAGGAGG + Intergenic
925920311 2:8633542-8633564 CAGTTTCCCCATTGGAAAAGAGG + Intergenic
926143775 2:10384514-10384536 CTGTAGCCCCATGGGGGAGGGGG - Intronic
927476400 2:23417538-23417560 CAGTGTCTCCATCAGGAAAGTGG - Intronic
928435520 2:31252157-31252179 CAGTGTCCCCATGTGTAACAAGG + Intronic
930596161 2:53390440-53390462 CATTGTTCCAACGGGGAAGGAGG - Intergenic
932310247 2:70734058-70734080 CAGTGTCCCCGGGGAGAGGGGGG - Intronic
932780324 2:74555082-74555104 CCGGGTCCCGACGGGGAAGGAGG - Intronic
935571300 2:104662923-104662945 CAGTTTCCCCATGGGCAAAATGG + Intergenic
937305583 2:120868567-120868589 AAGTGTCCCCAGGAGGGAGGGGG - Intronic
937909083 2:127066671-127066693 CAGGGTGCCCATGGGGAACCAGG - Intronic
940740348 2:157500436-157500458 CTGTGGCCCAATGGGGAAGAGGG + Intergenic
944121097 2:196241598-196241620 CAGTTTCCCCATTTGAAAGGAGG + Intronic
944851050 2:203719645-203719667 CAGTTTCCCCATGTGTAAGATGG + Intronic
945451028 2:209995457-209995479 CAGTGTCTCCATGCTGTAGGAGG - Exonic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
946386254 2:219386205-219386227 CAGGGTACCCGTGGGGAAGAGGG - Intronic
946408691 2:219505988-219506010 CAACGTCTCCATCGGGAAGGGGG + Exonic
946606930 2:221415622-221415644 CAGTCTCCCTAGGAGGAAGGAGG - Intergenic
947878815 2:233486804-233486826 CCATGTCCCCATGGGGGAGGGGG + Intronic
948469315 2:238167131-238167153 CAGTGGCCACATGGAGGAGGAGG + Intronic
948512789 2:238481748-238481770 CAGTGTCCCCATCTGTAAAGTGG - Intergenic
948754307 2:240150248-240150270 CTGTCTCCCCTGGGGGAAGGAGG + Intergenic
1169660401 20:7972638-7972660 AAGTCTCCAAATGGGGAAGGGGG + Intergenic
1170508898 20:17057052-17057074 CAGTGTCCCCCTGTGTAAGATGG - Intergenic
1170571042 20:17632831-17632853 CCGTGTCCCCCTGGGGACAGGGG + Intronic
1170816752 20:19720615-19720637 CAGTGTCCCCAGGGGAGTGGGGG + Intronic
1171349254 20:24490412-24490434 CACAGTCCTCATGGGAAAGGTGG + Intronic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1172836027 20:37873730-37873752 CAGAGTCCCCATGAGTGAGGAGG + Intergenic
1173454815 20:43193299-43193321 CAGTGTCCTCATGTGTAAGATGG - Intergenic
1174277590 20:49414955-49414977 CAGTCTCCCCATGAGTAAGATGG + Intronic
1174551986 20:51368790-51368812 CAGTGTTGCCATGGGGCGGGTGG + Intergenic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1176668282 21:9707718-9707740 CAGTGTCTCCGTGGGCACGGTGG - Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1179187657 21:39097113-39097135 CAGGGCCTCCACGGGGAAGGTGG - Intergenic
1180131549 21:45830081-45830103 CTGTGGCCCCAAGGGGATGGAGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180928571 22:19573482-19573504 CTGTGTCCCCATGGGGCAGAAGG + Intergenic
1182062183 22:27406185-27406207 CAGTTTCCCCACCTGGAAGGAGG - Intergenic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183456400 22:37925514-37925536 GACTGTCCCCATGGGGATGGGGG + Intronic
1183506832 22:38214115-38214137 CATTGACCCGATGGGGAAGGAGG - Intronic
1183630833 22:39031681-39031703 CAGGATCCACCTGGGGAAGGAGG - Exonic
1183634349 22:39052061-39052083 CAGGATCCACCTGGGGAAGGAGG - Exonic
1184277545 22:43418751-43418773 CAGTGTCCAGATGGGGGTGGTGG + Intronic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
950184261 3:10935295-10935317 CAGCGTCCCCTTGAGGCAGGTGG - Intronic
950570737 3:13798510-13798532 GGGGGTCCCCATGGGCAAGGTGG + Intergenic
950664090 3:14484416-14484438 GAGTTTCTCCTTGGGGAAGGTGG + Intronic
950703263 3:14765072-14765094 CAATGTCCTCATGGACAAGGTGG + Intronic
950893280 3:16424100-16424122 CAGTGTAGCCATGGGGACTGGGG + Intronic
950964623 3:17137720-17137742 CTGAGTCACCATGGGGCAGGAGG - Intergenic
951533961 3:23724913-23724935 CTGCGTCCTCATGGGGAAGAAGG + Intergenic
952324922 3:32312526-32312548 CTGTGTCCCCATGGAGTTGGGGG + Intronic
953852593 3:46477561-46477583 CAGTGTCCCCATGTGAAAATAGG + Intronic
953879894 3:46686189-46686211 CAGTTTCCCTATATGGAAGGGGG - Intronic
954812203 3:53255383-53255405 CCGTTTCCCCATCTGGAAGGGGG + Intronic
955393069 3:58535291-58535313 CAGTGTCCACAGGGGGAGTGGGG - Intronic
955960886 3:64340278-64340300 CTCTGCCCCCTTGGGGAAGGGGG - Intronic
956493369 3:69798118-69798140 CAGTCTCCCCATGTGTAAAGTGG + Intronic
956770972 3:72525724-72525746 CAGTTTCCCCATTGGTAAAGAGG + Intergenic
957012206 3:75020125-75020147 CAGTGTTGCCCTGGGGAAGATGG + Intergenic
957616433 3:82533637-82533659 GTGTATCCACATGGGGAAGGAGG + Intergenic
958098502 3:88978528-88978550 CAGTTTCCCCATGAGTAATGGGG + Intergenic
960374335 3:116879787-116879809 TAGTGTCTCCTTGGGGAAGAAGG - Intronic
960811518 3:121631680-121631702 CAGAGACAGCATGGGGAAGGAGG - Exonic
960954095 3:123019273-123019295 CAGTTTCCTCATGAGGAAAGTGG + Intronic
961828632 3:129611976-129611998 CTGTGTCCCCGTGGGGCTGGAGG + Intergenic
966641526 3:182196401-182196423 CAGTGTCCCCATTTGTAAAGTGG - Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
969499972 4:7546662-7546684 CAGCGTCCCCATGAGGAGGCAGG - Intronic
969709266 4:8833330-8833352 CAGTGTACCCATCTGTAAGGTGG - Intergenic
971603263 4:28623465-28623487 CAGTGTACCAATGGTGATGGTGG - Intergenic
972638680 4:40906551-40906573 CAGAGTCCCAATGAGGAGGGAGG + Intronic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
973700696 4:53534139-53534161 CAGTTACCCCATGGAGAAGGGGG + Intronic
975245184 4:72112271-72112293 CAGTATCCACATTTGGAAGGTGG - Intronic
975811511 4:78175104-78175126 CAGTGTCCGGATGGGGCCGGTGG - Intronic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
985287814 4:188354740-188354762 CACTGTGCCCATTGGGGAGGGGG + Intergenic
985406499 4:189643773-189643795 CAGTGTCTCCGTGGGCACGGTGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
985708427 5:1414700-1414722 CAGTGTGCCCATCGGGGACGTGG - Exonic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
986539517 5:8828977-8828999 CATTCACCCCATGGGGAAGCTGG + Intergenic
987348589 5:17000694-17000716 CAGTATCCAGATGGGGCAGGAGG + Intergenic
988468613 5:31514987-31515009 CAGTGACCCCATGGATCAGGTGG - Exonic
990616522 5:57514039-57514061 AATTTTCCCCATGGGTAAGGGGG - Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991095911 5:62739536-62739558 CAGTCTAGCAATGGGGAAGGTGG + Intergenic
992723186 5:79580647-79580669 CAGTGTCCCCAGGCAGAAAGGGG - Intergenic
995443960 5:112222433-112222455 CAGTATCCCCATGAGAAAGATGG - Intronic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996305065 5:122037244-122037266 CAGTTTCCCCATTGGGTTGGGGG - Intronic
996591022 5:125147816-125147838 CAGCATCCACATGGGCAAGGTGG + Intergenic
997476841 5:134147493-134147515 CAGTTTCCCCATGGGGCTGCGGG + Exonic
997614617 5:135237776-135237798 CTTTGTCCACATGGGGAAGTAGG + Intronic
998315244 5:141177348-141177370 CAGTTTCCTCATGTGTAAGGTGG + Intergenic
998401902 5:141852705-141852727 CAGGGGTCCCATGGGGGAGGGGG - Intergenic
999040244 5:148401602-148401624 GAGAGTACCCATGGGGGAGGAGG + Intronic
1002005510 5:176230619-176230641 CAGTTTACTCATGGGGCAGGTGG - Intergenic
1003019220 6:2495789-2495811 CTGTGTCCTCATGTGGATGGCGG + Intergenic
1004086541 6:12454973-12454995 CTGTGTCCTCATGGTGAAAGGGG - Intergenic
1004239724 6:13909512-13909534 CATTGGCCCCATGGGGTTGGAGG + Intergenic
1004504644 6:16238375-16238397 CAGTGACCGAATGGGGACGGGGG - Intergenic
1004703598 6:18102082-18102104 CATTCTCCCCATGAGGAAGATGG + Intergenic
1005912084 6:30319326-30319348 CAGAGTTCCCATGAGTAAGGAGG + Intergenic
1006300766 6:33192573-33192595 CAGTCTCCACCTGGGGAGGGAGG + Intergenic
1008914074 6:56767786-56767808 GAGAGTCCCCATTGAGAAGGGGG + Intronic
1009798406 6:68502318-68502340 CAGTTTCCCCATTGGGCGGGGGG - Intergenic
1010369428 6:75090109-75090131 CAGGGACCCCCTGGGGAACGAGG - Exonic
1010524503 6:76884203-76884225 CAGAGTCCACATGGGGAGGATGG + Intergenic
1010933802 6:81835950-81835972 CAGTGTCATCATGGGAAGGGAGG + Intergenic
1011274063 6:85611507-85611529 CAGTATCCCTTTGGGGAAGGGGG + Intronic
1012936708 6:105375690-105375712 CAGTTTCCCTCTTGGGAAGGAGG - Intronic
1012961860 6:105630543-105630565 TAGTGTCCCAAAGGAGAAGGAGG - Intergenic
1014756400 6:125305962-125305984 CAGTTTCCCCATCTGGAATGTGG - Intergenic
1016130057 6:140456951-140456973 CACTGTCACCATGGGAAAGAGGG + Intergenic
1016780296 6:147950612-147950634 CACTGTGCCCATTAGGAAGGAGG - Intergenic
1017076338 6:150622433-150622455 AAGAGTACCCATGGGGAATGGGG - Intronic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1018267348 6:162039524-162039546 CAGAGGTCCCATGGGGAAAGGGG - Intronic
1018714915 6:166524782-166524804 CAGTGTCCCCCTGCTGAAAGTGG - Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1020080803 7:5284728-5284750 CACTGTCCCCATGGTGGAGGGGG - Intronic
1022308594 7:29174066-29174088 CATAGTCTCCATGGGGAAGAGGG + Intronic
1023553100 7:41389692-41389714 CAGTTTCCCCATCTGGAAAGTGG - Intergenic
1023688669 7:42763636-42763658 CAGAGACCCCATGGAAAAGGAGG + Intergenic
1024997067 7:55280041-55280063 AGGGGTGCCCATGGGGAAGGCGG + Intergenic
1025198113 7:56947439-56947461 TACTGTCCCCATGGTGGAGGGGG + Intergenic
1025234900 7:57227894-57227916 CAGTGTCCCCATGGGAGCAGGGG + Intergenic
1025673836 7:63629498-63629520 TACTGTCCCCATGGTGGAGGGGG - Intergenic
1025996289 7:66529566-66529588 GAATGTCCCCATGGGGATGAAGG + Intergenic
1026929930 7:74218111-74218133 CAGCGTCCCCATGTGGGAGGTGG + Intronic
1026988301 7:74568783-74568805 AAATGTCCCCATGGGGATGAAGG + Intronic
1029114997 7:98232212-98232234 CTGTCTCCCCATGCAGAAGGCGG - Intronic
1029539914 7:101176593-101176615 AAGTCTCCCTATGGGGAAGAGGG - Intronic
1030809243 7:113955339-113955361 CAGTGTCAGCTTGGGGCAGGGGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG + Intronic
1034430426 7:151038583-151038605 CAGTCTCCCTGTGGGGAGGGTGG + Intronic
1034441921 7:151090046-151090068 CAGTGTCCCCATTTGGACTGAGG - Intronic
1034593405 7:152163650-152163672 CTGTGGCACCATGGGAAAGGTGG + Exonic
1035044545 7:155955015-155955037 CAGTGCTCCCATGGCGAAGACGG + Intergenic
1035286516 7:157810492-157810514 CAGGGTCTCCATGGGGACGGCGG + Intronic
1035376615 7:158410914-158410936 CAGTGTGCTCATGGGGTGGGAGG + Intronic
1035519524 8:266038-266060 CAGTGTCCCCCTGGGGAGGGGGG + Intergenic
1035838763 8:2787918-2787940 TAATGTCCCCATGGTGAAGCTGG + Intergenic
1036387293 8:8293528-8293550 CAGTCTCCCCATCTGGAAAGCGG + Intergenic
1036691257 8:10946196-10946218 CAGGTTGCCCATGGGGAATGGGG + Intronic
1036695456 8:10971700-10971722 TAGTGTCCCCATTGGCAAGAGGG - Intronic
1037620739 8:20561405-20561427 CAGTGTCCACTTGGGGTGGGGGG + Intergenic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1039919951 8:41886515-41886537 CAGTGTACCCTTGGGCAAGGGGG - Intronic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1042218519 8:66450784-66450806 AGGTGTCCACATGGGGAAGTTGG - Intronic
1044455790 8:92391741-92391763 CAGTGTCCCCAAGGTTAAAGGGG + Intergenic
1044713307 8:95077323-95077345 CATATTCCCCATGGAGAAGGGGG - Intronic
1045128925 8:99126250-99126272 CAGAGTAAGCATGGGGAAGGAGG + Intronic
1045254719 8:100509908-100509930 GAGAGTCTCCTTGGGGAAGGGGG + Exonic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1047194339 8:122707920-122707942 CTGTGTCCTCATGGGGCAGAAGG + Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049354762 8:142182235-142182257 CAGTCTCCCCATCTGGAAAGTGG + Intergenic
1050244858 9:3678073-3678095 GACTGTCCCCATGGCTAAGGTGG - Intergenic
1050302512 9:4274083-4274105 CAGTTTCCTCATCTGGAAGGTGG - Intronic
1050969210 9:11847102-11847124 TAGTGTCCCTAAGGTGAAGGAGG - Intergenic
1051088219 9:13376896-13376918 AAGAGTCCCCATGGGGTAGTGGG + Intergenic
1051457741 9:17280005-17280027 TAGAGTCCCCATGAGGAAGAAGG + Intronic
1052865162 9:33460399-33460421 GATTATCCCCATGGGGGAGGGGG - Intergenic
1053373849 9:37587493-37587515 CAGTGTCCTCCTGAGAAAGGTGG - Intronic
1058114034 9:101064781-101064803 CAGAGTCCCCATCGGAAAGAAGG - Intronic
1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG + Intronic
1060937514 9:127524233-127524255 AAGTGTCCACAGGGGGAGGGAGG + Intronic
1061188338 9:129068119-129068141 CAGTCTCCCCATCTGGAAAGTGG + Intronic
1061221579 9:129255124-129255146 CACTGTCTCCATGGGCAATGGGG - Intergenic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061236494 9:129346087-129346109 CCGTTTCCCCATGTGGATGGTGG - Intergenic
1061871799 9:133524833-133524855 CAGCGTCCCCATGGGCCAGGAGG + Exonic
1061924642 9:133800048-133800070 CAGTGTCCCCATGGGTAGAACGG - Intronic
1061973472 9:134056761-134056783 CAGAGTCCCAGTGGGGAGGGAGG + Intronic
1062231559 9:135484822-135484844 CTTTGACCCCATGGGGGAGGAGG + Exonic
1062698856 9:137888870-137888892 GAGGGTCCCCATGGGCAAGGAGG + Intronic
1203657584 Un_KI270753v1:13237-13259 CAGTGTCTCCGTGGGCATGGTGG + Intergenic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1187606859 X:20894372-20894394 CAGTGTCCTCATCTGGAAAGTGG + Intergenic
1190285920 X:48961431-48961453 CACTGTCCCCATGGAGCTGGTGG - Exonic
1190480500 X:50872128-50872150 CATTCTCCCCATGTGGAAGCTGG - Intergenic
1190735869 X:53255874-53255896 CAGTGTCGCCCTGAGGAAGCAGG - Exonic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194621849 X:96182558-96182580 CAGTGTCCCCATGTGGCAGAAGG + Intergenic
1196134096 X:112188396-112188418 CAGTGTCTGCCTGGGGATGGAGG - Intergenic
1196886622 X:120251556-120251578 CAGGGTCCATATGGGGAAGAGGG + Intronic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic