ID: 1143204955

View in Genome Browser
Species Human (GRCh38)
Location 17:5134882-5134904
Sequence GATGATGGAGTCGCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 17, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143204951_1143204955 -7 Left 1143204951 17:5134866-5134888 CCCTGGAGATTTGGAAGATGATG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG 0: 1
1: 1
2: 17
3: 5
4: 86
1143204952_1143204955 -8 Left 1143204952 17:5134867-5134889 CCTGGAGATTTGGAAGATGATGG 0: 1
1: 0
2: 0
3: 42
4: 209
Right 1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG 0: 1
1: 1
2: 17
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143204955 Original CRISPR GATGATGGAGTCGCTCCAGG AGG Intronic
900997831 1:6131924-6131946 GAGGATGGATTGGCTCCAAGGGG - Intronic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
919796037 1:201322178-201322200 GATGAGGCAGTGGCTCCTGGGGG - Intronic
920005649 1:202831918-202831940 GAGGATGGCTTCACTCCAGGAGG + Intergenic
924112171 1:240711120-240711142 CATGATGGAGGCGCTCAGGGTGG - Intergenic
924706550 1:246507199-246507221 GAGGATGGAGCCGCTGAAGGTGG - Exonic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1069532191 10:69227606-69227628 GAACATGGAGATGCTCCAGGAGG - Intronic
1070881382 10:79853652-79853674 GAGGATGGACTTGATCCAGGTGG + Intergenic
1071647958 10:87369968-87369990 GAGGATGGACTTGATCCAGGTGG + Intronic
1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG + Intergenic
1084972195 11:72777997-72778019 GATGACTGGGTCACTCCAGGAGG - Intronic
1085644393 11:78213739-78213761 GAGGATGAAGGCTCTCCAGGGGG + Exonic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1093825741 12:23685744-23685766 GTCCATGGAGTCCCTCCAGGGGG - Intronic
1096570931 12:52522756-52522778 AATAATGGAGCCGCTCCTGGTGG + Intergenic
1101750807 12:107581173-107581195 GCTGATGGAGTGGATCCGGGTGG + Exonic
1103362047 12:120360270-120360292 GATGATGGGGTCGGGCCTGGTGG - Intronic
1104122425 12:125812117-125812139 GATGATGGATTCAGACCAGGTGG - Intergenic
1106679137 13:31992412-31992434 GAGGATGGATTAACTCCAGGAGG - Intergenic
1111139686 13:84099815-84099837 GAGGATGGAGAAGCACCAGGAGG + Intergenic
1112337037 13:98524365-98524387 GCTGATGGAGGCCTTCCAGGAGG - Intronic
1115361921 14:32513088-32513110 GGTGTTGGGGTCACTCCAGGAGG + Intronic
1120124619 14:80726395-80726417 GTTGATGGAGTAGCTCTAGTTGG - Intronic
1122402600 14:101476192-101476214 GATGATGAATCCCCTCCAGGGGG + Intergenic
1130982052 15:88819386-88819408 GATGTTGAACTCGCTCCATGTGG + Intronic
1130990442 15:88872788-88872810 GATGATGAAGAGGCTCCACGGGG + Intronic
1132562071 16:600133-600155 GATGTTGGAGCCTCTTCAGGTGG + Intronic
1133181394 16:4057450-4057472 GATGATGGTGTCACTGCAGCCGG - Intronic
1139472444 16:67185369-67185391 GGTGTTGGAGGCGCTGCAGGCGG - Exonic
1141165682 16:81659420-81659442 GATGATGGAGGACTTCCAGGAGG + Intronic
1141185794 16:81786124-81786146 GATCATGGAGACGCGGCAGGTGG + Exonic
1141778632 16:86141721-86141743 GATGATGGATTGGCTCTTGGAGG + Intergenic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1144494873 17:15739727-15739749 GATGAAGGAGCCGCTCTGGGAGG + Intronic
1144905382 17:18636945-18636967 GATGAAGGAGCCGCTCTGGGAGG - Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146646937 17:34582000-34582022 CAAGCTGGAGACGCTCCAGGAGG + Intronic
1146651289 17:34608115-34608137 GCTAATGGAGTGACTCCAGGAGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148071929 17:44913760-44913782 GAAGATTGAGTCGCTGGAGGAGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152451389 17:80383212-80383234 GAGGATGGAGTGACTCGAGGTGG - Intronic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
925168093 2:1731512-1731534 GATGATGGTGGAGCTTCAGGCGG + Intronic
931522932 2:63119136-63119158 GATGTTGCAGTCGCTCTGGGTGG + Intergenic
946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG + Intronic
946396287 2:219445286-219445308 GAAGATGGAGTGGCAGCAGGGGG - Intronic
1173290757 20:41712916-41712938 GGTGATGGACTGGCTACAGGAGG - Intergenic
1174307166 20:49621365-49621387 GGTGATGGGTTGGCTCCAGGCGG - Intergenic
1185366566 22:50439575-50439597 GAAGATGGGGCTGCTCCAGGAGG - Intronic
949644152 3:6073924-6073946 GATGATGGAGCAGCTCCTGTGGG + Intergenic
956736769 3:72244426-72244448 GATGATTCAGTCGGTGCAGGTGG - Intergenic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
962917477 3:139917714-139917736 GATGATGGAGGTGGTCCAGGAGG - Intergenic
964440460 3:156703458-156703480 GATGATGAAGTTGCTTCAAGAGG - Exonic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966868596 3:184276134-184276156 CATGGTGGAGTCGGGCCAGGCGG - Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
971555653 4:28011341-28011363 GATGAGGGAGTCGTTCTAGTGGG + Intergenic
973284797 4:48403349-48403371 GATGATGGAGCCCCTGGAGGAGG - Intronic
973285555 4:48411911-48411933 GGTGATGGAGTATCTCCATGAGG - Intronic
980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG + Intergenic
991968057 5:72110628-72110650 CAAGATGGAGCTGCTCCAGGGGG + Intronic
998305280 5:141069954-141069976 GAGGATGGAGTGAGTCCAGGAGG + Intergenic
1003156780 6:3603555-3603577 GATGGTGGAGTCACTCCCAGTGG + Intergenic
1004170004 6:13288456-13288478 AACGATGGAGTCACTCCAGAAGG - Exonic
1006739030 6:36294230-36294252 GGTGATGGCGTCGGTCCAGAAGG - Exonic
1008793385 6:55268634-55268656 GATGATGGAGTTGATCCATCAGG + Intronic
1019593613 7:1848083-1848105 GATGATGGAGGAGCTCCTGGGGG + Exonic
1024603733 7:51008660-51008682 GCTGATGTAGTCCCTCCTGGGGG + Intergenic
1026253952 7:68694631-68694653 GATGATGGATTGGCTGCAGGAGG - Intergenic
1029188345 7:98755073-98755095 GAGGATGGAGTTCCTGCAGGAGG + Intergenic
1029845848 7:103411508-103411530 GATGATATAGTCATTCCAGGAGG - Exonic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1034713901 7:153221527-153221549 GATGCTGGAGCCCCTCCAGATGG + Intergenic
1035227013 7:157439282-157439304 GGTGATGGAGGTGCTCCTGGAGG - Intergenic
1035326948 7:158071534-158071556 GATGATGGAGGTGCTCCTGGTGG + Intronic
1035365772 7:158348807-158348829 AATGATGGAATCTGTCCAGGAGG - Intronic
1035989261 8:4469955-4469977 GATGATGGTGTGAATCCAGGAGG - Intronic
1041898853 8:62958435-62958457 GGTGATGGAGTAGATCCCGGTGG - Intronic
1044132364 8:88540028-88540050 GAGGATGGAGTTGCCCCAGAAGG - Intergenic
1057352870 9:94315376-94315398 CAGGATGGACTTGCTCCAGGTGG - Intergenic
1057654877 9:96942215-96942237 CAGGATGGACTTGCTCCAGGTGG + Intronic
1057699834 9:97355863-97355885 GATGATGGAGAAAATCCAGGGGG + Intronic
1060145941 9:121252399-121252421 GAAGCTGGAGGGGCTCCAGGAGG + Intronic
1060752946 9:126186105-126186127 GATGATGGAGAGGCTCCTGAAGG + Intergenic
1060827771 9:126696288-126696310 GAAGATGGAGTCGTTCCCTGGGG - Exonic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062401829 9:136376192-136376214 GGTCATGGAGGCCCTCCAGGGGG - Intronic
1062482689 9:136759702-136759724 GAGGATGGAGAGACTCCAGGTGG + Exonic
1200184866 X:154175632-154175654 GTTGCTGGAGTCCCTTCAGGAGG - Intergenic
1200190519 X:154212770-154212792 GTTGCTGGAGTCCCTTCAGGAGG - Intergenic
1200196270 X:154250572-154250594 GTTGCTGGAGTCCCTTCAGGAGG - Intergenic
1200201925 X:154287690-154287712 GTTGCTGGAGTCCCTTCAGGAGG - Exonic