ID: 1143209674

View in Genome Browser
Species Human (GRCh38)
Location 17:5175850-5175872
Sequence AGGTGAACAAATAGAAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143209674_1143209678 25 Left 1143209674 17:5175850-5175872 CCTCAGCTTCTATTTGTTCACCT No data
Right 1143209678 17:5175898-5175920 GGCTTGTAAGAATTAAATGAAGG No data
1143209674_1143209677 4 Left 1143209674 17:5175850-5175872 CCTCAGCTTCTATTTGTTCACCT No data
Right 1143209677 17:5175877-5175899 AGTTAAAATACGGAACACTCAGG No data
1143209674_1143209675 -6 Left 1143209674 17:5175850-5175872 CCTCAGCTTCTATTTGTTCACCT No data
Right 1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143209674 Original CRISPR AGGTGAACAAATAGAAGCTG AGG (reversed) Intergenic
No off target data available for this crispr