ID: 1143209675

View in Genome Browser
Species Human (GRCh38)
Location 17:5175867-5175889
Sequence TCACCTATAAAGTTAAAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143209673_1143209675 -5 Left 1143209673 17:5175849-5175871 CCCTCAGCTTCTATTTGTTCACC No data
Right 1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG No data
1143209674_1143209675 -6 Left 1143209674 17:5175850-5175872 CCTCAGCTTCTATTTGTTCACCT No data
Right 1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG No data
1143209672_1143209675 1 Left 1143209672 17:5175843-5175865 CCTTCACCCTCAGCTTCTATTTG No data
Right 1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143209675 Original CRISPR TCACCTATAAAGTTAAAATA CGG Intergenic
No off target data available for this crispr