ID: 1143210631

View in Genome Browser
Species Human (GRCh38)
Location 17:5184642-5184664
Sequence CCACTAGGGTAAATGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143210626_1143210631 2 Left 1143210626 17:5184617-5184639 CCTGAACTGGTTCACAGGAAGCA 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1143210631 17:5184642-5184664 CCACTAGGGTAAATGCCACCAGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143210631 Original CRISPR CCACTAGGGTAAATGCCACC AGG Intronic
900507498 1:3037051-3037073 CCAGTAGGGTAAAGACCTCCCGG - Intergenic
900901585 1:5520071-5520093 ACACTGGGGAAAATGCCTCCAGG - Intergenic
907056681 1:51375454-51375476 CCACTAGGTAGAATTCCACCAGG - Intronic
910412980 1:86965695-86965717 CCACTAGGATAAATGACCCTTGG + Intronic
920787153 1:209052064-209052086 CCACTGTGGTAAATGCCTGCAGG + Intergenic
922416323 1:225426723-225426745 CCACTAGGCAAAATGCAAACAGG + Intronic
1065352999 10:24812203-24812225 ACACTGGGGTAAATGCGGCCTGG + Intergenic
1066431249 10:35353989-35354011 CAACTAGGGGAACTGCCTCCAGG + Intronic
1067374088 10:45711414-45711436 CCACTAAAGTAAGTGCCACAAGG - Intergenic
1067881916 10:50053168-50053190 CCACTAAAGTAAGTGCCACAAGG - Intergenic
1071680802 10:87703456-87703478 AGACTAGATTAAATGCCACCTGG + Intronic
1077420611 11:2448172-2448194 CAACCAGAGTAGATGCCACCTGG - Intronic
1077635172 11:3837230-3837252 CCACAAGGGAAAATAACACCAGG + Intronic
1079032185 11:16994160-16994182 TCAGTAGGGTCAAGGCCACCAGG + Intronic
1081108903 11:39107276-39107298 CCAGTAGGGTAAATTCCACTAGG + Intergenic
1085178884 11:74515777-74515799 TCCCTAGGGTAAATCCCACTTGG - Intronic
1087374581 11:97325808-97325830 CCACTGTAGTAAATGCCCCCAGG - Intergenic
1088388865 11:109291036-109291058 ACAATAGGGAAAATGCCTCCAGG - Intergenic
1092140095 12:6177969-6177991 TCACCAGAGTCAATGCCACCTGG + Intergenic
1094734752 12:33222491-33222513 CCACTATGGTGAATGCCTACAGG - Intergenic
1094743375 12:33314851-33314873 ACAATAGGGAAAATGCCCCCAGG - Intergenic
1098239790 12:68455605-68455627 CCACTAGGGTAAATGGGGCAGGG - Intergenic
1101093388 12:101311012-101311034 CCACTAGGGAGAATGCCTCATGG - Intronic
1103170650 12:118816472-118816494 CAACTTGGCTAAATCCCACCTGG - Intergenic
1108475322 13:50810606-50810628 GCATTAGGGGAAAGGCCACCGGG + Intronic
1112319858 13:98396096-98396118 CCTCCGGGGTAAATGCTACCTGG - Intronic
1115375405 14:32670202-32670224 GCAGGAGGGTAAATGCCCCCAGG + Intronic
1115930428 14:38485678-38485700 TCACTGGGATGAATGCCACCTGG - Intergenic
1116392267 14:44407257-44407279 CCCTTAGGGTAATAGCCACCAGG - Intergenic
1117962784 14:61179343-61179365 CCACTGAGATAAATGCCACCAGG - Intergenic
1119356260 14:74009336-74009358 CCACTAGGATCAGTGCCACTGGG + Intronic
1119638048 14:76292750-76292772 CCAGGAGGGTGAATGCCGCCGGG - Intergenic
1120798904 14:88667738-88667760 CCACTCTGGTGAATGCCATCAGG - Intronic
1122479800 14:102039634-102039656 CCACTCGGTTAAACGCCACCTGG - Exonic
1126006309 15:44261222-44261244 CCTCTAGGGTAACTGCCTCTTGG + Intergenic
1126335459 15:47582430-47582452 ACAATAGGCTAAATGCCACAGGG + Intronic
1127940789 15:63693646-63693668 CCCCTAGGCAAAATGCAACCTGG + Intronic
1129172783 15:73818076-73818098 CCCCTAGGATGAAGGCCACCTGG - Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1137704839 16:50527476-50527498 CCACTAGTGCAAATGTCAACAGG - Intergenic
1140717759 16:77742261-77742283 CAAATAAGGTAAATGCCACATGG - Intergenic
1143210631 17:5184642-5184664 CCACTAGGGTAAATGCCACCAGG + Intronic
1154293698 18:13132006-13132028 CCACTGGGGGAAATGCTGCCTGG - Intergenic
1158438737 18:57454564-57454586 CCATAAGGGTATATGGCACCTGG + Intronic
1158603666 18:58876314-58876336 CCAGCAGGGTCAATGGCACCAGG - Intronic
1159014639 18:63091106-63091128 CCACAGGGGTGAATGCCACAGGG + Intergenic
1160045752 18:75385961-75385983 TCACTTGGGTAAATGCAACGTGG - Intergenic
1161207837 19:3051089-3051111 CAACAAGGGTAAATGTCAGCAGG + Intergenic
1165867996 19:38950502-38950524 CCACTTGGGTAAAAGACCCCTGG + Intronic
928222682 2:29417874-29417896 CCACTAGGGTAAATGCGTTCGGG - Intronic
932793120 2:74673041-74673063 CCACTATGGTAAATGTCTCAGGG - Intronic
940980782 2:160000049-160000071 CCTTTAGGGTAAATCCCACTAGG - Intronic
943304430 2:186242067-186242089 CCACTAGGAAAAATGTTACCTGG + Intergenic
943812419 2:192204711-192204733 CCAAAAGGGTAAAGGCCACAAGG + Intergenic
943962970 2:194291018-194291040 CCTCTGGGGAAAATGCAACCAGG - Intergenic
1170335356 20:15264777-15264799 TCACTAGGGAAAATTCCTCCAGG - Intronic
1170960553 20:21021744-21021766 TTACTAGAGCAAATGCCACCTGG - Intergenic
1174531481 20:51217879-51217901 ACAATAGGGGAAATGCCTCCAGG - Intergenic
1176723187 21:10409908-10409930 CCACTAGGGCCAGTGCCAACAGG + Intergenic
1184112767 22:42404988-42405010 TCACTAGGCTAAGTGCCAACAGG - Intronic
949733717 3:7145855-7145877 CCACTAGAGTAAATGCCAAGGGG + Intronic
950923024 3:16714962-16714984 CCACTGTGGTAAATTCCCCCAGG - Intergenic
951279320 3:20728499-20728521 CCCCTAGGATAAATCCCACTTGG + Intergenic
952188405 3:30996146-30996168 CCAGTAGCATTAATGCCACCTGG - Intergenic
958119399 3:89264328-89264350 CCAGTAGGGAAAATTCCACTGGG + Intronic
963913931 3:150840866-150840888 CCACTGTGGTGAATGCCAGCAGG - Intergenic
965781233 3:172288334-172288356 TCACTCAGGTAAATGCCACAAGG + Intronic
968632361 4:1658634-1658656 GCACTAAGGGAAATGCCACAGGG + Intronic
970097653 4:12482559-12482581 CCCCTAGGATAAATCCCACTTGG + Intergenic
970101264 4:12524853-12524875 CCACCATGGTGAATGCCCCCAGG + Intergenic
972815827 4:42644215-42644237 CCACAGGGATAAATTCCACCGGG + Intronic
973190582 4:47381045-47381067 GCACAGGGGTAATTGCCACCAGG + Intronic
976461244 4:85314832-85314854 CCAATAGGGAAAATGTCTCCAGG - Intergenic
976735897 4:88308838-88308860 TCACTGGGGTAAATCCCACTTGG + Intergenic
981975967 4:150728501-150728523 CCCCTAGGATAAATCCCACTTGG - Intronic
982185922 4:152798568-152798590 CCTCTAGGATAAATGCCATTTGG + Intronic
983389250 4:167107308-167107330 TCACTGGGGTAAATCCCACTTGG - Intronic
985050131 4:185981962-185981984 CCAATAAGGCAAATGCCAACCGG + Intergenic
986834572 5:11620818-11620840 CCACTAGGCTAAGTGTCACCTGG - Intronic
989354167 5:40522859-40522881 TCCCTAGGGTAAATCCCACTTGG - Intergenic
993175683 5:84482307-84482329 CCAGTGAGGTAAATGCCACCAGG + Intergenic
995188039 5:109291292-109291314 CCACTATGGTGAATGCCTGCAGG + Intergenic
996045994 5:118873906-118873928 CCACTGTGGTGAATGCCAGCAGG + Intronic
1008800034 6:55356059-55356081 TCACTAGGATAAATCCCACGTGG + Intronic
1014721325 6:124921070-124921092 ACACTAGGGAAAATGTCTCCAGG - Intergenic
1016157881 6:140835656-140835678 CCACTGGTGTGAGTGCCACCAGG - Intergenic
1016720833 6:147295636-147295658 CCACAAGGGGAAGTGCCTCCTGG - Intronic
1016721504 6:147304108-147304130 ACAATAGGGTAAATGCCTCCAGG + Intronic
1017244346 6:152206460-152206482 CCACTACGGTAAATGCTTGCTGG - Intronic
1019819403 7:3230746-3230768 CCACTTGGGAAAACCCCACCTGG - Intergenic
1023859094 7:44206458-44206480 CCAGCAAGGTAAAGGCCACCCGG - Exonic
1023938936 7:44757914-44757936 CCAGTAGGGTTCATGCCAGCGGG - Exonic
1025127036 7:56352710-56352732 CCACTGGGGAACATGCCCCCAGG + Intergenic
1025625828 7:63220458-63220480 TCACTGGTGTAAATGCCTCCTGG - Intergenic
1027054972 7:75043500-75043522 CCACTAGGCTCCATGCCCCCAGG + Intronic
1027773824 7:82441995-82442017 GCAAAAGGGTAAATGCCATCTGG - Intronic
1030108543 7:106007266-106007288 ACAATGGGGTAAATGTCACCAGG - Intronic
1030431110 7:109450382-109450404 TCCCTAGGATAAATCCCACCTGG + Intergenic
1030692431 7:112549737-112549759 CCATTAAGGAAAATGCCTCCTGG - Intergenic
1031494358 7:122428211-122428233 CCATTAGTGTAAATGTCAACAGG - Intronic
1031597208 7:123662145-123662167 CCACAAGGGTGAATGGCAGCTGG - Exonic
1031745666 7:125494919-125494941 CCACTATGGTAAAAGCCCACTGG - Intergenic
1033329617 7:140407223-140407245 CCACTAGTGTCAATTTCACCTGG - Intronic
1034453530 7:151151026-151151048 CCACTAAGGAAAATGTCAGCTGG - Intronic
1042595656 8:70445287-70445309 CCAATAGAGTAAATGCCACGTGG + Intergenic
1043385676 8:79745263-79745285 GGACTAGTGTAAATGCCATCAGG - Intergenic
1045505661 8:102776761-102776783 CCACTAGGGCAAAAGCCACTAGG + Intergenic
1047627470 8:126670913-126670935 CCACTAGGTTAGATGGCAACAGG - Intergenic
1049447610 8:142638615-142638637 CCACTGGGGTCATGGCCACCGGG - Intergenic
1051767518 9:20540731-20540753 ACATTAGGGAAAATGCCCCCAGG - Intronic
1052774151 9:32716993-32717015 ACACAAAGGTAAATGCCACGTGG - Intergenic
1055992316 9:82120176-82120198 CCACTGGAGTATATTCCACCAGG - Intergenic
1058163258 9:101593314-101593336 CCACTAGGGAAAAGGCTTCCTGG + Exonic
1061044737 9:128159169-128159191 CAACTAAGGTGCATGCCACCAGG + Intergenic
1061230946 9:129315525-129315547 CCCCTGGGATAAATTCCACCTGG + Intergenic
1061619792 9:131804474-131804496 CCACCAGGGTGACTGCCATCTGG + Intergenic
1186601789 X:11046133-11046155 TCCCTGGGGTAAATACCACCTGG + Intergenic
1191155434 X:57267560-57267582 CCACTATGGTGAATGCCCACAGG + Intergenic
1192926608 X:75760376-75760398 CCACTGTGGTAAATGCCTGCAGG + Intergenic
1193172695 X:78355186-78355208 TCACTGGGGTAAATCCCACTTGG + Intergenic
1194219405 X:91172637-91172659 TCACTAGGATAAATCCCACTTGG + Intergenic
1194450657 X:94041476-94041498 GCAATAGGGAAAATGCCTCCAGG + Intergenic
1194492028 X:94562955-94562977 TCACTAGGATAAATCCCACTTGG + Intergenic
1200392451 X:155957704-155957726 CAACTTGGGTAAATGTCATCGGG + Intergenic
1202266087 Y:23020767-23020789 CCACTAAGGTAAATGCCCAGAGG - Intergenic
1202419080 Y:24654510-24654532 CCACTAAGGTAAATGCCCAGAGG - Intergenic
1202451706 Y:25015574-25015596 CCACTAAGGTAAATGCCCAGAGG + Intergenic