ID: 1143220171

View in Genome Browser
Species Human (GRCh38)
Location 17:5255039-5255061
Sequence CCTGAAGGCCAGTTGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143220171_1143220179 -2 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220179 17:5255060-5255082 GGACTGCAAGAGGCCCCAAGGGG No data
1143220171_1143220184 22 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220184 17:5255084-5255106 CAGCTCTTCCTGCTGCTCTCAGG No data
1143220171_1143220178 -3 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220178 17:5255059-5255081 AGGACTGCAAGAGGCCCCAAGGG No data
1143220171_1143220186 24 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220186 17:5255086-5255108 GCTCTTCCTGCTGCTCTCAGGGG No data
1143220171_1143220177 -4 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220177 17:5255058-5255080 CAGGACTGCAAGAGGCCCCAAGG No data
1143220171_1143220185 23 Left 1143220171 17:5255039-5255061 CCTGCACCCAACTGGCCTTCAGG No data
Right 1143220185 17:5255085-5255107 AGCTCTTCCTGCTGCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143220171 Original CRISPR CCTGAAGGCCAGTTGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr