ID: 1143225072

View in Genome Browser
Species Human (GRCh38)
Location 17:5294604-5294626
Sequence CCTCAGATACTGAGGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143225066_1143225072 -8 Left 1143225066 17:5294589-5294611 CCTGGAACCAATTTCCCTCAGAT 0: 1
1: 4
2: 55
3: 235
4: 730
Right 1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG 0: 1
1: 0
2: 2
3: 34
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143225072 Original CRISPR CCTCAGATACTGAGGGAAAA CGG Intronic
901380515 1:8870646-8870668 CCTCCGATTCTGGGGGGAAAGGG - Intronic
903795728 1:25927597-25927619 CCTCAGTTTCTGGGGGAGAAAGG + Intergenic
907265269 1:53255571-53255593 CAACAGATACTGATGGAAAAAGG - Intronic
908051309 1:60234521-60234543 CTACAGATACTTGGGGAAAAGGG + Intergenic
908321171 1:62980433-62980455 CAACAGATTGTGAGGGAAAAAGG - Intergenic
908410090 1:63855495-63855517 AATAAGATACAGAGGGAAAAAGG - Intronic
909165835 1:72222708-72222730 CTTCAGAAGCTGAGGCAAAAAGG + Intronic
909245109 1:73270947-73270969 TCTCAGTTACAGAGAGAAAAAGG + Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
914675944 1:149907615-149907637 CCTAAGATAGTGAATGAAAAAGG + Intronic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
917493121 1:175515366-175515388 CCTCAGATGCTAAGGAAACATGG + Intronic
917636518 1:176942491-176942513 CTTCAGAAAAGGAGGGAAAAAGG + Intronic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
918914089 1:190612582-190612604 CATCACATAGTTAGGGAAAATGG + Intergenic
919429310 1:197473023-197473045 CTACATATACTGTGGGAAAATGG + Intronic
920097054 1:203493045-203493067 CCACAGATACAGAGGGCCAACGG - Intergenic
920560733 1:206936699-206936721 CCTCACATTCAGATGGAAAAAGG - Intronic
921351134 1:214236408-214236430 ACTCAGAAACGGAGGGAAACAGG + Intergenic
1063539185 10:6914835-6914857 ATTCAGACACTGAGGGAAAAAGG + Intergenic
1063572957 10:7233385-7233407 ACTCAGAGAGTGAGGGAAGAAGG + Intronic
1066055188 10:31674150-31674172 CCTCAGAGCCTCAGGGAAGAGGG + Intergenic
1067670605 10:48317591-48317613 GCTCAGAAAATGAGTGAAAATGG + Intronic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1068467607 10:57415334-57415356 CCTGAGATACAGTGGGAAACAGG + Intergenic
1069873714 10:71548636-71548658 ACACAGAGACAGAGGGAAAAAGG + Intronic
1069964740 10:72105171-72105193 CCTCTGCCACTGAGGGCAAAGGG - Intronic
1070675814 10:78410554-78410576 CCTGAGACACTGAAGGGAAAGGG - Intergenic
1070732505 10:78841097-78841119 GGTCAGAGGCTGAGGGAAAAGGG + Intergenic
1071797523 10:89022322-89022344 CCTCAGATGCTTAAGCAAAATGG + Intergenic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1073032897 10:100542047-100542069 TATCAGATACTGCAGGAAAAAGG + Intronic
1074504318 10:114054613-114054635 CCTCAGATGAGGAGAGAAAACGG + Intergenic
1075304224 10:121353673-121353695 TCTCAGAATCTGAGAGAAAATGG - Intergenic
1076437738 10:130458050-130458072 CCTAAGATACTGAATTAAAATGG + Intergenic
1078090894 11:8263860-8263882 CCTCATACATTGAGGGAGAAAGG - Intronic
1078442383 11:11378506-11378528 GCTCAGATGCTGGGGGGAAAGGG - Intronic
1079646236 11:22866551-22866573 CCTCCGCTAGTGAGGGCAAAGGG - Intergenic
1081022764 11:37968107-37968129 CCTCAGACAGTGAGGGCAAAGGG + Intergenic
1081062495 11:38497703-38497725 ATTCATTTACTGAGGGAAAAAGG - Intergenic
1083320398 11:61842509-61842531 CCTCAAAGACTGAGGGCAATTGG - Intronic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1084778359 11:71392286-71392308 CCTCAGCTGCCGAGGGAAAGAGG - Intergenic
1085150298 11:74247190-74247212 CCTGAGATAGTGAGGTATAACGG + Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1087335192 11:96835304-96835326 CCTAGGATACTGTGGGAAGAAGG + Intergenic
1087843217 11:102941540-102941562 CATCAGATAATAAGGGTAAAAGG - Intergenic
1088030609 11:105244373-105244395 ACTCAGAGAGAGAGGGAAAAAGG + Intergenic
1090307191 11:125701817-125701839 TTTTAGATACTCAGGGAAAATGG + Intergenic
1092695039 12:11162169-11162191 CCTCAGAAAATGATGGATAAGGG + Intronic
1092960849 12:13595634-13595656 CCTCTGATGCTGAGGCAAGAAGG - Intronic
1093247743 12:16761240-16761262 CCTCAGATACTGTGAGATAGAGG - Intergenic
1093657761 12:21716686-21716708 CCACAGAGCATGAGGGAAAATGG + Intronic
1093787344 12:23207832-23207854 GCTCAGCTATTGAGTGAAAAAGG + Intergenic
1093890342 12:24512523-24512545 GCCAAGATACAGAGGGAAAAAGG - Intergenic
1093906954 12:24704232-24704254 CCTCAGTTACCAAGGGAGAAGGG - Intergenic
1095126917 12:38490335-38490357 CCTCAGATACTGATGGGGAGGGG + Intergenic
1095202142 12:39396521-39396543 CCTCAGATAATGAATTAAAATGG + Intronic
1095939537 12:47717084-47717106 CCTCAGAGCCAGAGGGAAAGGGG + Intronic
1097079931 12:56422482-56422504 GCTGAGATACTAAGGGAAAGAGG + Intronic
1097746579 12:63310325-63310347 CCTCTGCTAGTGAGGGCAAAGGG + Intergenic
1098049599 12:66439444-66439466 CCTGATAGACTGAGAGAAAAGGG - Intronic
1098662683 12:73117341-73117363 CCTGAGAAACTTAGGGAGAATGG + Intergenic
1099464829 12:82970827-82970849 CTGCAGTTACTGAGAGAAAAAGG - Intronic
1100031491 12:90197771-90197793 CATCAGATACTGAGGGTGAGAGG - Intergenic
1100680356 12:96913067-96913089 CCTCTCCCACTGAGGGAAAATGG - Intronic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102605762 12:114066146-114066168 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1103249098 12:119484789-119484811 TTTCAGTTACTGATGGAAAATGG - Intronic
1105394799 13:20020601-20020623 CCTCAGTGACTGTGGGAAAGTGG - Intronic
1105600144 13:21879326-21879348 CCCCAGACACTGGGGGAGAAGGG - Intergenic
1106392392 13:29347182-29347204 AATCAGAAAGTGAGGGAAAATGG - Intronic
1106667244 13:31864652-31864674 CCTGGGATAGTGATGGAAAAAGG + Intergenic
1106856102 13:33854716-33854738 CCTAAGATTCTATGGGAAAATGG + Intronic
1108224554 13:48274862-48274884 CCCCAGATACTTAGAGAACATGG + Intergenic
1109331654 13:60938251-60938273 GGTCAAATAATGAGGGAAAAAGG + Intergenic
1109452973 13:62542582-62542604 CCACAGATACAGAGTAAAAATGG + Intergenic
1109667856 13:65562782-65562804 CCTTAAATACAGAGGGAAATTGG - Intergenic
1110521091 13:76477759-76477781 CCCCAGAGACTGAGAGATAACGG + Intergenic
1110662154 13:78069361-78069383 CCTGAGAAACTGAGAGAAAGAGG + Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1111336166 13:86826583-86826605 CTTGTGATACTAAGGGAAAAAGG - Intergenic
1111911327 13:94315598-94315620 CCTCACATAGAGAGAGAAAAAGG + Intronic
1115231778 14:31168212-31168234 CCTCAAATACTTCTGGAAAAGGG + Intronic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1120744967 14:88144574-88144596 CCTCAGAATCTGGAGGAAAATGG + Intergenic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1125360253 15:38857391-38857413 TCACAGATACTGAGTGAAGAAGG + Intergenic
1125426722 15:39556358-39556380 CCTCATCTACTTAGGGGAAATGG - Intergenic
1125757130 15:42071602-42071624 CCTCAGGTACTGATGGAAAATGG + Intronic
1126097431 15:45099530-45099552 CCTCCGATCCTGAGGGAGAGAGG + Intronic
1126372975 15:47966171-47966193 CATCTAATAATGAGGGAAAATGG - Intergenic
1127530259 15:59836846-59836868 CCTTAAATACTGAGGAATAAGGG + Intergenic
1127659117 15:61083461-61083483 CCTCAGATTCAGAGGGACTAAGG - Intronic
1130230905 15:82096132-82096154 CCTCTGGCACTGAAGGAAAATGG - Intergenic
1132410370 15:101573407-101573429 TTTCAGAGACTGAAGGAAAATGG + Intergenic
1134274770 16:12766356-12766378 CCTCAGACTGTGAAGGAAAAGGG + Intronic
1134357091 16:13492387-13492409 GCTCAGATTCTGAAGTAAAAAGG - Intergenic
1135636208 16:24077783-24077805 CCTCAGACAGTCAGGGAAAAGGG - Intronic
1136089213 16:27906471-27906493 CCTCAGATCCTCAGGGAAGCGGG - Intronic
1138050938 16:53776819-53776841 CCTCAGACATTAATGGAAAAAGG + Intronic
1140997372 16:80274281-80274303 ACTCACATACTGAAGCAAAAGGG + Intergenic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1141926529 16:87173840-87173862 CCTATGATCCTGAGGGTAAAAGG - Intronic
1142605026 17:1076755-1076777 CATCAGATACGGAGGGAACCGGG + Intronic
1143225067 17:5294596-5294618 CCTCAGTATCTGAGGGAAATTGG - Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1143418729 17:6771996-6772018 CATCATATACTAAGTGAAAAAGG - Intronic
1143593512 17:7900179-7900201 CCTCTGATCCTGAGTGAAATGGG + Intronic
1143692603 17:8582338-8582360 CCTCAAAGAGTGAGGGCAAAGGG + Intronic
1143706741 17:8703336-8703358 CCTCCGCTGCTGAGGGCAAAGGG + Intergenic
1144139034 17:12329427-12329449 CCTAAGATATTTAGAGAAAAGGG - Intergenic
1144710485 17:17398566-17398588 CCTCAGACACTGTGAAAAAAAGG + Intergenic
1146824357 17:36010099-36010121 CCTCAGACTCTGGAGGAAAATGG + Intergenic
1149664083 17:58353786-58353808 CCCCACTAACTGAGGGAAAAAGG + Exonic
1149742569 17:59060602-59060624 TCTCAGGGACTGAGGGAAACGGG + Intronic
1149899001 17:60456570-60456592 CCTCTCATTCTGAGGGAAATGGG - Intronic
1150368601 17:64614693-64614715 CTTGAGATACTTAGGGAGAAAGG + Intronic
1152054137 17:78009103-78009125 GCTCTTATACTGGGGGAAAAGGG + Intronic
1152994367 18:392626-392648 CTTCAGCTACTAAGGAAAAAGGG + Intronic
1156004168 18:32420386-32420408 CCACTGATATTGAGGGAAATGGG + Intronic
1156254900 18:35385609-35385631 ACTCAGACACAGAGGGAAGAAGG - Intergenic
1156591642 18:38496353-38496375 CCTCAGTAAATGAGGGGAAATGG + Intergenic
1157792579 18:50545937-50545959 CCTCAGCCAGTGAGGGCAAAGGG - Intergenic
1158998782 18:62951536-62951558 CTTCAGATCCTGAGGGCAAAGGG + Intronic
1159127933 18:64246786-64246808 ACTCAAATACTGAGAGACAAGGG + Intergenic
1159835967 18:73335859-73335881 TCTCTGATACTAAGGTAAAATGG + Intergenic
1162036325 19:7941727-7941749 CCCCTGAAACTGGGGGAAAACGG + Intronic
1164439403 19:28261158-28261180 CCTCAGAGCCTAAGGGAGAAGGG - Intergenic
1165122449 19:33569046-33569068 CCTCAGAAATTGGGGGACAAGGG - Intergenic
1166022519 19:40045327-40045349 CCTGAGAGGATGAGGGAAAAAGG + Intronic
1167265581 19:48481399-48481421 CCTCAGGTCCTGGGGGAAGATGG - Intronic
1167708234 19:51094412-51094434 ACTCTGAGATTGAGGGAAAAAGG - Intergenic
925518181 2:4708412-4708434 ACTCACATACTGAGGGGAAGAGG - Intergenic
925549569 2:5057275-5057297 CCTCAGATTTTGAGGGAGAAGGG + Intergenic
925748076 2:7061427-7061449 AATCATATTCTGAGGGAAAATGG + Intronic
926627190 2:15102060-15102082 CCACAGAGGCTGAGGGAAAGTGG - Intergenic
927355864 2:22172354-22172376 CCACAGATACAGAGGGCCAATGG + Intergenic
928059990 2:28102251-28102273 TCTCTGGTATTGAGGGAAAAAGG - Intronic
928498746 2:31864115-31864137 CCTAAAATACTCAGGTAAAAAGG + Intergenic
928885606 2:36144569-36144591 CCTCAGATATTGAGAGGAACTGG + Intergenic
929928518 2:46234351-46234373 AATCAGATACTGATTGAAAACGG - Intergenic
931245183 2:60486497-60486519 TCTAAGATACTGAAAGAAAATGG + Intronic
935380453 2:102446459-102446481 CTTTAGAGACTGAGGGAGAAGGG - Intronic
935512186 2:103989913-103989935 AATCAGAAACAGAGGGAAAAGGG - Intergenic
937301953 2:120848045-120848067 CCTCAGAAGCTGTGGGAAGAGGG + Intronic
938143582 2:128815346-128815368 CCATAGAAACTGAGGGACAAAGG + Intergenic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
939233591 2:139463189-139463211 CCTTAGAGACTGAGGGCAAATGG - Intergenic
939839363 2:147168772-147168794 TCTTAGAAACTGGGGGAAAAGGG - Intergenic
940048206 2:149432720-149432742 CCTAAGACAATGAGGGAAAGGGG - Intronic
940550006 2:155141776-155141798 CCACAGAGACTGAGAGATAAGGG + Intergenic
942204934 2:173610768-173610790 CCTCTGATGGTGAGGGAAAAAGG + Intergenic
942672340 2:178389705-178389727 CCAGAGAAACTGAGGGAAAATGG - Intronic
942850383 2:180477544-180477566 CCTCAGATACTGTGGAAAAGAGG - Intergenic
945773973 2:214081748-214081770 CATCAGGTACTGGGGGAAGAAGG - Intronic
947501456 2:230674296-230674318 CCTCAGACACTGAGTTAAAGAGG - Intergenic
948052728 2:234990857-234990879 CCCCAGATGCTAAGGGAGAAAGG - Intronic
948168802 2:235884199-235884221 CCATAGATACTGAGGGACAATGG - Intronic
948417781 2:237827308-237827330 CCTCAGATACTGAAGGGCAGAGG - Exonic
1168843179 20:922885-922907 CCTCAGAGGCTGAGGGGATAAGG + Intergenic
1168934384 20:1650547-1650569 ACTGAGATACGGATGGAAAATGG + Intronic
1169689609 20:8315818-8315840 AGTCAGATGCTGAGGGCAAAGGG + Intronic
1170026647 20:11895798-11895820 GCTCAAAGACTGAGGGTAAAAGG - Intronic
1170871565 20:20211142-20211164 CATCAAATCCAGAGGGAAAATGG + Intronic
1170988351 20:21279279-21279301 TGTCAGATACTCAGGGATAATGG + Intergenic
1171119283 20:22554341-22554363 CCTCAAATAGTGTGAGAAAAAGG - Intergenic
1174273717 20:49388207-49388229 CCTGACATACTGAGTGAACAAGG - Intronic
1174999434 20:55610814-55610836 TTTCAGATTCTGAGGGAAAATGG - Intergenic
1176304906 21:5118259-5118281 CCTGAGATGCTGGGGGAAAGCGG - Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177479943 21:21673884-21673906 CCTCAGATAATTTGGGTAAATGG - Intergenic
1178123548 21:29493785-29493807 TGTCAGATACTGAGGGCATATGG - Intronic
1178238095 21:30867399-30867421 CCTCGGAAGCTGAGGGAAGAGGG + Intergenic
1178970133 21:37167090-37167112 CCTCAGAAAGAGAAGGAAAAAGG + Intronic
1178990447 21:37350857-37350879 CCTCAGAAAGAGAGAGAAAAAGG - Intergenic
1179798408 21:43798969-43798991 CCTCAGCTACTGAGAGAGAAGGG - Intronic
1179852148 21:44143771-44143793 CCTGAGATGCTGGGGGAAAGCGG + Intronic
1180905871 22:19411035-19411057 TCTCAGGTACTTAGTGAAAAGGG + Intronic
1181443122 22:22948853-22948875 CCTCAGATACTGTGCAGAAAAGG - Intergenic
1181670298 22:24422753-24422775 CCCCAGGTCCTGAGGGATAAAGG - Intronic
949432108 3:3988523-3988545 TTTGAGATACTGAAGGAAAAAGG - Intronic
949676421 3:6459411-6459433 CCTCAGTTTCTGGGGGAAATTGG + Intergenic
949763757 3:7502682-7502704 CCTGAGAAACTCAGAGAAAATGG + Intronic
951576685 3:24121717-24121739 CCTCAGAGTCAGAGGGAAAAAGG + Exonic
952176081 3:30864893-30864915 CCACAGAAAATGAGGGGAAAGGG - Intronic
952917399 3:38258169-38258191 TCACACATAGTGAGGGAAAAGGG - Intergenic
954386790 3:50248364-50248386 CCTCAGGTCCTGATGGAAAGAGG + Intronic
954946021 3:54425008-54425030 CCTCAGCTAGTGAAGGAACATGG + Intronic
955342567 3:58136696-58136718 TCTTAGAAACTGAAGGAAAAAGG - Intronic
955793960 3:62616053-62616075 CCTAAGCTACTGATAGAAAAGGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
956219890 3:66891249-66891271 TAGCAGAAACTGAGGGAAAATGG - Intergenic
957615056 3:82516498-82516520 CTTCTGATAATGATGGAAAAGGG + Intergenic
957743227 3:84302441-84302463 ACTCAGACATTGGGGGAAAAAGG - Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
960026933 3:113020066-113020088 CCTCAGACATTAGGGGAAAAAGG + Intergenic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
963122886 3:141791178-141791200 CCTCACATTCAGAGGGATAATGG + Intronic
964585059 3:158288588-158288610 CCACAGATACCGGGGGAAGATGG - Intronic
964626889 3:158768356-158768378 TCTCAGTTACTGATGGACAATGG + Intronic
966802027 3:183773166-183773188 CCACAGATACAGAGGGCCAATGG + Intronic
966863325 3:184242485-184242507 ACTCAGGTCCTGAGGGAAAGGGG + Exonic
966976268 3:185086103-185086125 CCTCAGATCCAGAGGGAACAAGG + Intronic
967355097 3:188560298-188560320 GCACAGATAAAGAGGGAAAATGG + Intronic
967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG + Intergenic
969667769 4:8571839-8571861 CCTCAGTCACTGAGGGTCAAAGG - Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970318725 4:14854857-14854879 CCACAGATACAGAGGGCCAATGG + Intergenic
970845653 4:20534758-20534780 TATCAGATACGGAGGGAGAAGGG + Intronic
970882531 4:20948558-20948580 CCTCACATTCTGTGGGAAACAGG + Intronic
971079963 4:23198476-23198498 CCTGAGCTCCTGAGGGGAAAGGG + Intergenic
971270655 4:25141723-25141745 CCTCATATTCTGAGTGAAATAGG - Intronic
972343086 4:38169787-38169809 CCAGAGATCCTGAGGGATAAGGG - Intergenic
973550845 4:52034621-52034643 CCATAGATATTGAGGGACAACGG + Intronic
974612149 4:64230672-64230694 CCTCAGAGACTGAGGGTCAAAGG + Intergenic
976567253 4:86565083-86565105 CCTCACATTCTGAGTGAACATGG - Intronic
976862212 4:89678997-89679019 ACTCATATACTGAGAGATAAAGG - Intergenic
977433057 4:96956873-96956895 CCTCAGAAAATGAGAGAGAAAGG + Intergenic
979703525 4:123694091-123694113 CCTTGGATACTGAGGGATGAGGG + Intergenic
979971541 4:127141876-127141898 CCACAGATACTAAGTGAAGAAGG - Intergenic
980795852 4:137681568-137681590 CCTCATGTACAGAGGAAAAAGGG + Intergenic
982004717 4:151052496-151052518 CCGAAGCTAATGAGGGAAAAGGG - Intergenic
982183268 4:152769582-152769604 CCTCAGATTTTGATGGTAAAGGG + Exonic
982255449 4:153447019-153447041 CCTCAGACACTGTGGGACCAGGG + Intergenic
982797075 4:159659160-159659182 CCTGAGATCCTGAGGGCAAGGGG - Intergenic
986106168 5:4661541-4661563 CCTCAGACGCTTAGGGACAATGG + Intergenic
986430276 5:7674256-7674278 CCTCCCATACAGCGGGAAAAGGG - Intronic
986673167 5:10161058-10161080 CCTGAGATAATGAGGGCAAAGGG + Intergenic
987749097 5:22016867-22016889 CCCCAGTTATTGAAGGAAAATGG - Intronic
987933880 5:24438344-24438366 GCTCAAATCCTGATGGAAAATGG + Intergenic
989432481 5:41371973-41371995 AGTCAGCAACTGAGGGAAAAGGG - Intronic
989494003 5:42090293-42090315 TCTGAGTTACTGAGGAAAAATGG - Intergenic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
990294831 5:54390421-54390443 CCTCAAATAATGAGTGAAATAGG + Intergenic
993604061 5:89965944-89965966 CCTTAGAAACTGAGGGGCAATGG + Intergenic
995077155 5:107999308-107999330 CCTAAGATATGGAGGGTAAAAGG - Intronic
996559417 5:124812910-124812932 CCTCAGTCACTGAAGGAAACAGG - Intergenic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
997425986 5:133802999-133803021 CTTCATATAGTCAGGGAAAATGG - Intergenic
998394631 5:141810853-141810875 CCTCAGATACGGTGGGCATATGG - Intergenic
999013263 5:148067266-148067288 CCTCAGCCAGTGAGGGAAACAGG + Intronic
1000506119 5:162120312-162120334 CCTGAGAGAATGAGGGAAGATGG - Intronic
1003291347 6:4780979-4781001 CCACATCTACTGAGGAAAAAAGG - Intronic
1005136168 6:22570903-22570925 CTTCAGACATTTAGGGAAAAGGG + Exonic
1005675324 6:28148628-28148650 CCTCAGCCACTGATGGCAAAGGG - Exonic
1005695538 6:28349615-28349637 GGTCAGAAACTGAGTGAAAACGG - Intronic
1006341277 6:33448523-33448545 ACTTAAATACTGAGGGCAAAGGG - Intronic
1007647407 6:43393554-43393576 CCTCAGACACCGAGTTAAAAAGG - Intergenic
1008685058 6:53916449-53916471 CCCAAGATACTGAGTGAAAAGGG + Intronic
1008875701 6:56324179-56324201 CCTCAGAGATTGAAGGATAATGG - Intronic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1013794467 6:113870615-113870637 CCTCAGACACTGGAGGAAAATGG - Intergenic
1014417262 6:121197352-121197374 CCTGAGGTACTGAAGGCAAAGGG + Intronic
1014740482 6:125143273-125143295 CCTCTGCTAGTGAGGGCAAAGGG + Intronic
1014767490 6:125423516-125423538 CCTCAGAAACTGATAGAAAATGG - Intergenic
1015955090 6:138590433-138590455 CCTCAGGGAGTGAGGGGAAAGGG - Intronic
1017319576 6:153073904-153073926 ACACAGAACCTGAGGGAAAATGG - Intronic
1020967055 7:14884318-14884340 CCTGTAATACTGAGGGAAAATGG - Intronic
1021541668 7:21766242-21766264 ATTCAGATTCAGAGGGAAAAAGG + Intronic
1022347972 7:29536417-29536439 CCTCAGCTAATGAGGAATAAAGG - Intergenic
1022508275 7:30920308-30920330 GCTCAGATACAGAGGGACAGGGG + Intronic
1022582881 7:31574435-31574457 TCCCAGATACTGAGTGAAAGAGG - Intronic
1023129401 7:36987403-36987425 CCACAGAGATTGATGGAAAATGG + Intronic
1023798312 7:43811883-43811905 CCTTAGATACGGAGGGAAATGGG - Intergenic
1023798798 7:43815189-43815211 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1027658761 7:80963770-80963792 CCTGAGATTCTGAGGTAAACTGG - Intergenic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1029413152 7:100428030-100428052 CGACAGATTCTGAGGAAAAAGGG + Intronic
1029562705 7:101313793-101313815 CCTCAGATAATGAGGGAACCTGG - Intronic
1030716897 7:112818399-112818421 GCTCAGAAAGTGTGGGAAAACGG + Intergenic
1030895140 7:115050289-115050311 CCCCAGATACTGACGGTGAAAGG - Intergenic
1032709728 7:134451228-134451250 CCTGAGATACTGATGCACAAAGG - Intronic
1032783469 7:135182872-135182894 GATCAGATACCGAGGGGAAAGGG - Intergenic
1033298876 7:140167905-140167927 CCTTAAATATTGAGGGACAAAGG + Intronic
1036191539 8:6675061-6675083 CAACAGCTTCTGAGGGAAAATGG + Intergenic
1037435217 8:18855516-18855538 TTTCAAATACTGAGGAAAAAAGG + Intronic
1039287704 8:36060861-36060883 TCTATGATATTGAGGGAAAATGG + Intergenic
1040797149 8:51298924-51298946 CCCCAAATTCTAAGGGAAAATGG + Intergenic
1041276113 8:56159025-56159047 CATAAGATAATGACGGAAAAAGG + Intergenic
1042041958 8:64601411-64601433 CCAGAGGTACTGAGGGATAAAGG - Intronic
1042742192 8:72062302-72062324 ACTCAGACATTGAAGGAAAAAGG + Intronic
1045318662 8:101064811-101064833 GGTCTGATACTGGGGGAAAAAGG - Intergenic
1047103676 8:121709152-121709174 ACTCACCTACTGAGGGTAAAGGG + Intergenic
1047223245 8:122935973-122935995 CCTTAGATACTCAGGGAATAAGG - Intronic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048284791 8:133133377-133133399 CCTCAGATACCGAGTGCAAGTGG + Intronic
1048512055 8:135071946-135071968 CCTCTGATGGTGAGGGAAAAGGG - Intergenic
1048602329 8:135931312-135931334 TCACAGATACTGAGCCAAAAAGG + Intergenic
1052295578 9:26893379-26893401 CTTTAGCCACTGAGGGAAAAAGG + Intergenic
1052550401 9:29940243-29940265 CCTCACATCATGATGGAAAAGGG - Intergenic
1056040241 9:82658362-82658384 CTTCAGATACTAAGTGAAAGAGG - Intergenic
1056148439 9:83759140-83759162 CCTCAGAAGAGGAGGGAAAAGGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057241748 9:93417371-93417393 CCACAGAGACTGAGGAAAACAGG - Intergenic
1057490336 9:95515808-95515830 CCTCCCATGCTGCGGGAAAAGGG - Intronic
1057597614 9:96428666-96428688 CCTCAGTTAGTGAAGGAACAAGG + Intergenic
1057893494 9:98887680-98887702 CCATGGATACTGAGGGACAAAGG - Intergenic
1059357093 9:113708359-113708381 TCCCATATGCTGAGGGAAAAAGG - Intergenic
1059579523 9:115529198-115529220 CCTAAGAAACTGGGGGAGAAGGG - Intergenic
1059820891 9:117970815-117970837 ACTCAGATATTGAGGGAGAGGGG - Intergenic
1060130631 9:121094362-121094384 CCTGAGACACAGAGAGAAAAAGG + Intronic
1189122073 X:38405430-38405452 ACACAGACACAGAGGGAAAATGG - Intronic
1189141714 X:38613907-38613929 CCTCTGAAACTGGGGGATAAGGG - Intronic
1189943964 X:46157859-46157881 CCTCAGATCATGAGGAAGAATGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190478722 X:50853233-50853255 CCTCAGAAAGAGAAGGAAAAGGG - Intergenic
1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG + Intergenic
1199637451 X:149826864-149826886 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1199833231 X:151563909-151563931 CCTCAGCCACCGAGGGACAAAGG - Intronic