ID: 1143226037

View in Genome Browser
Species Human (GRCh38)
Location 17:5304277-5304299
Sequence CATTATAAGTAGCCATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143226036_1143226037 -8 Left 1143226036 17:5304262-5304284 CCTTTGGATGTCAAGCATTATAA 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG 0: 1
1: 0
2: 1
3: 10
4: 116
1143226035_1143226037 -7 Left 1143226035 17:5304261-5304283 CCCTTTGGATGTCAAGCATTATA 0: 1
1: 0
2: 1
3: 8
4: 193
Right 1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143226037 Original CRISPR CATTATAAGTAGCCATTGCA TGG Intronic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
908140964 1:61184238-61184260 CATTTTAAGGAGCCAGTGAAGGG + Intronic
908480038 1:64530560-64530582 CCTTTTAAGTAACCATTCCAGGG - Intronic
910019518 1:82569993-82570015 CAAAATAAGTAGCAATTGGAAGG - Intergenic
911496326 1:98636252-98636274 CATTTGAAATAGTCATTGCAGGG + Intergenic
915418828 1:155763573-155763595 CATTATAAGTACTCTTTGGAGGG - Intronic
916182282 1:162095882-162095904 CATGATAAGTAGTCTTTGAAGGG - Intronic
916486217 1:165261356-165261378 CTTTGAAAGTAGCCATTGTAAGG - Intronic
916598769 1:166272241-166272263 CATAATAAGTAGTCATGACAGGG + Intergenic
917672188 1:177283325-177283347 CATTATATTTAATCATTGCATGG + Intergenic
919447676 1:197729303-197729325 CATTATATATATCCATTGAATGG - Intronic
922126153 1:222726183-222726205 CATTATTACTTGCCATTGAAAGG - Intronic
1067765704 10:49084495-49084517 CTTTATAACTAGGCATTGGAAGG + Intronic
1067963640 10:50884936-50884958 TATAATAATTAGCCATTCCAAGG + Intronic
1068725367 10:60295012-60295034 CATTATAAGTAGTTATAACATGG + Intronic
1068761582 10:60716968-60716990 CTGTATAAGTAGCAATTGCTGGG - Intronic
1075305228 10:121361939-121361961 AATTTGAAATAGCCATTGCATGG + Intergenic
1076524215 10:131101065-131101087 CATGCTAAGTACCCATTGCCTGG - Intronic
1086230831 11:84568146-84568168 CGTGATAAGTAACCAGTGCATGG + Intronic
1088947711 11:114531550-114531572 AATTACAAGAAGCCATTGAAGGG - Intronic
1089993672 11:122884570-122884592 CATTATAAAGAGCCATGGAAAGG - Intronic
1090055503 11:123420098-123420120 CTTTAAAAGTAGCCTTTCCATGG - Intergenic
1090246436 11:125219141-125219163 AATTATAAGTAGCCCAGGCATGG + Intronic
1091341126 11:134814787-134814809 CATCATAAGTAGCCACTTCTGGG + Intergenic
1091462134 12:651609-651631 CATTAGAACTAGACATGGCAGGG + Intronic
1092752748 12:11734067-11734089 CAATAGAAGTAGCCACTGCCAGG - Intronic
1095175649 12:39089087-39089109 CTTTATAAGCAGCCCGTGCAAGG + Intergenic
1098063444 12:66586949-66586971 CAGTATAGGAAGCCATTGTAGGG - Intronic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1099525516 12:83713743-83713765 CATGATAAATAGACATGGCAAGG + Intergenic
1101281842 12:103265647-103265669 CATTAGCAGGAGCCATTCCAAGG + Intronic
1106595449 13:31131593-31131615 CTTTTTAAGTAGACATTGCCAGG - Intergenic
1107343319 13:39432816-39432838 CATAATAAGTAGCCAATACATGG + Intronic
1107759544 13:43662727-43662749 TATTAATAGTAGACATTGCATGG - Intronic
1108482132 13:50884205-50884227 ATTTAAAACTAGCCATTGCATGG + Intergenic
1109531955 13:63661595-63661617 TATTATAAGTAGAAAATGCATGG - Intergenic
1112194511 13:97212089-97212111 CATTATCAAGAGCCATAGCACGG - Intergenic
1121669552 14:95697548-95697570 CAGTAAAAGTAGCCATCTCATGG + Intergenic
1132948370 16:2545785-2545807 AATTATAATTAGCCAGTGCTGGG - Intronic
1133704848 16:8343928-8343950 CATCAAAAGTAAGCATTGCATGG - Intergenic
1135754371 16:25084083-25084105 CATTATGAATAGCCACTGCCAGG - Intergenic
1141249426 16:82341605-82341627 CATTATCTATTGCCATTGCAGGG + Intergenic
1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG + Intronic
1149173623 17:53843281-53843303 GATTATAAGAAGCCATGGGAAGG - Intergenic
1151062694 17:71114426-71114448 CATTGGAAGTAGCCATTGCAAGG - Intergenic
1153392411 18:4577822-4577844 AATTATAAGTAGCCATAGTGTGG + Intergenic
1155914248 18:31540331-31540353 CTGTATATGTAGCCATAGCATGG - Intronic
1158836829 18:61339649-61339671 CATCAGATGTATCCATTGCATGG - Intronic
931110847 2:59109929-59109951 CATTTTATGTAACCATGGCATGG + Intergenic
931567683 2:63632047-63632069 CATCATCAGTAACGATTGCAGGG - Intronic
936431543 2:112468469-112468491 CATTCTTTGTAGCTATTGCATGG - Intergenic
937208182 2:120250346-120250368 CATTCTCAGTAGCCATACCAAGG + Intronic
941279727 2:163534976-163534998 CATAATGAGAAGCCATTGGAGGG - Intergenic
943081341 2:183261767-183261789 CATCATCAGTACCCATTGCTTGG - Intergenic
943232617 2:185274625-185274647 TATTATAAGGAGCCATTGATTGG + Intergenic
943736270 2:191358716-191358738 CATTATAAGGTGCCACTGTAAGG + Intronic
1170000286 20:11607395-11607417 CATCATCTGTAGCCATTGCTTGG + Intergenic
1170464926 20:16613862-16613884 CATTTTAAGTAGCAATCACATGG - Intergenic
1172145990 20:32758888-32758910 AATTTTAAGTAAACATTGCAAGG + Intergenic
1173391179 20:42635344-42635366 GAATATAATTAACCATTGCATGG - Intronic
1173877276 20:46381956-46381978 CTTTATAACTTGCCTTTGCATGG - Intronic
1175051626 20:56160948-56160970 TATTATAGGTCACCATTGCAGGG - Intergenic
1177154568 21:17488246-17488268 CAGTATTAGTAGCCAATGGAAGG - Intergenic
1177644687 21:23886834-23886856 CAAAATAAGAAGCCATTGCTTGG - Intergenic
1182063380 22:27413646-27413668 CAATATAAGAAGCCACTGTAAGG + Intergenic
1182862363 22:33571098-33571120 AATTATTAACAGCCATTGCAAGG - Intronic
949803565 3:7930181-7930203 CATTTTAAGTAGTCATTCCAGGG + Intergenic
950961788 3:17115550-17115572 CATTTTAAGTAGACAGTTCAAGG - Intergenic
952191277 3:31025862-31025884 CATTTTAAGAAGCCATTGGAAGG - Intergenic
952701768 3:36336078-36336100 CATGATAAGTAGGGACTGCAAGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
956789861 3:72672207-72672229 CAGTATCAGTAGCCTTTGGAAGG - Intergenic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
962034193 3:131633338-131633360 CATTATAGGTACCCATTGTAAGG + Intronic
964667770 3:159192693-159192715 CATTATCAGTGGCCATTGCCTGG + Intronic
965536549 3:169829437-169829459 CATTCAAAGTAGCCATAGTAGGG + Intronic
966723200 3:183085325-183085347 CATTCTGAGTAGCCATTGGGAGG - Intronic
967683348 3:192391451-192391473 CATTATAAACAGCAGTTGCAAGG + Intronic
967764514 3:193263704-193263726 CATTGAAATTAGCAATTGCAAGG - Intronic
970428353 4:15965484-15965506 TATGATAAGTTCCCATTGCAGGG - Intronic
971012567 4:22454762-22454784 AATTATAAGTAGCAACTGTAGGG - Intronic
972847593 4:43008226-43008248 CAAGATAAATAGTCATTGCATGG + Intronic
973576675 4:52296729-52296751 CATCATAAGAAGCCCTTCCAGGG - Intergenic
974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG + Intergenic
976908857 4:90275144-90275166 CTTTATAAGTAGCCAGAACATGG + Intronic
979998840 4:127464884-127464906 CATAATTAGAAGCCATTGAAAGG + Intergenic
981350452 4:143723428-143723450 GAATATAAGAAGCCATTGTAGGG + Intergenic
982519033 4:156390012-156390034 AATTATAAGTTGCCATTGTGAGG + Intergenic
984319706 4:178177689-178177711 CATAATAAGTAGCTATTGGTGGG - Intergenic
984495518 4:180492502-180492524 CATAATAATTAGCCAGTCCATGG - Intergenic
988422680 5:31025256-31025278 TATTATAAGTATGCATTGTATGG - Intergenic
991250913 5:64560120-64560142 TATTATAAGTAGGCATTTCATGG - Intronic
992147609 5:73867769-73867791 GATTACAAGTAGTCATTGCAGGG + Intronic
992272919 5:75084139-75084161 CATTATAATTAACTATTTCAAGG - Intronic
993503667 5:88688050-88688072 ATTTATAGGTAGCCATTGCATGG + Intergenic
993530091 5:89013730-89013752 CATTCTCAGTAGACATTGCTGGG + Intergenic
994221376 5:97198924-97198946 CATTTTTATTAGCCATTGGAGGG + Intergenic
994224294 5:97234521-97234543 CATTCTAAGCAACTATTGCAAGG - Intergenic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
1004187771 6:13435675-13435697 TATTATAAAGAGTCATTGCATGG - Intronic
1005099667 6:22157101-22157123 CATTATAAAAAGCAATAGCATGG - Intergenic
1012751661 6:103171117-103171139 CATTATAAATATCCATAGAATGG - Intergenic
1013075033 6:106763714-106763736 CATTATCAGTGGTCATAGCATGG - Intergenic
1014609826 6:123527967-123527989 CATAATAAGTATTCATTGCCTGG + Intronic
1014981519 6:127951321-127951343 TATTAAAAGAGGCCATTGCAAGG - Intergenic
1016209919 6:141519040-141519062 CATTATAAGCAGGCATGGCTAGG + Intergenic
1016703282 6:147077790-147077812 TGTTACAAGTAGCCATTGCTTGG - Intergenic
1017121790 6:151030893-151030915 CATTAGAAGTTGCCCATGCAGGG + Intronic
1019318360 7:401972-401994 CTTTTTAAGGAACCATTGCACGG - Intergenic
1021266499 7:18530450-18530472 CATTAGAAGTAGCTTTAGCAAGG - Intronic
1027403022 7:77828284-77828306 CATTATAATTAGCTATTTAAAGG + Intronic
1029861643 7:103578812-103578834 CATTAGTAGTAACAATTGCAAGG - Intronic
1034068163 7:148156564-148156586 TATTATCAGAAGCCATTGGATGG - Intronic
1038387051 8:27158374-27158396 CATTATAAGTTTCCAAAGCAGGG + Intergenic
1041272591 8:56123579-56123601 TATTATAATTACCCATTACATGG - Intergenic
1043972473 8:86547008-86547030 TATTATAAGTAGCCAAGGCTTGG - Intronic
1044024633 8:87153658-87153680 AGCTATAAGTAGCCATTGAATGG - Intronic
1048921367 8:139233533-139233555 CATTATAATCAGCAATTGCCAGG - Intergenic
1054885542 9:70194047-70194069 CATCATATGTAGCAATTCCAAGG + Intronic
1055203582 9:73698009-73698031 CATTATGATTAGTCATTGCATGG + Intergenic
1187817497 X:23248646-23248668 CAATATATGTAGCAATAGCATGG + Intergenic
1190624954 X:52328145-52328167 CATGTGAAGTAGCCATTGGATGG + Intergenic
1190913838 X:54795176-54795198 CATAATAAGGAGACATGGCAAGG - Intronic
1195375041 X:104218759-104218781 CATTATAGGGAGCCATTGACAGG + Intergenic
1195540076 X:106053527-106053549 CAATATATGTATACATTGCATGG - Intergenic
1197840918 X:130745678-130745700 CTTCATAAATAGCCATTGCAGGG - Intronic
1199380295 X:147164752-147164774 AATTCAAAGTAGCTATTGCAAGG - Intergenic
1199908993 X:152264481-152264503 CTTTTTAAGTATCCATTGTATGG - Intronic