ID: 1143230576

View in Genome Browser
Species Human (GRCh38)
Location 17:5350766-5350788
Sequence ACATAACAGCTACATTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143230576 Original CRISPR ACATAACAGCTACATTTGAG GGG Intronic
904417061 1:30369494-30369516 ACATAATACCTACCCTTGAGGGG - Intergenic
906799806 1:48726848-48726870 AGATAATAGCTACCTTTCAGAGG - Intronic
907595283 1:55713881-55713903 ACATAAAAGGGACAATTGAGTGG - Intergenic
907756565 1:57316410-57316432 AAATAAAATCTTCATTTGAGGGG - Intronic
916035605 1:160919921-160919943 ACATATCAGCTAAATTTAAAGGG - Intergenic
916658121 1:166896020-166896042 ACATAAGACCCTCATTTGAGAGG - Intergenic
922382012 1:225039458-225039480 ACATAACAGATACATTTGATGGG - Intronic
923034346 1:230273825-230273847 ACATTACAGCTAAATTTAATGGG - Intronic
1062975976 10:1683018-1683040 TCATCACAGCTTCATTTGCGTGG + Intronic
1063245333 10:4212138-4212160 ACATACCAGCAACATGTGAGTGG - Intergenic
1064280025 10:13943103-13943125 ACATTACAATTACATTTGGGAGG + Intronic
1065979969 10:30884193-30884215 ACAATACAGCTTCATTTGAGTGG - Intronic
1067345708 10:45437523-45437545 ATCTAACAGCTACATATGATAGG - Intronic
1067548002 10:47209932-47209954 CCATCACAGCTGCAATTGAGAGG - Intergenic
1068193552 10:53686200-53686222 AAATAACAGTTGCATTTAAGAGG + Intergenic
1068325076 10:55474720-55474742 GCCTAACAGCTGCAATTGAGAGG - Intronic
1068626939 10:59259662-59259684 ACATTATAGGTATATTTGAGGGG + Intronic
1070087262 10:73249646-73249668 AAATCACAGCCACATTTGAATGG + Exonic
1070935376 10:80290133-80290155 ACACAACAGATTCATTTTAGAGG + Intergenic
1075516955 10:123117063-123117085 AAATAACAGCTACAGTGCAGAGG - Intergenic
1076395144 10:130132977-130132999 ATAAAACAGCCACATTTGAGGGG + Intergenic
1078890594 11:15553604-15553626 ACATAGAAGTTACATTGGAGAGG + Intergenic
1080149438 11:29032481-29032503 ACTTAACATTTACATTTCAGAGG + Intergenic
1080780483 11:35424550-35424572 AAATGACAGCGACTTTTGAGTGG - Intergenic
1081826341 11:46057084-46057106 ATATAAAAACTACAATTGAGAGG + Intronic
1082651750 11:55802700-55802722 AAATAACAGCTAAATTTGAAGGG + Intergenic
1089806471 11:121095087-121095109 ACATGACAGCTTCATGCGAGTGG - Intergenic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1094827189 12:34278805-34278827 ACACAAAATCTACATTTGATTGG + Intergenic
1099905448 12:88764672-88764694 ACCTAACAGCTGCATTTCATTGG + Intergenic
1100353218 12:93804403-93804425 ATATACCAGCTACATCTGAGGGG + Intronic
1108669412 13:52668684-52668706 ACAAAATAGGTAGATTTGAGAGG + Intronic
1110968223 13:81728220-81728242 AAATAACAGCTACATTTTGACGG + Intergenic
1111327770 13:86721806-86721828 ACATAAAAACTGAATTTGAGTGG + Intergenic
1111488323 13:88934529-88934551 ACATAACAAATTCACTTGAGAGG - Intergenic
1111780246 13:92714136-92714158 GCTTACCAGCTACATTTGATAGG + Intronic
1113053993 13:106247878-106247900 ACATAAAAGAAACAATTGAGAGG + Intergenic
1116116622 14:40660443-40660465 ACAAAACATGTACATTAGAGAGG - Intergenic
1117238120 14:53799677-53799699 AAATAAAACCTACATTTGATTGG + Intergenic
1117822007 14:59659245-59659267 ACATCAAACCTACATTTGATTGG + Intronic
1118513102 14:66498067-66498089 AAATAAGAGCTTCTTTTGAGGGG - Intergenic
1119399473 14:74352533-74352555 ACAAAAAAGCTACATTTGAAAGG - Intronic
1120356784 14:83444271-83444293 TCATAAGAGCTTCATTTGAGAGG + Intergenic
1121220169 14:92279086-92279108 ACATGATAGGGACATTTGAGAGG + Intergenic
1127245576 15:57169671-57169693 ACATTACTGCTAAACTTGAGGGG + Intronic
1131345126 15:91639561-91639583 CCACAGCAGCTACATTGGAGGGG + Intergenic
1131400404 15:92120851-92120873 ATATAAAATGTACATTTGAGAGG + Intronic
1132769946 16:1556266-1556288 ATCTAACATCTACATCTGAGGGG + Intronic
1134432120 16:14219844-14219866 AGATAAGAGCTACTTTGGAGAGG + Intronic
1135138840 16:19904753-19904775 TCATAAAACCTTCATTTGAGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1144508287 17:15852852-15852874 ACATAAGAGCTACATGGGATGGG + Intergenic
1147950820 17:44106858-44106880 ACATAAAAGCTACTTTTGGCCGG - Intronic
1148375029 17:47135486-47135508 ACATATCTGCTTTATTTGAGTGG + Intronic
1149504242 17:57180399-57180421 AAATAACATTTACATTTGGGAGG - Intergenic
1151541669 17:74767849-74767871 ACCTAAAAGCCACATTGGAGTGG + Intronic
1154069954 18:11145289-11145311 ACATAACATCTGCATTGAAGAGG + Intronic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1155906503 18:31458557-31458579 ACATAACAGCTATAGTCGACCGG + Exonic
1158716686 18:59886681-59886703 GCATAACAGCTACATAGGAGTGG + Intergenic
1160172266 18:76564912-76564934 ACCTAACATCTAGCTTTGAGAGG - Intergenic
1164606391 19:29601468-29601490 CTATATCAGGTACATTTGAGAGG - Intergenic
1167623557 19:50571927-50571949 AAATAACAGGAACATCTGAGTGG - Intergenic
926005393 2:9369598-9369620 ACAGAGCACCTGCATTTGAGTGG + Intronic
926662532 2:15483141-15483163 ACATAAAAGCAACATTTCAAAGG + Intronic
927819415 2:26249930-26249952 ATACAGCAGCTACATTTGGGTGG + Intronic
928389823 2:30900685-30900707 AAATCACAGCTGCATTTGAAAGG + Intergenic
928778991 2:34797841-34797863 AAATGAAAGCTGCATTTGAGTGG - Intergenic
930345006 2:50169279-50169301 ACACAATAGCTACAATAGAGTGG - Intronic
930353713 2:50290974-50290996 ACATTACATCCACATTTGACGGG - Intronic
930633162 2:53776410-53776432 GCATAACAGGAACATTTGATAGG - Intronic
935442269 2:103114013-103114035 TCATAAAAGTTACATTTTAGGGG + Intergenic
939538143 2:143458908-143458930 ACCAAACAGCTACATTTAAGAGG - Intronic
941246609 2:163106028-163106050 ACATAACAATTACATTTTATTGG + Intergenic
941297936 2:163763681-163763703 TCATAGTAGCTACATTTTAGTGG - Intergenic
941386535 2:164859245-164859267 AAATATGAGCAACATTTGAGGGG - Intergenic
942139471 2:172963589-172963611 ACATAACACCTATATTTCAGGGG - Intronic
942220863 2:173767770-173767792 ACATGACATTTACATTTGACTGG - Intergenic
943019061 2:182551157-182551179 AAATAATAGCTACAATTGGGGGG + Intergenic
943035151 2:182735293-182735315 ACATAACAGCAAAGTTTCAGAGG - Intronic
943394799 2:187320987-187321009 ACATAATATCTACATTTGGAAGG + Intergenic
943455417 2:188101619-188101641 ATATAACAGTTAAATTTGAGAGG + Intergenic
944149748 2:196544998-196545020 TCATAAGATCTACATGTGAGTGG + Intronic
944670123 2:201987491-201987513 ACATAGCAGCTGGCTTTGAGTGG + Intergenic
944964580 2:204915558-204915580 ACTTAACAACTAAATTTTAGAGG - Intronic
945464639 2:210153952-210153974 AACTAACAGGCACATTTGAGTGG + Exonic
945597912 2:211817827-211817849 ACATGACAGCAACATTCAAGGGG + Intronic
945662510 2:212703750-212703772 ATAAAACAGCTACTTTTGAATGG - Intergenic
1169635385 20:7685413-7685435 ACATGAGAGCTACATTTGTGTGG - Intergenic
1169635392 20:7685579-7685601 GCATGAGAGCTACATTTGTGTGG - Intergenic
1169743726 20:8921756-8921778 ACAAAACAGGTCCATTTTAGAGG - Intronic
1169901655 20:10558781-10558803 ACTTCTCAGCTACCTTTGAGGGG - Intronic
1170764054 20:19275159-19275181 GCATAGCAGCTCCTTTTGAGAGG - Intronic
1173021358 20:39270184-39270206 TCATAAGAGCTAAATTTGAATGG + Intergenic
1173337929 20:42128082-42128104 ACATAGCAGCTCCATTTGAGGGG - Intronic
1173704796 20:45101680-45101702 ACACAACAGGTACATGTGTGGGG - Intergenic
1182058496 22:27379874-27379896 GCAAAACAGCTACATTAGATGGG + Intergenic
949791224 3:7794094-7794116 ACATAGCAGGAATATTTGAGAGG + Intergenic
951107650 3:18763884-18763906 ACATTAAAGCTATAATTGAGGGG + Intergenic
951732102 3:25821621-25821643 AGATAACAGCTACACATGACAGG + Intergenic
953719844 3:45345854-45345876 ACATACCACTTACATTTAAGTGG - Intergenic
957396010 3:79639226-79639248 ATATCACAGCTAAATTTGAAAGG + Intronic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
958665093 3:97127330-97127352 AGATAAGAGCTTCATTTGAGAGG - Intronic
958888933 3:99761791-99761813 AGATAACAACTAGATATGAGAGG - Intronic
962142432 3:132804628-132804650 ACAAAACAGAAACATTTCAGTGG - Intergenic
963674830 3:148296957-148296979 TCAGAACACCTACATTTGAATGG + Intergenic
963689378 3:148479382-148479404 AGATCAAATCTACATTTGAGTGG + Intergenic
963689396 3:148479644-148479666 AGATCAAATCTACATTTGAGTGG + Intergenic
969264973 4:6058351-6058373 ATCTAACAGCTACATAGGAGGGG - Intronic
970904297 4:21197959-21197981 ATTTAACAACTTCATTTGAGGGG + Intronic
974382010 4:61153559-61153581 ACAGAAGAGCTACATTACAGAGG - Intergenic
981362122 4:143859204-143859226 AAATAAAAACTACATGTGAGGGG - Intergenic
981372858 4:143980041-143980063 AAATAAAAACTACATGTGAGGGG - Intergenic
981381947 4:144083281-144083303 AAATAAAAACTACATGTGAGGGG - Intergenic
982856380 4:160386654-160386676 ACCTATCAGCATCATTTGAGAGG + Intergenic
983021625 4:162683929-162683951 ACAAAACAGTTGCATTTTAGTGG - Intergenic
983086961 4:163457859-163457881 TAATAACAGTTAAATTTGAGAGG + Intergenic
983730282 4:170985058-170985080 TCATCACTGCCACATTTGAGAGG + Intergenic
987213948 5:15713447-15713469 AGGTAATAGCTACATTTGAGAGG - Intronic
988299033 5:29397855-29397877 AAATACCAGCAACATGTGAGTGG - Intergenic
988393287 5:30663687-30663709 ACATCACAGCTTCCTTAGAGAGG + Intergenic
989667342 5:43871025-43871047 GGATAACAGCTACCTCTGAGAGG - Intergenic
990029241 5:51236599-51236621 ACATTAAAGACACATTTGAGGGG - Intergenic
992118955 5:73571136-73571158 ACATAAGAGCTAAATTTCTGGGG - Intronic
997070576 5:130617755-130617777 ACTTAACAGCTTTATTGGAGAGG - Intergenic
997558604 5:134823432-134823454 ACATAACAGCTGTATTTGCCGGG - Intronic
998582961 5:143400325-143400347 TCAGAACAGCAACATTTGAAGGG - Exonic
999621396 5:153478291-153478313 GGCTAAAAGCTACATTTGAGGGG + Intergenic
999637840 5:153641171-153641193 ACAGGACAGCTTCATTTTAGGGG - Intronic
1005174354 6:23027088-23027110 ACAAGACAGGTACTTTTGAGAGG + Intergenic
1005409705 6:25530891-25530913 ACTTTATAGCTACATTTTAGAGG + Intronic
1005773270 6:29099295-29099317 TCATAAAAGCTACATTTGATAGG + Intergenic
1005779258 6:29171488-29171510 TCATAAAAGCTACATTTGATAGG + Intergenic
1006407511 6:33853770-33853792 ACATAAGAACTAAATTTGACTGG - Intergenic
1009502199 6:64428908-64428930 ACATAGCAGCTGCATTTATGTGG - Intronic
1009514746 6:64600905-64600927 ACATGAAAGCTACATTAGAATGG - Intronic
1009919734 6:70042725-70042747 AAGTAACAGCAGCATTTGAGAGG - Intronic
1009950890 6:70394461-70394483 ATATAACAAGTACATTGGAGAGG + Intergenic
1010110098 6:72217170-72217192 ACATAACAGCAGCATCGGAGTGG - Intronic
1012003101 6:93679296-93679318 ACATTACTGCTCCATTTGACAGG + Intergenic
1013467389 6:110429833-110429855 ACTTAACAGGTACATGAGAGAGG + Intronic
1013759721 6:113503159-113503181 ACATATCAGCAATATTTGAAAGG - Intergenic
1014978796 6:127921931-127921953 TCATATCTGCTACATTTGATTGG - Intergenic
1015042751 6:128741709-128741731 AAATAATACCTACATTTAAGTGG - Intergenic
1016668087 6:146667717-146667739 ACATAACAGCAACTTTTAATTGG + Intronic
1018331862 6:162737547-162737569 ACATAATAGAGATATTTGAGAGG + Intronic
1020001317 7:4757704-4757726 ACATAGCAGGTACATTTGTTAGG + Intronic
1020700228 7:11472767-11472789 TCAAAACAGCAACATTTGAAAGG + Intronic
1021065161 7:16164144-16164166 ACATCAAAGCTGCATTTGATTGG - Intronic
1021368157 7:19807492-19807514 TCATAACACCTACTTTTCAGAGG - Intergenic
1024200357 7:47100431-47100453 ACATAACAGGTTCCTTTGATAGG + Intergenic
1024513779 7:50225520-50225542 ACCTACCAGCTACATAAGAGTGG - Intergenic
1024869733 7:53949391-53949413 AAATAATAGCTACATGTGATTGG - Intergenic
1028057442 7:86264045-86264067 AAATAACAGCAACTTTTGAAAGG + Intergenic
1028568724 7:92262176-92262198 ATATAACAGTTACATTTAGGAGG - Intronic
1031349610 7:120713665-120713687 AGATAACAGGATCATTTGAGTGG - Intronic
1035772951 8:2163975-2163997 ACATTTCAGCCACATTTGAACGG + Intronic
1036178333 8:6561278-6561300 ACATGAAATCTACATTTGATAGG + Intronic
1036759646 8:11498563-11498585 ACAAAGCAGCCACATCTGAGTGG + Intronic
1037582608 8:20254540-20254562 ACAATCCAGCTACATTTCAGTGG + Intronic
1038891465 8:31729336-31729358 AGATAAGACCTACATGTGAGTGG - Intronic
1039298789 8:36186858-36186880 ACATAACAGCTTGATTAGTGAGG + Intergenic
1041627197 8:60043905-60043927 ACATAAAAGGTACATTAAAGAGG - Intergenic
1043190290 8:77212840-77212862 TCATAAGACCTACATTTGAGAGG + Intergenic
1044577213 8:93782937-93782959 ACATAAAAGCTTAATTTAAGTGG + Intronic
1044623883 8:94217553-94217575 AGAGAGCAGCTGCATTTGAGGGG - Intergenic
1044940960 8:97343339-97343361 TAATAACAGCCTCATTTGAGGGG - Intergenic
1045074850 8:98553150-98553172 ATACAACAGATACATTTGGGTGG + Intronic
1045872983 8:106947136-106947158 AGAGAACAGTTACATATGAGAGG - Intergenic
1046734935 8:117766786-117766808 ACATAACAGCTGGATCTAAGAGG - Intergenic
1048660351 8:136592879-136592901 AAATAACAGCAAAATTTCAGTGG + Intergenic
1050913360 9:11101948-11101970 ACATAAGAGCTAATTTTTAGAGG + Intergenic
1051813761 9:21080295-21080317 ACATAACAGACATTTTTGAGTGG - Intergenic
1052655066 9:31348495-31348517 AGATTACAGCAACAATTGAGAGG + Intergenic
1053237711 9:36470553-36470575 ACATAACAGTGACATCTAAGCGG - Intronic
1055279171 9:74654823-74654845 ACAAAACAGCAACTTTTGGGGGG + Intronic
1056035978 9:82606146-82606168 ACATAACAGTTACATATGACTGG + Intergenic
1057147534 9:92768300-92768322 AGGAAACAGCGACATTTGAGTGG + Intergenic
1057536830 9:95918262-95918284 ACATCACAGCTACACTGTAGTGG - Intronic
1058512537 9:105735987-105736009 AAATACCAGCTATTTTTGAGAGG - Intronic
1058583544 9:106483676-106483698 GCATCACAGCAACTTTTGAGAGG - Intergenic
1189039613 X:37529089-37529111 AGATCAAAGCTACATTTGACTGG - Intronic
1190429009 X:50360310-50360332 ACAGAACACCAACTTTTGAGGGG - Intergenic
1190794749 X:53730590-53730612 ACATAAAAGCTGCATTTTCGGGG - Intergenic
1190999433 X:55644910-55644932 AAATAACAGCTAGAATTGATTGG + Intergenic
1192237994 X:69308083-69308105 ACAGAACAGCCTCACTTGAGAGG + Intergenic
1193261815 X:79416600-79416622 ACATAATGGCTACATTAAAGTGG + Intergenic
1193447772 X:81625765-81625787 ACATAACAACCACATATGAGAGG + Intergenic
1195527187 X:105904489-105904511 ACATGTCAGATACTTTTGAGGGG + Intronic
1197939089 X:131770112-131770134 ACATTATAGCTTCATGTGAGTGG - Intergenic