ID: 1143237906

View in Genome Browser
Species Human (GRCh38)
Location 17:5419207-5419229
Sequence TGAGTCCCCGCGACCGCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143237901_1143237906 10 Left 1143237901 17:5419174-5419196 CCAGGCCTCCAGGCCGTAAGCAT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237903_1143237906 2 Left 1143237903 17:5419182-5419204 CCAGGCCGTAAGCATCGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237898_1143237906 18 Left 1143237898 17:5419166-5419188 CCTTCCTCCCAGGCCTCCAGGCC 0: 1
1: 1
2: 15
3: 125
4: 938
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237904_1143237906 -3 Left 1143237904 17:5419187-5419209 CCGTAAGCATCGAGAGAGCCTGA 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237896_1143237906 23 Left 1143237896 17:5419161-5419183 CCTTTCCTTCCTCCCAGGCCTCC 0: 1
1: 1
2: 38
3: 503
4: 3095
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237902_1143237906 5 Left 1143237902 17:5419179-5419201 CCTCCAGGCCGTAAGCATCGAGA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237900_1143237906 11 Left 1143237900 17:5419173-5419195 CCCAGGCCTCCAGGCCGTAAGCA 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237895_1143237906 24 Left 1143237895 17:5419160-5419182 CCCTTTCCTTCCTCCCAGGCCTC 0: 1
1: 1
2: 10
3: 149
4: 1100
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1143237899_1143237906 14 Left 1143237899 17:5419170-5419192 CCTCCCAGGCCTCCAGGCCGTAA 0: 1
1: 0
2: 0
3: 20
4: 216
Right 1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143237906 Original CRISPR TGAGTCCCCGCGACCGCGTA TGG Intronic