ID: 1143241168

View in Genome Browser
Species Human (GRCh38)
Location 17:5444456-5444478
Sequence GGAGAGTGTCCGCCGCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241168_1143241170 -10 Left 1143241168 17:5444456-5444478 CCAGGCAGCGGCGGACACTCTCC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1143241170 17:5444469-5444491 GACACTCTCCACGTCTCCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 103
1143241168_1143241172 3 Left 1143241168 17:5444456-5444478 CCAGGCAGCGGCGGACACTCTCC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1143241172 17:5444482-5444504 TCTCCTCGGGATGATGCGATTGG 0: 1
1: 0
2: 0
3: 1
4: 78
1143241168_1143241175 22 Left 1143241168 17:5444456-5444478 CCAGGCAGCGGCGGACACTCTCC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1143241175 17:5444501-5444523 TTGGCATTGACATCTGTTTCGGG 0: 1
1: 0
2: 5
3: 24
4: 272
1143241168_1143241174 21 Left 1143241168 17:5444456-5444478 CCAGGCAGCGGCGGACACTCTCC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1143241174 17:5444500-5444522 ATTGGCATTGACATCTGTTTCGG 0: 1
1: 0
2: 2
3: 18
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241168 Original CRISPR GGAGAGTGTCCGCCGCTGCC TGG (reversed) Exonic
900109098 1:998163-998185 GGGGAACGTCCGGCGCTGCCTGG + Intergenic
900158567 1:1213031-1213053 GGACACAGTCTGCCGCTGCCGGG - Exonic
900346770 1:2213950-2213972 GCTGAGTCTCCGCCGCTCCCTGG + Intergenic
900997469 1:6130245-6130267 TGACAGTGTCCGCCGTGGCCAGG + Exonic
902184389 1:14714209-14714231 GGGGAGTGTCAGCCACTACCTGG - Intronic
902385571 1:16073645-16073667 GCGCAGTGCCCGCCGCTGCCAGG + Intergenic
905137245 1:35808662-35808684 GGAAGGTGACCGGCGCTGCCGGG + Intronic
908658967 1:66417952-66417974 GGAGAGTATGAGACGCTGCCTGG - Intergenic
913186351 1:116373523-116373545 GGTGAGTGTCCGGCGCGCCCGGG + Intronic
915310030 1:155002090-155002112 GGGCAGTGTCCGCAGCGGCCAGG - Intergenic
919663482 1:200270367-200270389 AGAGAGTGTCCAACTCTGCCTGG - Intergenic
920039336 1:203085514-203085536 GGAGCGTGACCTCCGCTACCGGG - Exonic
921366937 1:214383289-214383311 GGTGAGTGTCCTCCTCTCCCAGG - Exonic
1063086715 10:2825943-2825965 GGAGAGAATCCGCAGCTGACCGG - Intergenic
1063676027 10:8141249-8141271 GGAGAGTGGCCTCCGCTGGTGGG + Intergenic
1064061494 10:12141219-12141241 GAAGAGTGTCTACAGCTGCCAGG + Intronic
1064348676 10:14556844-14556866 GGGGAGTGAGGGCCGCTGCCAGG - Intronic
1069862350 10:71479670-71479692 GGTGAGGGTCTGCCCCTGCCAGG + Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1072227029 10:93379883-93379905 GGAGAGTGTTCACCGCATCCAGG + Exonic
1075048618 10:119165658-119165680 TTAGAGTGGCCGCCGCCGCCAGG + Exonic
1075249298 10:120851360-120851382 GCACAGTGTCCGCCGCTTCCTGG + Exonic
1075297636 10:121292166-121292188 GGTCAGTGTCCACCTCTGCCTGG + Intergenic
1076993950 11:289378-289400 GGAGGGAGTCCGGGGCTGCCGGG - Intronic
1078946143 11:16070772-16070794 GGAGAGTGTGCCCCCCCGCCAGG - Intronic
1079217502 11:18526848-18526870 GCAGAGGGTCAGCCGCTGCTGGG + Exonic
1079294726 11:19222665-19222687 GGACAGTGTCCAGAGCTGCCTGG + Intergenic
1080749523 11:35139370-35139392 GGTGAGTGCCCGCCGCAGCCTGG + Exonic
1084457027 11:69273797-69273819 GGAGAGGGTCCTTTGCTGCCTGG - Intergenic
1085260065 11:75199548-75199570 GGGAAGTGTCTGCAGCTGCCAGG + Intronic
1090878541 11:130813212-130813234 TGAGAGTGTCCTCCGCTCCATGG + Intergenic
1091634053 12:2183985-2184007 GGAGAGGGCCAGCCTCTGCCTGG + Intronic
1093208239 12:16277303-16277325 GGTGAGTGTCCTCTGCTGACTGG - Exonic
1097895907 12:64824771-64824793 GGTGAGTGTCTGCGGCTGACCGG - Exonic
1103954479 12:124568538-124568560 GGAGAGTGTCTGCCTGTGCGTGG - Intergenic
1104796777 12:131525861-131525883 GGACAGCGGCCGCCGCTGCTGGG - Intergenic
1106563980 13:30869999-30870021 GGAAAGTGTCTGCCTCTGACTGG - Intergenic
1113834067 13:113317249-113317271 GGAGAGTGCCCTGCGCTGCCCGG - Intronic
1115754215 14:36517411-36517433 GGAGACTGGCCTGCGCTGCCTGG + Exonic
1117885486 14:60357086-60357108 GGTGACTGACCGCCGCTGCTTGG + Intergenic
1121050708 14:90817093-90817115 TGAGAGTGGCAGCCCCTGCCTGG - Intergenic
1122847222 14:104506520-104506542 GGAGAGTGTCTGGAGGTGCCTGG - Intronic
1129853909 15:78811099-78811121 GGTGGGTGTCCGCCCCTCCCCGG - Exonic
1130546408 15:84859903-84859925 GGTGAGTGTGCCCCGCGGCCCGG + Exonic
1131849671 15:96525369-96525391 TGAGAGTGTCCGGCTCTGCATGG + Intergenic
1133209999 16:4258156-4258178 GAAGCCTGTCCGCAGCTGCCCGG - Exonic
1141604858 16:85146936-85146958 GGAGAGTCACTGCAGCTGCCAGG + Intergenic
1142305702 16:89283698-89283720 GGAGAGAGTCCGCAGAGGCCGGG - Exonic
1143088791 17:4436202-4436224 GGAGGGTGCCTGCAGCTGCCAGG + Intronic
1143149806 17:4800860-4800882 GCCGAGTGTCCACCCCTGCCAGG - Intergenic
1143241168 17:5444456-5444478 GGAGAGTGTCCGCCGCTGCCTGG - Exonic
1144541346 17:16145646-16145668 GGAGCGTCTCCGCCCCTTCCGGG + Intronic
1147719805 17:42532122-42532144 GGAGAGGCGCCGCCGCCGCCGGG + Intergenic
1148246055 17:46031671-46031693 GGGGAAGGTCCGCCGCTCCCAGG + Exonic
1148503215 17:48107564-48107586 GGAGAGTGCACGCAGGTGCCGGG - Exonic
1148586641 17:48785945-48785967 GGTGAGAGTCCTCTGCTGCCTGG + Intronic
1148777418 17:50103387-50103409 GGAGAGTATCAGATGCTGCCTGG + Intronic
1151494998 17:74453852-74453874 GGAGAGGGTCCGCGGGGGCCCGG + Intergenic
1152376657 17:79922164-79922186 GGAGAGCTCCTGCCGCTGCCAGG + Intergenic
1152748299 17:82051272-82051294 GGTGAGTGTCCCCCACTCCCCGG - Exonic
1154466176 18:14643917-14643939 GGAGAGTGTCTGCAGGGGCCAGG + Intergenic
1156036622 18:32772131-32772153 GGAGAGCCGCCGCCGCCGCCCGG + Exonic
1157248164 18:46071730-46071752 GGAGAGTCTCTGCCGGTCCCTGG - Intronic
1158836173 18:61333806-61333828 GGAGAGTCGCCGGCGGTGCCAGG + Exonic
1160062344 18:75544001-75544023 GGCAAATGTCCGCCGCTGCTAGG + Intergenic
1160518925 18:79493564-79493586 GGAGCGTGTCCGCCGCAGTCTGG + Intronic
1161041129 19:2111263-2111285 GGTGAGTGGCAGCCGCTCCCAGG - Exonic
1161183420 19:2900603-2900625 CGGGAGTGTCCACCGCTGGCGGG + Intergenic
1162456197 19:10786494-10786516 GGAGTGTGTCTGCCACTCCCTGG + Intronic
1163315334 19:16537188-16537210 TGAGGGTGTCCTCAGCTGCCTGG - Intronic
1167767454 19:51492955-51492977 GGAGAGTGACAGAGGCTGCCTGG + Intronic
925027396 2:620807-620829 TGAGAGAGGCCGCAGCTGCCCGG + Intergenic
926592712 2:14757205-14757227 TGAGGGTGTCTGCAGCTGCCTGG + Intergenic
930705563 2:54501760-54501782 GGAGAGTTACCACCCCTGCCTGG + Intronic
941987614 2:171523550-171523572 GGAGAGGGCCCGCGGCTGCCTGG + Intronic
943646142 2:190408890-190408912 GGAGGGTGAGCGCCGATGCCCGG + Intronic
948530397 2:238600230-238600252 GGACAGCGTCCTCCTCTGCCTGG + Intergenic
1168958950 20:1855208-1855230 GGAGAGCCTCCGCTCCTGCCTGG + Intergenic
1171488686 20:25501475-25501497 GGGGTGTGTGCGCCTCTGCCTGG - Intronic
1172755837 20:37283745-37283767 GGCGAGTCTCCACTGCTGCCTGG + Intergenic
1173388766 20:42612427-42612449 GGGGAGTCTCAGCTGCTGCCTGG - Intronic
1173488386 20:43458179-43458201 GGAGAGTTCCCGCCGCCACCAGG - Intronic
1176288018 21:5029032-5029054 GGAGAAGGTCCGGCTCTGCCGGG - Intronic
1176808410 21:13514679-13514701 GGAGAGTGTCTGCGGGGGCCAGG - Intergenic
1176952597 21:15064723-15064745 GGTGAGTGACGGCCGCGGCCAGG - Exonic
1179516030 21:41907631-41907653 CGAGGCTGTCCGCCGCGGCCGGG - Intronic
1179869163 21:44234443-44234465 GGAGAAGGTCCGGCTCTGCCGGG + Intronic
1182088062 22:27575025-27575047 AGAGAGTGGCGGCCACTGCCTGG - Intergenic
1182430100 22:30294224-30294246 GCAGGGTGTCTGCCTCTGCCAGG + Intronic
1182554662 22:31122779-31122801 GGAGAGTGTACCCATCTGCCTGG - Intronic
1184419172 22:44369603-44369625 GGAGACTGCCAGCCCCTGCCTGG + Intergenic
1184474221 22:44711888-44711910 GGAGGGTGTCTGCAGCTGCCAGG + Intronic
950152199 3:10696522-10696544 GCAGGGTTTCCGCAGCTGCCTGG + Intronic
950835947 3:15919096-15919118 GGAGAGAGCCCGCTCCTGCCTGG + Intergenic
953069539 3:39505662-39505684 GGAGTGTGACAGCCTCTGCCTGG + Intronic
954553240 3:51499566-51499588 GGGGTGTGTCCGCCCCTACCTGG - Intronic
955060533 3:55488602-55488624 GGAGAGTGTACCCCGCCTCCCGG - Intronic
961566106 3:127764185-127764207 GGAGAGTGTGTGCCCCTCCCAGG - Intronic
962714405 3:138114726-138114748 GGAGGGGGTCCGAGGCTGCCTGG - Intronic
968627239 4:1631479-1631501 GGAGTGTGTCCCCCGCTGCCTGG + Intronic
968817588 4:2829800-2829822 GGAGAGTGCCAGCCCCAGCCCGG + Exonic
969592592 4:8130450-8130472 GGAGAGTGGACGCCGGCGCCGGG + Intronic
975798980 4:78038889-78038911 GGAGACTGTCAGCCTCTGCTGGG - Intergenic
987429016 5:17808813-17808835 GGAGAGTGTATGCAGCTGACTGG + Intergenic
990194228 5:53294932-53294954 GGAGAGTGGCCACAGTTGCCTGG - Intergenic
999264354 5:150256744-150256766 GGTGAGTGTCAGGTGCTGCCTGG - Exonic
1001562229 5:172677296-172677318 GGAGCGAGACCGCCGCTGCATGG + Intronic
1002804794 6:562201-562223 GGGATGTGTCGGCCGCTGCCTGG + Intronic
1003071482 6:2948561-2948583 GGAGAGTGTCCTGCGCAACCTGG - Exonic
1003127717 6:3368804-3368826 GGAAAGAGGACGCCGCTGCCTGG - Intronic
1007398812 6:41592077-41592099 AGAGAGTGTTCGCCCCTGCAGGG + Intronic
1007681940 6:43640101-43640123 GGAGAGTGTCCTCAGCCACCTGG + Exonic
1009392843 6:63164309-63164331 GGGAAGTGTGCGCCTCTGCCCGG + Intergenic
1016658082 6:146543774-146543796 GGGGAGTTTCCGCGGCCGCCGGG + Exonic
1018613017 6:165662078-165662100 GGAGTTTGGCCGCCGCCGCCTGG + Intronic
1019387179 7:763838-763860 GGAGGGTGTCAGCAGCTGCCAGG + Exonic
1019402776 7:866067-866089 GGTGAGTGGCCGCCGGTGGCCGG + Exonic
1019728612 7:2617282-2617304 GGACAGAGTCCAGCGCTGCCAGG + Intergenic
1019888298 7:3924529-3924551 GGAGAATGACCGATGCTGCCAGG + Intronic
1023773665 7:43583262-43583284 GGGGAGGAGCCGCCGCTGCCTGG - Exonic
1024022822 7:45387094-45387116 GGAGGGGGTCGGCAGCTGCCCGG + Intergenic
1030176433 7:106660203-106660225 GGTGAGGCTCCGCCGCTTCCCGG - Exonic
1030262512 7:107580345-107580367 GGAGGGAGAGCGCCGCTGCCTGG + Intronic
1033433141 7:141307422-141307444 AGTGAGTGGCAGCCGCTGCCAGG - Intronic
1034129060 7:148699029-148699051 GGTGAGTGTCGGCAGCCGCCGGG + Exonic
1035312180 7:157976360-157976382 GGAGAGTGCCAGCCGGTGCTAGG - Intronic
1035468683 7:159096226-159096248 GGAGAGTTTCAACCCCTGCCTGG + Intronic
1036307318 8:7611625-7611647 GGGGAGGACCCGCCGCTGCCAGG + Intergenic
1036358162 8:8059609-8059631 GGGGAGGACCCGCCGCTGCCGGG + Intergenic
1037116732 8:15236970-15236992 GGAGAGGTACCCCCGCTGCCGGG - Intronic
1037260453 8:17001920-17001942 GGGGAGCGGCCGCCGCTGCTGGG - Exonic
1038443540 8:27587547-27587569 AGAGACTGTCCCCAGCTGCCAGG - Intergenic
1039022526 8:33223553-33223575 GGAGAGTGTCAGGCAATGCCGGG + Intergenic
1047452051 8:124973505-124973527 AGAGAGTTCCCGCTGCTGCCAGG + Intronic
1048866947 8:138768242-138768264 GGGGAGGGTCCCCTGCTGCCAGG - Intronic
1049605721 8:143528360-143528382 GGAGGGTGTCTGTCGCTGCCTGG - Intronic
1060821268 9:126662750-126662772 CGAGAGCGGCCACCGCTGCCGGG + Intronic
1061141294 9:128768756-128768778 GGAAAGTCTCAGCCTCTGCCGGG + Intronic
1190324861 X:49200109-49200131 GGACAGAGCCCGCCGCCGCCCGG - Intronic
1196828587 X:119759214-119759236 GGCGTGAGGCCGCCGCTGCCTGG - Exonic