ID: 1143241209

View in Genome Browser
Species Human (GRCh38)
Location 17:5444695-5444717
Sequence TGGTCCGTGCTCCTCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241222 19 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440
1143241209_1143241215 9 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49
1143241209_1143241217 14 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1143241209_1143241219 15 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143241209_1143241223 22 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241209_1143241221 18 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340
1143241209_1143241216 10 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
1143241209_1143241214 5 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241209 Original CRISPR TGGTCCGTGCTCCTCCAGCT GGG (reversed) Intronic