ID: 1143241209

View in Genome Browser
Species Human (GRCh38)
Location 17:5444695-5444717
Sequence TGGTCCGTGCTCCTCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241223 22 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241209_1143241219 15 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143241209_1143241214 5 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 63
1143241209_1143241217 14 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1143241209_1143241216 10 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
1143241209_1143241215 9 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49
1143241209_1143241222 19 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440
1143241209_1143241221 18 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241209 Original CRISPR TGGTCCGTGCTCCTCCAGCT GGG (reversed) Intronic
900089790 1:915044-915066 AGGTCCGTGGTCCACCAGCCAGG + Intergenic
902780409 1:18701143-18701165 TGGTCCATGCTCCACCAGCTTGG - Intronic
911241457 1:95471601-95471623 TGGGCCATTCTCCTCCGGCTAGG + Intergenic
912345491 1:108959764-108959786 TGGTCCCTGTTACTCCATCTTGG - Intronic
913319792 1:117580199-117580221 TGGACCCTGCTCCTCCAGCCTGG + Intergenic
915549174 1:156622674-156622696 TGCTCCCTGCACCTCCAGCATGG - Intronic
917931603 1:179826361-179826383 TGGTCAGTGCTCCGCTTGCTGGG - Intergenic
921626324 1:217380847-217380869 TAGTACATGCTCCTTCAGCTTGG - Intergenic
921722381 1:218487559-218487581 TGATCCGTGATCCGCCACCTTGG - Intergenic
924797057 1:247300210-247300232 TGGCCCATGCTCCCCAAGCTCGG - Exonic
1065887913 10:30095027-30095049 TGGCCGGTGCACCTCCAGCTAGG + Intronic
1066298249 10:34074973-34074995 TTCTCCCTGCTCCTGCAGCTAGG + Intergenic
1067076886 10:43192946-43192968 TTGTCCAAGCTTCTCCAGCTGGG + Intergenic
1067077265 10:43195217-43195239 TGGAGTGTGCTCCTCTAGCTGGG + Exonic
1067097468 10:43311887-43311909 TGGTCCCAGCTACTCCTGCTTGG + Intergenic
1073423372 10:103441737-103441759 GAGTCCATGCTCCTCCAGGTGGG + Intronic
1073445576 10:103578415-103578437 AGATCTGTGCTTCTCCAGCTGGG + Intronic
1074471326 10:113729368-113729390 TTTTCCGTGCTCCTCCAGGATGG - Exonic
1075946232 10:126435629-126435651 AGGTCTGGGATCCTCCAGCTGGG - Intronic
1076187668 10:128461707-128461729 TGCTCTGTGCTCCTCCCTCTGGG + Intergenic
1076581668 10:131516314-131516336 TAGCCCGTGCCCCCCCAGCTTGG + Intergenic
1078269260 11:9779876-9779898 TGGTCCGTGCTCTGCCAGTGGGG - Exonic
1082205197 11:49425139-49425161 TGGTCCTAGCTCTGCCAGCTGGG - Intergenic
1083163043 11:60867439-60867461 AGGTGGGTGCTCCTCCAGGTGGG + Intergenic
1083310227 11:61780127-61780149 TGGTCCTTGCTCCTGAGGCTGGG - Intronic
1083763564 11:64831736-64831758 TGGTCCACGGCCCTCCAGCTGGG - Intronic
1084706761 11:70820295-70820317 GGGTCCCAGCTCCTCCAACTTGG - Intronic
1089639682 11:119839463-119839485 TGGTGCGTGCACCGCCAGTTGGG - Intergenic
1090689634 11:129165344-129165366 TTTTCAGTGCTCCTCCATCTTGG - Intronic
1092527253 12:9316820-9316842 TGTGACGTGCTCCTCCTGCTTGG - Intergenic
1092540020 12:9414953-9414975 TGTGACGTGCTCCTCCTGCTTGG + Intergenic
1093069744 12:14696396-14696418 TGGTCACTGCTCTTCCAGCCCGG - Exonic
1094513016 12:31107511-31107533 TGTGACGTGCTCCTCCTGCTTGG - Intergenic
1098264711 12:68706690-68706712 TGGCCCGCCCACCTCCAGCTTGG - Intronic
1098295485 12:68999918-68999940 TGGTCCATGAACCTCCAGCATGG - Intergenic
1101568463 12:105931803-105931825 TTGTCCGTGCTCATATAGCTTGG - Intergenic
1103704622 12:122864702-122864724 TGAGCCGTGCGCCTGCAGCTAGG - Intergenic
1103733404 12:123043330-123043352 TGGTCCTTGCCCTTCCAGCCTGG - Intronic
1104946066 12:132415391-132415413 GGGACCGGGCTTCTCCAGCTGGG - Intergenic
1105628811 13:22140723-22140745 TGGTCCATGCACCTGAAGCTTGG + Intergenic
1110657933 13:78022749-78022771 TGGTCCTTGCTCTCACAGCTAGG + Intergenic
1114837029 14:26214987-26215009 TGCTCCCTGCTCCTTCAGCTGGG + Intergenic
1115814928 14:37153498-37153520 GGGTGGGTGCTCCTACAGCTGGG + Intronic
1118256352 14:64209266-64209288 TTGTCTGTGCTCCTCCTGCCTGG - Intronic
1121091177 14:91183919-91183941 TGGGCCGTGCTCCTAAACCTGGG + Intronic
1122810453 14:104285149-104285171 TGGAAAGTGCTCCTCCAGCAAGG + Intergenic
1122816192 14:104315331-104315353 TGGACCGGGCTCCTCCTGCAGGG + Intergenic
1125526283 15:40377369-40377391 TGGCCCCTGCTCCTCCATCTTGG - Intergenic
1132234050 15:100205985-100206007 TGATCCCTGCTCCTCCCTCTGGG + Intronic
1132718586 16:1304537-1304559 TGGTTCCTGCCCCTCCAGCCCGG - Intergenic
1132910258 16:2306614-2306636 TGGTCTGAGCCCCTCCAGTTAGG - Intronic
1133036885 16:3038567-3038589 GGGTCCGTGCACCTCTGGCTGGG + Intergenic
1137971051 16:52985415-52985437 TGGTCCCAGCTACTCCAGGTGGG - Intergenic
1142246989 16:88974776-88974798 TGGCCCCCGCTCCTCCAGCCAGG + Intronic
1143241209 17:5444695-5444717 TGGTCCGTGCTCCTCCAGCTGGG - Intronic
1147595655 17:41715570-41715592 TGGGCCCTGCTGCTCCAGCCAGG - Exonic
1147659402 17:42109312-42109334 TTGGCTGTGCTCCTGCAGCTGGG + Exonic
1148437156 17:47693948-47693970 TGCTCCGGGTTTCTCCAGCTGGG - Intergenic
1148791172 17:50173825-50173847 TGGGCCATGCTCCTCCTGCGGGG - Intronic
1152608463 17:81304438-81304460 TGGACCTTGTTCCTGCAGCTCGG + Intergenic
1152744316 17:82031973-82031995 GGGTCCGCGGGCCTCCAGCTCGG + Intronic
1152899318 17:82930949-82930971 TTGTGGGAGCTCCTCCAGCTTGG + Intronic
1153331458 18:3879452-3879474 TCGTCCGAGCTCCACCAGCCCGG + Exonic
1155396617 18:25393089-25393111 TGGTCCCTGTTACTCCATCTAGG - Intergenic
1155512774 18:26594180-26594202 TGCTCCTTCCTCCTCCTGCTAGG + Intronic
1156383089 18:36581634-36581656 TGGCCAGGGCTCCTCCAGATAGG - Intronic
1156412093 18:36840316-36840338 TGGTCCCTGTTACTCCATCTGGG + Intronic
1157153585 18:45243393-45243415 TGGTCCATGTTCACCCAGCTTGG + Intronic
1161099877 19:2416324-2416346 TTGTCCGAGGTCCCCCAGCTTGG + Intronic
1164443907 19:28300905-28300927 TGCTCCGAGCTCTTCCTGCTGGG - Intergenic
1165986077 19:39770028-39770050 TGGGCCATGGTACTCCAGCTTGG + Intergenic
926911314 2:17853976-17853998 TGGTCAGCGCTCCTCCAACAGGG + Intergenic
927312618 2:21648152-21648174 TGCTACGTGCTCCTCCCTCTTGG + Intergenic
927520204 2:23693818-23693840 AGGTATGGGCTCCTCCAGCTGGG - Intronic
930156513 2:48112187-48112209 AGATCCTTGCTCCTCCAGCCCGG + Intergenic
930867452 2:56135961-56135983 TGTTCCTTGCTGCTCCATCTAGG + Intergenic
931264876 2:60651931-60651953 TGTTCCGTGCAGCACCAGCTGGG + Intergenic
934545007 2:95207378-95207400 TGGTCAGCGCTCCTCCAGGTCGG + Intergenic
937143276 2:119619791-119619813 TGGTACATGCTCCTTTAGCTTGG - Intronic
938271509 2:129976078-129976100 ATGTCTGTTCTCCTCCAGCTGGG - Intergenic
938365450 2:130729726-130729748 AGCTCCTTGCTCCTCCAGCTGGG - Exonic
939004141 2:136766026-136766048 TGTTCCCTTCACCTCCAGCTTGG + Intronic
946530421 2:220564367-220564389 TGCTCAGTGCTCCTCCTGCATGG + Intergenic
946758048 2:222966000-222966022 TTGTCCGTGCTCCTCCCCTTGGG - Intergenic
948158448 2:235803539-235803561 TGGATAGTGCCCCTCCAGCTGGG - Intronic
948910612 2:241000480-241000502 TGGACAGGCCTCCTCCAGCTCGG - Intronic
1169227711 20:3866477-3866499 TGGTCCCTCCTGCTCCACCTGGG - Exonic
1173945857 20:46950499-46950521 TGTTCCCTGCTCCTCCTTCTGGG + Intronic
1176091907 20:63321993-63322015 TGGTCTTTGCTCCTCTACCTTGG + Intronic
1177356720 21:20018386-20018408 TGTCCAGGGCTCCTCCAGCTTGG + Intergenic
1179591953 21:42414856-42414878 AGGTCCCTGCTCCGCCAGCCTGG - Intronic
1179878110 21:44281719-44281741 TGGGCCCTGCTCCTGCAGCCTGG - Intergenic
954462157 3:50633545-50633567 TGGCCAGTGCTGCTCCAACTTGG + Intronic
961392099 3:126558296-126558318 TGGCCTGTGCTCCTCCTGCTGGG + Intronic
962854552 3:139332023-139332045 TGGTCCCTGTTCCTCTATCTTGG - Intronic
964309951 3:155381920-155381942 TGGTCCGTCGTCCTCCAGTAAGG + Intronic
966927966 3:184657914-184657936 TGGTCCCTGCTGATCCAGGTTGG + Intronic
966984972 3:185171924-185171946 TGGCCCCTCCTTCTCCAGCTTGG + Intergenic
968574933 4:1361224-1361246 TGGTCCTGGCCCCTGCAGCTGGG + Intronic
968934204 4:3601493-3601515 TGGTCAGTGCTCCAGCAGCCGGG - Intergenic
974024357 4:56720132-56720154 TGGTCCCAGCTCCTCTTGCTGGG - Intergenic
978150418 4:105427400-105427422 TAGAACGTGCTCCTCTAGCTCGG - Intronic
983543438 4:168936485-168936507 TAGAACGTGCTCCTTCAGCTCGG - Intronic
998808044 5:145937886-145937908 TGGACGCTGCTCCTCCAGGTGGG + Exonic
999462619 5:151770667-151770689 GCGCCCGTGCTCCTTCAGCTCGG + Exonic
1004216732 6:13711145-13711167 GGGTCGGGGCTCCTCCAGCCGGG + Exonic
1007308996 6:40930151-40930173 TGGTCTGTGTTCCTCCCTCTTGG + Intergenic
1011125618 6:84003991-84004013 TGGTACAGACTCCTCCAGCTGGG + Intergenic
1018762529 6:166904333-166904355 TGGCCGGTGTTCCTCCAGCGTGG - Intronic
1020059822 7:5143888-5143910 AGCTCCGTGCTCCCCCAGATCGG + Intergenic
1020168147 7:5823863-5823885 AGCTCCGTGCTCCCCCAGATCGG - Intergenic
1020281137 7:6650656-6650678 TGGTCCAGGCTTATCCAGCTAGG + Intronic
1020651397 7:10880963-10880985 TTGCCCTTGCTGCTCCAGCTGGG + Intergenic
1023351517 7:39324456-39324478 TAGTAGGTGCTCCACCAGCTTGG + Intronic
1024308887 7:47950933-47950955 TGGGCCATACTCCTCCACCTGGG + Intronic
1025220033 7:57099516-57099538 AGGGCAGGGCTCCTCCAGCTGGG + Intergenic
1025651659 7:63475518-63475540 AGGGCAGGGCTCCTCCAGCTGGG - Intergenic
1029321482 7:99764684-99764706 TAATCCGTGCTTCTCAAGCTAGG - Intronic
1032799480 7:135306849-135306871 TGGTTCGTGTTCCTGCGGCTTGG + Intergenic
1033925380 7:146452795-146452817 TGGTCCCTGCTACTCCACCTTGG - Intronic
1034610879 7:152367298-152367320 AGGTCAGGGCTCCTCCAGCTGGG - Intronic
1036711416 8:11081886-11081908 TGGTCCTTGCCCCTCGAGGTGGG + Intronic
1037717373 8:21411732-21411754 TGTCCCCAGCTCCTCCAGCTGGG - Intergenic
1041685833 8:60643917-60643939 GGGACTGGGCTCCTCCAGCTTGG + Intergenic
1047213226 8:122856659-122856681 TGGCCTGTGCTCCTCCTGCCAGG - Intronic
1053503450 9:38621048-38621070 TAGGCCGTGCTCCACCACCTGGG - Intergenic
1060497192 9:124127339-124127361 TGGTCTGGGCTTCCCCAGCTGGG - Intergenic
1061274381 9:129561170-129561192 TGGTCTGGGTTCCCCCAGCTGGG + Intergenic
1061700620 9:132412247-132412269 GGGTCCCTGCTGCTCCAGCATGG - Intronic
1061726491 9:132584784-132584806 TGGTCCTTGCTCCTCCCCCGGGG + Intronic
1062587128 9:137254477-137254499 TGGAGCGATCTCCTCCAGCTGGG + Intergenic
1188446655 X:30259746-30259768 TGGTCCCTGTTACTCCATCTTGG + Intergenic
1191830126 X:65407264-65407286 TGGCCGCTGCTCCTCGAGCTCGG - Intronic
1196969198 X:121090413-121090435 TGGTCCCTGTTACTCCATCTTGG + Intergenic
1199540385 X:148952229-148952251 AGGTCTGTGCTCCTTGAGCTGGG + Intronic
1199892891 X:152105050-152105072 AGGTCCCTGTTCCTCCATCTTGG - Intergenic