ID: 1143241210

View in Genome Browser
Species Human (GRCh38)
Location 17:5444696-5444718
Sequence CTGGTCCGTGCTCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241210_1143241223 21 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241210_1143241217 13 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1143241210_1143241215 8 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49
1143241210_1143241222 18 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440
1143241210_1143241219 14 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143241210_1143241216 9 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
1143241210_1143241214 4 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 63
1143241210_1143241221 17 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241210 Original CRISPR CTGGTCCGTGCTCCTCCAGC TGG (reversed) Intronic
900161608 1:1226780-1226802 CTGCTCGGTGCGTCTCCAGCTGG - Intronic
900166578 1:1246437-1246459 CTGGGGCGTCCTCCCCCAGCAGG - Intronic
904377060 1:30088311-30088333 CTGGTCCCTGCTCCTTCTGCAGG + Intergenic
907701672 1:56794278-56794300 CTGCTCCATGCTCTTCCTGCTGG + Intronic
910739663 1:90501232-90501254 ATGGTCAGTTTTCCTCCAGCTGG + Intergenic
911206582 1:95097521-95097543 CTTTTCCTGGCTCCTCCAGCTGG - Intergenic
912121241 1:106474223-106474245 CTGGACAGTGCTCCTCCTGGGGG - Intergenic
914955591 1:152159183-152159205 CTGCTCCTTCCTCCTCAAGCAGG - Exonic
915238342 1:154502073-154502095 CTGCTCCGTGCGCCCCCGGCCGG + Exonic
919977792 1:202623798-202623820 CTGGTGAGCGCTCCCCCAGCTGG - Intronic
920060177 1:203222020-203222042 CTGGTCCGTGCCCCTGCTGAGGG - Intronic
1063304315 10:4882895-4882917 CTGCTTTGGGCTCCTCCAGCCGG + Intergenic
1064299678 10:14112339-14112361 CTCCTCTGTGCTCCTCCATCAGG - Intronic
1066038050 10:31513623-31513645 CTGCTTCATGCTCTTCCAGCTGG - Intronic
1067076885 10:43192945-43192967 CTTGTCCAAGCTTCTCCAGCTGG + Intergenic
1067730843 10:48810566-48810588 CTGGTTCCTGCTGCTCCTGCAGG + Exonic
1067853276 10:49768863-49768885 CCGGTCCGCGCTCCTCCAGCAGG + Intergenic
1069833575 10:71295204-71295226 CTGGGAAGTGCTCCTGCAGCTGG + Intronic
1070834941 10:79442303-79442325 CTGGTGCTTGCTCCTGCACCAGG + Intronic
1074676748 10:115859798-115859820 CTGGCACTTGCTCCTCCACCAGG - Intronic
1075551535 10:123396111-123396133 CTGGTCACTGCTCCTTCACCTGG - Intergenic
1076541116 10:131215544-131215566 CTGGGGTCTGCTCCTCCAGCCGG - Intronic
1076697981 10:132256263-132256285 CTGGTGCCTACACCTCCAGCAGG + Intronic
1077089060 11:770115-770137 CTGGGCTGTGGCCCTCCAGCGGG - Exonic
1078269261 11:9779877-9779899 ATGGTCCGTGCTCTGCCAGTGGG - Exonic
1082205198 11:49425140-49425162 CTGGTCCTAGCTCTGCCAGCTGG - Intergenic
1083163042 11:60867438-60867460 CAGGTGGGTGCTCCTCCAGGTGG + Intergenic
1083763565 11:64831737-64831759 CTGGTCCACGGCCCTCCAGCTGG - Intronic
1084697045 11:70761952-70761974 CTGGGCAGTGTTGCTCCAGCTGG - Intronic
1085284612 11:75351667-75351689 CTGGCCCGCGCTCCTCCTGCTGG - Exonic
1087095432 11:94313373-94313395 GTGCTCAGTGCTCCTCCATCAGG - Intergenic
1088757554 11:112898615-112898637 ATGGTCCCTCATCCTCCAGCAGG - Intergenic
1090902426 11:131044679-131044701 CTGGCCCCTGCCCCTCCAGGTGG - Intergenic
1091204262 11:133808752-133808774 CTGGCCAGTGCTCCTCCCACTGG - Intergenic
1091358833 11:134958364-134958386 CTGGGCCTGGCTGCTCCAGCGGG + Intergenic
1091391656 12:129761-129783 CTGGGCCCTGCTCCCCGAGCCGG + Intronic
1091599864 12:1911627-1911649 CCGGTCCCTGCGCCTCCTGCGGG - Intronic
1096430254 12:51537388-51537410 CAGGTCTGTGCTGCTGCAGCTGG - Intergenic
1103209573 12:119156686-119156708 CTAGTCCGGGCTCCCGCAGCCGG + Exonic
1103415186 12:120738496-120738518 CTGGTCAGTGGCCCGCCAGCCGG - Intronic
1103851914 12:123938890-123938912 CCCCTCCCTGCTCCTCCAGCCGG + Intronic
1104858838 12:131914357-131914379 CTGGCCCGTTCTCCAGCAGCAGG + Exonic
1108688652 13:52843605-52843627 CTGGTACCTCCTCCTCAAGCTGG - Exonic
1112843283 13:103606367-103606389 CTGCTCCTGGCCCCTCCAGCAGG + Intergenic
1114837028 14:26214986-26215008 TTGCTCCCTGCTCCTTCAGCTGG + Intergenic
1121715129 14:96068402-96068424 GTGCTCCGTGCCCGTCCAGCGGG + Intronic
1121718684 14:96094538-96094560 CTGGTCTCTCCTCATCCAGCAGG - Intergenic
1121874630 14:97440099-97440121 TTGGGACGTGCCCCTCCAGCAGG + Intergenic
1122153878 14:99738829-99738851 CAGGTCTGGCCTCCTCCAGCAGG + Intronic
1122804205 14:104248406-104248428 CTGGTCCGTGCCCCTCTTGGGGG + Intergenic
1122816191 14:104315330-104315352 CTGGACCGGGCTCCTCCTGCAGG + Intergenic
1123030027 14:105447225-105447247 CTGGGCACTGCTTCTCCAGCGGG - Intronic
1126167463 15:45666030-45666052 CTGGTCCTTGCTCCTTCTCCAGG + Intronic
1128998268 15:72312767-72312789 CTTGTCCCTGCTTCTCCAGCAGG + Intronic
1130605029 15:85307883-85307905 CTGGAGGGTGCTCCTCCAGTAGG - Intergenic
1131580957 15:93642652-93642674 CTGATGCGTGCTCCTGCAGCGGG - Intergenic
1132234049 15:100205984-100206006 CTGATCCCTGCTCCTCCCTCTGG + Intronic
1132542801 16:519179-519201 CTGGACCGTGCTCCACCCACAGG + Intronic
1134011919 16:10860193-10860215 CTAGTTCCTGCTCCTCCAGCTGG - Intergenic
1134019623 16:10912534-10912556 CTTGCCCGTGGTCCCCCAGCTGG + Intronic
1134065601 16:11226038-11226060 GTGTTCGCTGCTCCTCCAGCAGG - Intergenic
1137260255 16:46821469-46821491 CTGGTTCTTCCTCCTCCTGCAGG + Intronic
1137580419 16:49630488-49630510 CTGGGCGGTCCTCATCCAGCAGG - Intronic
1141216735 16:82032210-82032232 CTAGTCTCTGCTCCTGCAGCAGG + Intergenic
1142967431 17:3590318-3590340 CTGCTCCGTTCTCCACCAGGAGG + Exonic
1142982826 17:3681300-3681322 CTGATCCCTGCTTCTCCAGAAGG + Intronic
1143241210 17:5444696-5444718 CTGGTCCGTGCTCCTCCAGCTGG - Intronic
1145093986 17:20009233-20009255 CTGCGCCGTCCTCCTTCAGCCGG - Intergenic
1148437157 17:47693949-47693971 CTGCTCCGGGTTTCTCCAGCTGG - Intergenic
1148720562 17:49749822-49749844 CTGGTCCTTACTACTCTAGCTGG - Intronic
1148791173 17:50173826-50173848 ATGGGCCATGCTCCTCCTGCGGG - Intronic
1151560212 17:74865948-74865970 CTGGTCCCTCCTCCCCCACCTGG + Intronic
1152600065 17:81257801-81257823 CTCGTCCCCGCTCCCCCAGCGGG - Intronic
1153791896 18:8586494-8586516 CAGCTCTGTGCCCCTCCAGCTGG - Intergenic
1154008857 18:10558912-10558934 CTGGTCCGGGTGACTCCAGCCGG + Intergenic
1154496136 18:14962875-14962897 CTGGGCCCAGCTGCTCCAGCAGG - Intergenic
1156412092 18:36840315-36840337 CTGGTCCCTGTTACTCCATCTGG + Intronic
1157680007 18:49597665-49597687 CTGCTCCCTGCTGCCCCAGCTGG - Exonic
1160228886 18:77031769-77031791 CTGGTCCGTGCCTCTCCATTTGG + Intronic
1162790540 19:13060569-13060591 CTGGACTGGGCTCCTCCAACAGG - Intronic
1162802362 19:13118477-13118499 CGGTTCCGGCCTCCTCCAGCCGG + Intronic
1163596635 19:18224724-18224746 CTGTTCCGTCCGACTCCAGCGGG + Intronic
1166376684 19:42331339-42331361 CTGGCCCAGGGTCCTCCAGCTGG + Intronic
1166876574 19:45901552-45901574 CTGGCCCGTGCGCTTCCAGCTGG + Exonic
1167624516 19:50578660-50578682 CTGCGCCGAGCTCCTCCTGCAGG + Intergenic
925147273 2:1589459-1589481 GTGGTCTGTGCCCCTCCTGCAGG - Intergenic
926911313 2:17853975-17853997 CTGGTCAGCGCTCCTCCAACAGG + Intergenic
927520205 2:23693819-23693841 CAGGTATGGGCTCCTCCAGCTGG - Intronic
929782564 2:44966440-44966462 CTGGAAGCTGCTCCTCCAGCTGG - Intergenic
933632158 2:84671189-84671211 CTGGTCCCTGCTTCTCTAGCTGG + Intronic
933746953 2:85578502-85578524 CAGGGCCGTGCTCCGGCAGCTGG + Intronic
935151477 2:100440390-100440412 TTTGTCCATGATCCTCCAGCAGG - Intergenic
937896290 2:126979007-126979029 CTGGTGGGTGCTCTTCCATCAGG - Intergenic
938365451 2:130729727-130729749 AAGCTCCTTGCTCCTCCAGCTGG - Exonic
938449794 2:131407473-131407495 CTGGTCCGCTCCCCTCCAGGTGG - Intergenic
946673128 2:222127943-222127965 CTGGTCCGTGTTCCTTTAGTGGG - Intergenic
947109945 2:226707866-226707888 CTGGTCAGTGCTCCTACAAGGGG + Intergenic
947642124 2:231712713-231712735 CTGGTTCTTGCTCTGCCAGCAGG + Intronic
1170157932 20:13285507-13285529 CTGGTCCCTCCCCCTCCAGGAGG + Intronic
1173523536 20:43715984-43716006 CTGGTCCCTGGTCCCCCCGCAGG - Exonic
1173945856 20:46950498-46950520 CTGTTCCCTGCTCCTCCTTCTGG + Intronic
1176154682 20:63612701-63612723 CCGGTCTGTGATCCTCCACCTGG - Intronic
1178172151 21:30053411-30053433 CAGGTCCTTCCTCCTCCAGGTGG + Intergenic
1180699427 22:17773615-17773637 CCGCACTGTGCTCCTCCAGCCGG + Exonic
1180871249 22:19148563-19148585 CTGGCTCGTCCTCCCCCAGCGGG - Exonic
1181543041 22:23584110-23584132 CTGGGCCGGGCCTCTCCAGCAGG + Intergenic
1185086390 22:48743155-48743177 CTGGGCCGTGCTCCCGCAGGAGG + Intronic
949944390 3:9178655-9178677 CAGGCCAGTGCTCCTGCAGCAGG + Intronic
950442207 3:13016584-13016606 CTCCTCTGTGCTCCTCCTGCAGG + Intronic
952843327 3:37666559-37666581 ATGGTCTCTCCTCCTCCAGCAGG + Intronic
954109353 3:48425446-48425468 CTGGGCCCAGCTCCACCAGCAGG - Intronic
954501794 3:51024698-51024720 CTGGGCAGTGCTCCTCCTGTGGG + Intronic
958988490 3:100812330-100812352 CTTGTCTGTGCTCATCCAGTGGG - Intronic
959621986 3:108408714-108408736 CAGGTCTGTGTTCCTCCAGGTGG - Intronic
961392098 3:126558295-126558317 GTGGCCTGTGCTCCTCCTGCTGG + Intronic
962382813 3:134911074-134911096 CTGGTCCCTTTTCCTCCAGGTGG - Intronic
968652031 4:1763938-1763960 CTGGCCTGTGCTCATCCAGGAGG + Intergenic
968934205 4:3601494-3601516 GTGGTCAGTGCTCCAGCAGCCGG - Intergenic
969415227 4:7053507-7053529 CTGGCCCTTGCTTTTCCAGCGGG + Intronic
970712913 4:18885117-18885139 CTGTTCCCTCCTGCTCCAGCAGG - Intergenic
979195457 4:117915804-117915826 CTGGAGGGTGCTCCTCCAGTGGG + Intergenic
985746770 5:1652449-1652471 CAGTTCCGTGCTTCTCCAGAGGG + Intergenic
986028356 5:3871964-3871986 CTGCTCCCGGCTCCTGCAGCAGG - Intergenic
988346253 5:30041746-30041768 CTGTTCCTGGCTCCACCAGCTGG - Intergenic
988828694 5:34967250-34967272 CTGGTCCTTGAGCCTCCAGGTGG + Intergenic
991258193 5:64638275-64638297 CTTGTCACTGCTCCTCCTGCTGG - Intergenic
993891316 5:93477973-93477995 CTGGGACTTGCTCCTCAAGCTGG + Intergenic
996542729 5:124647325-124647347 CAGGTCGGTGCCCCTGCAGCTGG - Exonic
998322423 5:141245421-141245443 CTGGTCCGTGCTCTGCTAACAGG - Exonic
1001878096 5:175218176-175218198 CTGGGCTGTGGTCCTCCAGCTGG + Intergenic
1002104772 5:176874605-176874627 CTGTCCCGTCCTCCTCCAGGAGG - Intronic
1002329370 5:178430953-178430975 CTGCCCTGTGCTCCTGCAGCAGG - Intronic
1004216731 6:13711144-13711166 GGGGTCGGGGCTCCTCCAGCCGG + Exonic
1004610350 6:17233692-17233714 GTGGTCTCTCCTCCTCCAGCAGG - Intergenic
1007105321 6:39279732-39279754 CTGTTCTGTGCTACTCCAGTGGG - Intergenic
1007464400 6:42041848-42041870 CTGGTCCTCCCTCCTCCATCTGG + Intronic
1008893910 6:56529588-56529610 CAGGTCTGAGCTCCTCCAGCAGG - Exonic
1019083123 6:169449708-169449730 CAGGACCTTGCTCCTCCTGCCGG - Intergenic
1020651396 7:10880962-10880984 CTTGCCCTTGCTGCTCCAGCTGG + Intergenic
1024766336 7:52665483-52665505 CTGGTCCCTCCTCCTCCATATGG + Intergenic
1025220032 7:57099515-57099537 CAGGGCAGGGCTCCTCCAGCTGG + Intergenic
1025651660 7:63475519-63475541 CAGGGCAGGGCTCCTCCAGCTGG - Intergenic
1026019145 7:66694595-66694617 CTGGGCCCTGCCCCTCCAGCTGG - Intronic
1026051791 7:66952935-66952957 CTGAACCCTGCCCCTCCAGCAGG - Intronic
1028961208 7:96751404-96751426 CTGGTCAGTGGTCCTCATGCAGG - Intergenic
1033716992 7:144012387-144012409 CTGGTCTCTTATCCTCCAGCAGG + Intergenic
1034610880 7:152367299-152367321 CAGGTCAGGGCTCCTCCAGCTGG - Intronic
1035168041 7:157003209-157003231 CCGGCCCCTGCGCCTCCAGCAGG - Intronic
1037717374 8:21411733-21411755 CTGTCCCCAGCTCCTCCAGCTGG - Intergenic
1044364470 8:91326798-91326820 CTGGTCCATGCTCCCTCTGCAGG + Intronic
1051500843 9:17776103-17776125 CTCATCCTTGCTCTTCCAGCAGG + Intronic
1052807337 9:33025007-33025029 CTGGGCCATGCCCCACCAGCCGG + Intronic
1053503451 9:38621049-38621071 CTAGGCCGTGCTCCACCACCTGG - Intergenic
1056983611 9:91340763-91340785 CTGACCCCTGCTCCTCCAGCTGG + Intronic
1058961932 9:109999685-109999707 CTGGTCGATGCTGCTTCAGCGGG - Intronic
1059437543 9:114285644-114285666 CTGAGCTGTCCTCCTCCAGCAGG - Intronic
1061274380 9:129561169-129561191 CTGGTCTGGGTTCCCCCAGCTGG + Intergenic
1061726490 9:132584783-132584805 GTGGTCCTTGCTCCTCCCCCGGG + Intronic
1189382699 X:40513101-40513123 CTGGGCCCTCATCCTCCAGCAGG + Intergenic
1190691341 X:52915842-52915864 CTGCTCTGTGCTCCCCCAGCAGG - Intergenic
1190694642 X:52939950-52939972 CTGCTCTGTGCTCCCCCAGCAGG + Intronic